ID: 1083712453

View in Genome Browser
Species Human (GRCh38)
Location 11:64557568-64557590
Sequence GGTGCTGAGGGGCCAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 437}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083712449_1083712453 -5 Left 1083712449 11:64557550-64557572 CCAGTGTGTCTGCGCACAGGTGC 0: 1
1: 0
2: 1
3: 20
4: 194
Right 1083712453 11:64557568-64557590 GGTGCTGAGGGGCCAGAAGCAGG 0: 1
1: 0
2: 3
3: 34
4: 437
1083712448_1083712453 -4 Left 1083712448 11:64557549-64557571 CCCAGTGTGTCTGCGCACAGGTG 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1083712453 11:64557568-64557590 GGTGCTGAGGGGCCAGAAGCAGG 0: 1
1: 0
2: 3
3: 34
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083712453 Original CRISPR GGTGCTGAGGGGCCAGAAGC AGG Intronic
900094780 1:935929-935951 GGGGCTGTGGGGCCAGAGGACGG + Intronic
900150603 1:1177731-1177753 GGTGCTGAGGGCCCATGAGAAGG + Intronic
900352322 1:2241084-2241106 GATGCTGTGGGCCCAGAAGGTGG + Intronic
900360596 1:2287077-2287099 GCTGCTGTGGGGCCTGCAGCTGG - Intronic
900641790 1:3691090-3691112 GGCGTTGAGGGGCTAGAGGCAGG + Intronic
901391904 1:8951587-8951609 CGTGCTGAGGGCCCAGAAGAGGG + Intronic
901757167 1:11448427-11448449 TGTGCAGAGGGGACTGAAGCGGG + Intergenic
902104988 1:14027476-14027498 GGTGGCGGGGGGGCAGAAGCCGG - Intergenic
902466546 1:16622032-16622054 GGAGCTGATGGCCCAGAAGCTGG - Intergenic
902508113 1:16951014-16951036 GGAGCTGATGGCCCAGAAGCTGG + Exonic
902863597 1:19262853-19262875 GGTGCTGAGGGGTCCTAAGGTGG - Intergenic
903090733 1:20913916-20913938 GCTGCTGAGGAGGCTGAAGCAGG - Intronic
903330991 1:22597293-22597315 GGTGCTGAGGGGCGGGAGGAGGG - Exonic
903818468 1:26082490-26082512 GCTGCTCAGGGGGCTGAAGCGGG + Intergenic
904609461 1:31717125-31717147 GCTGCAGAGGGTGCAGAAGCTGG + Intergenic
905472992 1:38207226-38207248 GGTGCTCAGGGTCCTGGAGCTGG + Intergenic
906056676 1:42923568-42923590 GGTGATGAGTGGCCAGCAGTAGG + Intergenic
906113132 1:43337884-43337906 GGTTTTGAGGGGCCAGGAGGAGG - Exonic
906345311 1:45010985-45011007 GGCGCGGAGGGGCCCGGAGCCGG + Exonic
907120008 1:52000081-52000103 GGGACAGAGGGGCCAGAAGAAGG + Intergenic
907427119 1:54386930-54386952 GGTGCTGACAGGCAAGAAGGAGG - Intronic
910450034 1:87335152-87335174 GGAGCTGAGGGGTCGGGAGCCGG - Intronic
911181338 1:94863190-94863212 GATGCAGAGGTTCCAGAAGCTGG - Intronic
911802424 1:102158820-102158842 GGTGCTCAGGAGACTGAAGCAGG + Intergenic
912800753 1:112718683-112718705 GGTGCTGGGGGGAAAGGAGCTGG - Intergenic
915623069 1:157097985-157098007 GGAGCTGAGGGGTGAGAAGTAGG + Exonic
