ID: 1083710467

View in Genome Browser
Species Human (GRCh38)
Location 11:64545319-64545341
Sequence GTCCCAGAGCAGCATGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083710467_1083710472 9 Left 1083710467 11:64545319-64545341 CCTTTCCCATGCTGCTCTGGGAC No data
Right 1083710472 11:64545351-64545373 ATTTCCTTTCTGGATCCACTTGG No data
1083710467_1083710476 22 Left 1083710467 11:64545319-64545341 CCTTTCCCATGCTGCTCTGGGAC No data
Right 1083710476 11:64545364-64545386 ATCCACTTGGATTTGGTTGGAGG No data
1083710467_1083710478 25 Left 1083710467 11:64545319-64545341 CCTTTCCCATGCTGCTCTGGGAC No data
Right 1083710478 11:64545367-64545389 CACTTGGATTTGGTTGGAGGAGG No data
1083710467_1083710475 19 Left 1083710467 11:64545319-64545341 CCTTTCCCATGCTGCTCTGGGAC No data
Right 1083710475 11:64545361-64545383 TGGATCCACTTGGATTTGGTTGG No data
1083710467_1083710470 -1 Left 1083710467 11:64545319-64545341 CCTTTCCCATGCTGCTCTGGGAC No data
Right 1083710470 11:64545341-64545363 CTGCCAAACTATTTCCTTTCTGG No data
1083710467_1083710474 15 Left 1083710467 11:64545319-64545341 CCTTTCCCATGCTGCTCTGGGAC No data
Right 1083710474 11:64545357-64545379 TTTCTGGATCCACTTGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083710467 Original CRISPR GTCCCAGAGCAGCATGGGAA AGG (reversed) Intergenic
No off target data available for this crispr