ID: 1083711947

View in Genome Browser
Species Human (GRCh38)
Location 11:64554983-64555005
Sequence CGGGGCTGGCCTCAGATGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083711942_1083711947 -8 Left 1083711942 11:64554968-64554990 CCCGGAGCCTGGAAGCGGGGCTG No data
Right 1083711947 11:64554983-64555005 CGGGGCTGGCCTCAGATGCTGGG No data
1083711938_1083711947 -3 Left 1083711938 11:64554963-64554985 CCTCGCCCGGAGCCTGGAAGCGG No data
Right 1083711947 11:64554983-64555005 CGGGGCTGGCCTCAGATGCTGGG No data
1083711935_1083711947 24 Left 1083711935 11:64554936-64554958 CCATGGGGGAGGGCTGGCTTCAC No data
Right 1083711947 11:64554983-64555005 CGGGGCTGGCCTCAGATGCTGGG No data
1083711943_1083711947 -9 Left 1083711943 11:64554969-64554991 CCGGAGCCTGGAAGCGGGGCTGG No data
Right 1083711947 11:64554983-64555005 CGGGGCTGGCCTCAGATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083711947 Original CRISPR CGGGGCTGGCCTCAGATGCT GGG Intergenic