916720039 1:167477899-167477921 GGTGCTGATGGGGCAGTTGCTGG + Intronic
917080542 1:171252803-171252825 GGGGGTGAGGGGACAGAAGAGGG + Intronic
917526545 1:175793269-175793291 GGTGCTGTGGGGCCACATGAGGG + Intergenic
917968961 1:180195236-180195258 GTCCCTGAGAGGCCAGAAGCAGG + Intronic
920251431 1:204624768-204624790 GGAGCTGAGGGTCCAGAGGGAGG + Intronic
920381435 1:205536716-205536738 GGTTCTGAGGGTCCGGAAGAGGG - Intergenic
921438983 1:215161560-215161582 GGTGCTAAGGGGCCAGGGGAGGG - Intronic
922421136 1:225461900-225461922 GGGGCTGAGGGGACAGGGGCAGG - Intergenic
922973933 1:229768244-229768266 GGTGGTGAGGGGCAAGAGGAGGG - Intergenic
923102347 1:230826561-230826583 GGAGGTGAGGGGGCAGAAGGTGG - Intergenic
923518080 1:234714107-234714129 GGGGCTGGGGGACGAGAAGCAGG - Intergenic
1063123881 10:3123717-3123739 GGTGCTGAGGGGCCACATCCTGG + Intronic
1063178175 10:3570874-3570896 GGGGCTGAGGGGCCACAGGAAGG + Intergenic
1065845572 10:29739920-29739942 GGTGCTGTGGGAGCAGAAGGGGG - Intergenic
1066551672 10:36565290-36565312 GTTGCTCAGGAGCCTGAAGCAGG - Intergenic
1066617224 10:37307710-37307732 GGTGCTGCAGGGACAGATGCTGG + Intronic
1070784743 10:79156379-79156401 CGTCCTGAGGGCCCAGCAGCAGG + Intronic
1071181867 10:82995578-82995600 GGTTCTTAGGGGGCTGAAGCAGG - Intergenic
1072553316 10:96495239-96495261 GGGGTGGAGGGGCCAGAGGCGGG + Intronic
1073115876 10:101091363-101091385 GGGCCTGAGGGGGCAGAATCAGG + Intronic
1075613709 10:123875368-123875390 GGAGGTGAGGGGCCAGAACTGGG - Intronic
1076222197 10:128743248-128743270 GGGACAGAGGGGCCAGAGGCAGG + Intergenic
1076351273 10:129816493-129816515 GGTGCGGAGATGGCAGAAGCCGG - Intergenic
1076562467 10:131376121-131376143 AGTGATGAGGGGGCAGGAGCGGG + Intergenic
1076849537 10:133086282-133086304 GGTGCTGTGGGGGCAGAGGGAGG - Intronic
1077284051 11:1758085-1758107 GGGGCGGAGGGGGCAGAAGAGGG + Intronic
1077299398 11:1840162-1840184 GGTGCTGGGAGGCCAGAGGCTGG - Intronic
1077338726 11:2016690-2016712 GGTGGGGAGGGGCCAGGTGCAGG - Intergenic
1077641816 11:3888134-3888156 GCTGCTATGGGGCCAGAAACAGG + Intronic
1077678536 11:4219045-4219067 GGTGCTGGGGAGTCAGAGGCTGG - Intergenic
1077682094 11:4251287-4251309 GGTGCTGGGGAGTCAGAGGCTGG + Intergenic
1077687939 11:4315448-4315470 GGTGCTGGGGAGTCAGAGGCTGG - Intergenic
1078191114 11:9092839-9092861 GGTACTGAGGGTGCAGAGGCTGG - Intronic
1078325995 11:10381194-10381216 AGTGCTGAGGGGACATAAGAAGG + Intronic
1078552658 11:12291051-12291073 TCCGCTGAGTGGCCAGAAGCAGG + Intronic
1079166825 11:18051969-18051991 GGTGCTTAGGGGCTAGATGTGGG - Intergenic
1079396642 11:20069327-20069349 GGTGGAGAGGGGACAGAAGTAGG + Intronic
1079451048 11:20599929-20599951 GGTGCTGAAAAGCCAGATGCCGG + Intronic
1079925562 11:26488052-26488074 GCTGCTGAGGAGGCTGAAGCAGG + Intronic
1081631176 11:44691044-44691066 GGATCTCAGGGGCCAGAAGCAGG + Intergenic
1082654744 11:55840087-55840109 GCTACTGAGGGGCCTGAGGCAGG - Intergenic
1083151366 11:60793812-60793834 GGGGCTGAGGGGCCAGTGACAGG + Intronic
1083712453 11:64557568-64557590 GGTGCTGAGGGGCCAGAAGCAGG + Intronic
1083887663 11:65580780-65580802 GGTGGTGAGGGATCAGGAGCCGG - Intronic
1084173255 11:67410547-67410569 GGTCCCGAGGGGGCAGACGCAGG - Intronic
1084208631 11:67610743-67610765 GGTGCGGAGGGGACCGAGGCAGG - Intronic
1084223632 11:67700515-67700537 GGAGCAGAAGGGGCAGAAGCTGG - Intergenic
1084275215 11:68047824-68047846 GGTGCTGCGGGGCCCCCAGCCGG - Intronic
1085386877 11:76162668-76162690 GGGGCTGAGGGGAAAGAGGCAGG - Intergenic
1085471439 11:76760952-76760974 GGTGCTGATGGGCATGATGCTGG + Intergenic
1085865950 11:80292452-80292474 AGTGGTGAGGGGCCAAAAACAGG + Intergenic
1086544965 11:87957291-87957313 GGGGGTGAGGGGAGAGAAGCAGG - Intergenic
1086660175 11:89406474-89406496 GGCGGTGTGGGGCAAGAAGCAGG - Intronic
1087084162 11:94199588-94199610 TGTGCAGAGAGGCCAGAAGTTGG - Intergenic
1088740477 11:112762925-112762947 CGTGCTCAGGAGCCAGAAGATGG + Intergenic
1088743509 11:112785794-112785816 GGTGTTGATGGGCCTGGAGCTGG - Intergenic
1089114361 11:116082344-116082366 GATGCGGTGGGGCCAGAATCTGG - Intergenic
1089147848 11:116343336-116343358 GGCGGTGATGGGCCAGAAGGAGG + Intergenic
1089646621 11:119884596-119884618 GGTCCTGAGGGGTCAGACACTGG - Intergenic
1202821710 11_KI270721v1_random:71872-71894 GGTGGGGAGGGGCCAGGTGCAGG - Intergenic
1091758529 12:3072049-3072071 GGTACTGCTGGGCCAGAAGGTGG - Intergenic
1093588502 12:20871740-20871762 TGTGCTGAGCTGCCAGAAACTGG + Intronic
1094523775 12:31218733-31218755 GGTGTGGAGGGGGCAGATGCAGG + Intergenic
1096240133 12:49955497-49955519 AGTGCTGAAGGGCCTGGAGCCGG + Exonic
1096467156 12:51852978-51853000 GGGGCTGAAGGGAGAGAAGCAGG - Intergenic
1096781797 12:53996099-53996121 GGTGCTGACGAGCCGGGAGCGGG + Intronic
1096788016 12:54029060-54029082 CGAGCTGAGGGGGCAGAAGAGGG - Intronic
1097255949 12:57674742-57674764 GGTGCTGCTGGGCCGGAAGGTGG + Intergenic
1097438410 12:59578952-59578974 GGTGCTCAGGGGACTGAAGCTGG + Intergenic
1098385068 12:69909799-69909821 GGTCCTGAAGGGCCAGCAGTTGG + Intronic
1099154438 12:79157119-79157141 GGTGCAGAGGTGGCAGGAGCAGG - Intronic
1100308668 12:93374810-93374832 GGTACTGAGGAGGCTGAAGCAGG - Intergenic
1100831009 12:98516313-98516335 GGAGCGGAGAGGCCAGAAGTTGG + Intronic
1102074393 12:110048363-110048385 GGTGCTGCGAGGGCAGAACCTGG - Intronic
1103527897 12:121579712-121579734 GGGGCTGAGGGGCCGGGCGCTGG - Intronic
1103735697 12:123059466-123059488 GGTGCTAAAGGGCCAGAAGGTGG - Intronic
1104498839 12:129265660-129265682 GGTGTTGAGGAGCCCCAAGCAGG - Intronic
1104768310 12:131344993-131345015 GGAGCTGAGTGACCAGCAGCAGG - Intergenic
1104814651 12:131638726-131638748 GGTGGTGAGGGGACAGATGAGGG + Intergenic
1104969693 12:132525630-132525652 GGTGCTGGGGTGCCGGGAGCAGG + Intronic
1107073560 13:36297739-36297761 GGTGCTGAGGGGAAAGACGCGGG - Exonic
1107088165 13:36447968-36447990 GGTGCTGAGGGGAGAGAATGGGG + Intergenic
1107491012 13:40879884-40879906 GGTGCTGTGGGCTCAGAAGTGGG + Intergenic
1107682153 13:42863275-42863297 GGCTCTGAGAGGCAAGAAGCTGG + Intergenic
1107906796 13:45068856-45068878 GGTGCTGAGGAGGCAGGAGATGG + Intergenic
1110120174 13:71870164-71870186 GGAGGGGAGGGGCCAGAAGGGGG - Intergenic
1112247110 13:97745351-97745373 GGTGCTGAGAGGGCAGGGGCTGG + Intergenic
1112300212 13:98223126-98223148 GCAGCTGATGGGACAGAAGCAGG + Intronic
1113312131 13:109141266-109141288 GCTGCTGAGAGGCCTGGAGCTGG - Exonic
1113674124 13:112196373-112196395 GGTGCTGAGGAGGCAGGAGCAGG - Intergenic
1116592343 14:46794183-46794205 AGAGCTGAGCGGCCAAAAGCTGG - Intergenic
1117313461 14:54551178-54551200 GGTGCTGCTGGGCCTGGAGCTGG - Intergenic
1117500787 14:56349070-56349092 GGAGCTGAGGGTCCAGAAAGTGG - Intergenic
1119789958 14:77341343-77341365 GTTGTTGAGGTGCCAGAAGAGGG - Exonic
1119887153 14:78152658-78152680 GGTGCTGAGAGGCAGGAAGAAGG - Intergenic
1121333015 14:93059829-93059851 GGGGGTGAGGGTCCCGAAGCAGG + Intronic
1121438685 14:93935237-93935259 GGTGCTGAGAGGCCAGGATAAGG + Intronic
1121513582 14:94533997-94534019 GCTGATGAGGGGCCAGAACTAGG + Intergenic
1121674207 14:95739360-95739382 GGTGCTGGGGGGCCAGGGGTAGG - Intergenic
1122273917 14:100581463-100581485 GGGGCTGCGGTGCCAGGAGCCGG - Intronic
1122359612 14:101151604-101151626 CGGGCTGAGGGACAAGAAGCCGG + Intergenic
1122374799 14:101250655-101250677 GGTGCTGGGGGTGCAGAGGCAGG + Intergenic
1122767493 14:104082158-104082180 GGTGAGGGGAGGCCAGAAGCTGG - Intergenic
1124371171 15:29105597-29105619 GGAGCTCAGGGAGCAGAAGCTGG - Intronic
1124466148 15:29941570-29941592 GGTGTTGAGGGGGCAGAGGGGGG - Intronic
1124706675 15:31972295-31972317 GCTGCTGAGTGGCCAGCAGGCGG - Intergenic
1125571961 15:40726978-40727000 TGTGCTTAGGCTCCAGAAGCAGG - Intronic
1125575852 15:40755057-40755079 GGGGTTGAAGGCCCAGAAGCCGG - Exonic
1125652929 15:41332374-41332396 GGGGCTGAGGAGCCAGCCGCCGG - Exonic
1125722080 15:41850035-41850057 TGTGCTGAGCCTCCAGAAGCTGG - Intronic
1125725442 15:41866106-41866128 GGCCCTCAGGGGCCAGGAGCTGG - Exonic
1125759722 15:42088364-42088386 GCAGCTGAGTGGGCAGAAGCTGG + Intronic
1125807061 15:42502707-42502729 GGGGCTCAAGAGCCAGAAGCTGG - Intronic
1126736203 15:51734361-51734383 GGTGCTGAAGGGCTGGCAGCAGG - Intronic
1126852172 15:52804157-52804179 GGTGGTGAGGGGGAAGAAGTAGG - Intergenic
1128511032 15:68314021-68314043 GGAGAGGAAGGGCCAGAAGCAGG + Intronic
1128639211 15:69323457-69323479 GGTGCTCCTGGGCCAGAGGCAGG + Intronic
1128764617 15:70243563-70243585 GGTGCTGGTGGGTGAGAAGCAGG + Intergenic
1128986858 15:72228695-72228717 GGTGCTGTGGGGGCAGGAGTGGG - Intronic
1129064370 15:72888934-72888956 GCTGCTGAGGCCTCAGAAGCAGG + Intergenic
1129410584 15:75348331-75348353 GGTGGTGAGCGGCCAGATCCAGG + Intronic
1129707380 15:77802469-77802491 CCTGCAGAGGGGCCAGGAGCAGG + Intronic
1130229076 15:82082625-82082647 TGTGATGAGGGCCCAGAAGAAGG - Intergenic
1130903371 15:88223523-88223545 TATGCCCAGGGGCCAGAAGCAGG + Intronic
1131092629 15:89633862-89633884 GGTGCTGAAGGAGAAGAAGCAGG - Exonic
1131253359 15:90845399-90845421 GGTGATGATGAGCCAGAGGCGGG + Intergenic
1131961288 15:97792540-97792562 GATGGAGAGGGGCCAGGAGCTGG + Intergenic
1132769546 16:1553650-1553672 GGTGCTGGGTGGGCAGAAGCGGG + Intronic
1132802309 16:1760446-1760468 GGTGCTGAGGGGCGAGTTGGAGG + Exonic
1132891998 16:2209147-2209169 GCTGCTGAGGGGTCTGAGGCTGG + Exonic
1133303158 16:4795370-4795392 GGTGGTGTGGAGCCGGAAGCAGG + Intronic
1134187511 16:12096369-12096391 GGTGCTGAGGAGCCAGAGGTGGG + Intronic
1134626886 16:15728786-15728808 GCTGCTGAGGAGGCTGAAGCAGG + Intronic
1135054353 16:19218670-19218692 GGTATTGAGGGCCCAGAAGATGG + Intronic
1135508234 16:23058340-23058362 CGTGCTCAGGGTCCAGGAGCAGG - Intergenic
1136535466 16:30896673-30896695 GGGGCTGAGGGACCGGACGCCGG + Intronic
1136751161 16:32637581-32637603 GGTGCTGCGGGGCTGGATGCAGG + Intergenic
1137496812 16:48975902-48975924 GTTGCTGAGGGGCCAGTAGCAGG + Intergenic
1138394714 16:56695306-56695328 GTTCTTGGGGGGCCAGAAGCAGG + Intronic
1139286307 16:65817470-65817492 GGTGCGGAGAGGCCTGAAGTTGG - Intergenic
1139658265 16:68402318-68402340 GGTGCTGAGGGCCAGGAGGCAGG + Intronic
1142192220 16:88723271-88723293 GGTGCTGAGGCGGCGGCAGCAGG - Exonic
1142391602 16:89804667-89804689 GGTGCTGAGAGACCAGAGGATGG - Intronic
1142399131 16:89850213-89850235 GGTGCAGAGGGCCCAGCACCCGG - Intronic
1203053295 16_KI270728v1_random:896836-896858 GGTGCTGCGGGGCTGGATGCAGG + Intergenic
1142496032 17:306794-306816 GGCCCTGAGGGGTAAGAAGCAGG - Intronic
1142713138 17:1734149-1734171 CGTGCTGCGGGGCCTCAAGCTGG - Exonic
1142713969 17:1738047-1738069 GGGGCTGAGGGGCTAGAGACCGG - Exonic
1143042561 17:4049712-4049734 GGTGCTGAGCTGTCAGAAGCAGG - Exonic
1144422091 17:15107999-15108021 GATGCTGTTGGGTCAGAAGCAGG + Intergenic
1144462838 17:15471750-15471772 GCTACTCAGGGGGCAGAAGCAGG + Intronic
1144993575 17:19250826-19250848 GGTGCAGGGGGGCAAGTAGCAGG - Intronic
1145089986 17:19978123-19978145 GGTACCCAGGGGCCGGAAGCCGG - Intronic
1147119600 17:38328209-38328231 GATGCTGATGGACCAAAAGCTGG - Exonic
1147272405 17:39284490-39284512 GCTGCTCAGGGGACTGAAGCAGG - Intronic
1148051075 17:44770153-44770175 GGTGCTGAGGGGCCAGGCCCAGG - Intronic
1148127473 17:45244241-45244263 GGAGGTGAGGGGCCAGGAGGTGG + Exonic
1148166960 17:45490509-45490531 AGGGCTGAGGGCCCTGAAGCCGG + Intronic
1148495053 17:48048540-48048562 GGTGCTGAGGTGCAGGAGGCGGG + Intronic
1148793187 17:50184980-50185002 GGTGCTGGGCGGGCAGGAGCGGG + Exonic
1148860204 17:50600655-50600677 TCTGCTGAGGAGCCAGGAGCCGG + Intronic
1149048009 17:52270035-52270057 GGTGCTGAGGGACCAGAAAAGGG + Intergenic
1149658482 17:58322737-58322759 GGAGCTGAGGGGCCAGCTCCTGG - Exonic
1151348228 17:73516299-73516321 GGTGCCGAGGGCCCAGGAGGAGG + Intronic
1152132511 17:78485625-78485647 GGTGCTGATGGGGGACAAGCTGG - Exonic
1152630669 17:81409455-81409477 GGTTCTGGAGGGCCAGGAGCGGG + Intronic
1152645913 17:81468442-81468464 GGTGTTGCGGGGCCAGAGCCAGG - Intergenic
1152745556 17:82037133-82037155 GGGACTGTGGGGCCAGCAGCCGG + Intronic
1152928543 17:83098866-83098888 CCTGCTGAGGGGCCAGAGTCCGG + Intergenic
1153285270 18:3450432-3450454 GGTCTGGAGGGGCCAGGAGCGGG - Intronic
1153582952 18:6593832-6593854 GGTGCTGGGGGGTCAGGAGAAGG + Intergenic
1153787250 18:8545900-8545922 GGTGCTCAGTGGCCTGGAGCTGG + Intergenic
1154009907 18:10565537-10565559 GGTGCTGTGGGGCCAAAGGCAGG - Intergenic
1156024811 18:32640170-32640192 GGTGCTCAGGAGACAGAGGCAGG - Intergenic
1156257421 18:35411060-35411082 GGTGCTGAAGTGACAGAAGGTGG + Intergenic
1156702930 18:39846044-39846066 GCTGCTCTGGTGCCAGAAGCTGG + Intergenic
1157157274 18:45280384-45280406 GGTGTTAAGGGGCCACAAGCAGG + Intronic
1157335114 18:46732348-46732370 GGTGCTGAGAGGCCTGAACTGGG - Intronic
1157947599 18:51998267-51998289 GGTGCTGAGTGGGAAGAAGGAGG + Intergenic
1158395717 18:57077265-57077287 GGTGCTGAGGAGCCAGTCTCTGG + Intergenic
1158899555 18:61950003-61950025 GTTGCTGCGGAGTCAGAAGCAGG - Intergenic
1159446431 18:68546004-68546026 GGTGCTGAGTTGCCTGGAGCTGG - Intergenic
1160690316 19:458413-458435 GGTCCTGGGGAGGCAGAAGCGGG + Intronic
1160690482 19:458857-458879 GGTCCTGGGGAGGCAGAAGCCGG + Intronic
1160706378 19:532062-532084 GGTGTTGGGGGGCCCGAAGATGG - Exonic
1160856822 19:1221520-1221542 GGTGAACAGGGCCCAGAAGCAGG - Intronic
1160865423 19:1253935-1253957 GGGGCTGTGGGGACAGAGGCGGG - Intronic
1160952785 19:1675604-1675626 GGTCTTGGGGGGCCAGAGGCGGG + Intergenic
1161720389 19:5899016-5899038 GGGGCTGCTGGGCCAGGAGCAGG - Intronic
1162064617 19:8117429-8117451 GGTGCCCAGGGGCCAGCAGGTGG + Intronic
1162397477 19:10425433-10425455 GGTGCTGGGCAGCCAGGAGCTGG + Intronic
1162420185 19:10561743-10561765 GGGGCTGAGGGGCCTGGGGCTGG - Intronic
1163440018 19:17317891-17317913 GGAGCTGGGGCACCAGAAGCGGG - Intronic
1163531997 19:17855453-17855475 AGTGCTGAGCGGCTACAAGCAGG - Intergenic
1163566702 19:18056114-18056136 GGTAAAGAGGGGCCAGAAGAGGG - Intergenic
1163627068 19:18396367-18396389 GATGCCGAGTGGCCAGAAGCCGG - Exonic
1163672639 19:18637566-18637588 GGTGCTGAAGGGCCCCAAGGTGG + Intronic
1163799599 19:19356558-19356580 GCTGCTGAGGGGCAGGAAGCGGG + Exonic
1163916510 19:20245134-20245156 GGTGCTGTGGGCTCAGAAGTGGG - Intergenic
1164762622 19:30739322-30739344 GGTGAGGAGGGGGCAGCAGCAGG - Intergenic
1164977054 19:32581282-32581304 GGCGCTGAGGAGACAGAGGCTGG + Exonic
1165077277 19:33286867-33286889 GATGCTGAGGCCCCAGAAGCTGG + Intergenic
1165467859 19:35985763-35985785 AGTGAAGAGGGGCCAGCAGCGGG - Intergenic
1165902199 19:39174176-39174198 GGTGCTGTGAGGACAGAGGCAGG - Intronic
1166364324 19:42270741-42270763 GGTGCTGTGGGGGGAGGAGCAGG + Intronic
1166502917 19:43354364-43354386 GGGGCTGTGGGGCCCAAAGCGGG - Exonic
1166538934 19:43593116-43593138 GGTGCTGTGGGGACCGAAGCAGG + Exonic
1167162652 19:47778334-47778356 GGCGCGGTGGGGACAGAAGCAGG - Intergenic
1167224602 19:48229205-48229227 GGTGAAGACGGGCCAGAAACAGG + Intronic
1167289385 19:48615991-48616013 GGATCTGGGAGGCCAGAAGCTGG - Intronic
1167503105 19:49858224-49858246 GGAGCTGAGGGTGCTGAAGCAGG + Intronic
1167747982 19:51364024-51364046 GGTGCTGGGGAGCCACAGGCAGG + Intronic
1168101914 19:54145891-54145913 TGTGCTGTGGGGGCAGAAGAAGG - Exonic
1168309591 19:55453693-55453715 TGAGCTGAGGGCCCAGAAGAGGG - Intronic
926891612 2:17643908-17643930 GGAGCCGGGGGACCAGAAGCTGG + Intronic
926892406 2:17649759-17649781 GCTGCAGCGGGGACAGAAGCAGG - Intronic
928484226 2:31712714-31712736 TGTGCTGAGTTGCCTGAAGCTGG - Intergenic
930205450 2:48583198-48583220 GGTACTGAGGAGGCTGAAGCAGG - Intronic
930393282 2:50788196-50788218 GCTGCTCAGGAGGCAGAAGCAGG - Intronic
932536549 2:72603358-72603380 GGTGCTGGGGGGCCAGGGGAGGG - Intronic
932594004 2:73083116-73083138 AGTCCTGAAGGGGCAGAAGCCGG + Intronic
932760804 2:74438120-74438142 GCTGCTGAGAGGTCAGAGGCAGG - Intronic
933143525 2:78822843-78822865 CATGGTGAGGGGCCTGAAGCCGG - Intergenic
936511183 2:113148993-113149015 TGTGCTGAGTGGCCTAAAGCTGG + Intergenic
939837310 2:147146807-147146829 GGGGTTGGGGGGCCAGAAGAAGG - Intergenic
945761899 2:213924074-213924096 GGGACTGATGGGCTAGAAGCTGG + Intronic
946192032 2:218012625-218012647 GGGGGTGGGGGGCCAGAAGTTGG - Intergenic
946412064 2:219520392-219520414 GGTGCTAAGGAGCCCGAAACTGG - Intronic
946481279 2:220059210-220059232 GGTGCTGAGGAGGCTGAGGCAGG - Intergenic
946495181 2:220189464-220189486 GGCCCTCAGGGGCCAGAGGCTGG + Intergenic
947300295 2:228681901-228681923 GGTGCTGATGGGACAAAAGCTGG + Intergenic
947734605 2:232448164-232448186 TGTGCTCTGGGGACAGAAGCAGG + Intergenic
948438807 2:237972301-237972323 GTTGGTGATGGGCCAGAACCTGG + Intronic
948615949 2:239199097-239199119 GGTGGTGGGGGGCAGGAAGCAGG - Intronic
948976587 2:241467141-241467163 GGTACTCAGGGGGCTGAAGCAGG + Intronic
1168955739 20:1832994-1833016 AGGGCGGAGGGCCCAGAAGCTGG + Intergenic
1169499877 20:6148772-6148794 GGTGGTGAGTGGCCAGGAGCTGG + Intergenic
1169640494 20:7745339-7745361 GCTGCTCAGGGGCCTGAGGCAGG + Intergenic
1170867777 20:20175219-20175241 GGTGCTAAGGAGCAAGAAGGAGG - Intronic
1171128446 20:22625622-22625644 GTTACTGAGGAGCCTGAAGCAGG - Intergenic
1171235507 20:23521087-23521109 GGTTCTGAAGAGCCAGGAGCAGG + Intergenic
1171240666 20:23565008-23565030 GGTGCTGATGGTGAAGAAGCAGG + Exonic
1172028700 20:31967286-31967308 GATCCTAAGGGGCCAGAAGGTGG - Intergenic
1172367878 20:34363660-34363682 GGGGCTGAGGGGCGAGGGGCCGG - Intronic
1172390264 20:34560811-34560833 GGGGCTGTGGGGCCAGAAGCTGG - Exonic
1172813655 20:37669714-37669736 GGGGCTGTGAGGGCAGAAGCTGG + Intergenic
1173258682 20:41413838-41413860 AGTGCTGTGGGGACAGGAGCTGG - Intronic
1173625674 20:44471111-44471133 GCTGCTCAGGAGGCAGAAGCAGG - Intergenic
1174066025 20:47866706-47866728 GGTGCTGAGCGGTCAGAGGGTGG - Intergenic
1174157988 20:48528947-48528969 GGTGCTGAGCGGTCAGAGGGTGG + Intergenic
1174736902 20:52973253-52973275 GGGGCTGGGGCGCCAGAAGTGGG + Exonic
1174757034 20:53169320-53169342 GACGTTGAGAGGCCAGAAGCTGG - Intronic
1175477362 20:59286318-59286340 GGGGCAGAGGGCCCAGCAGCTGG + Intergenic
1175787835 20:61723311-61723333 GGTGCTGAGGAGCCAGGACGGGG - Intronic
1175835192 20:61989263-61989285 GGTGTTGAGAGGCCAGGATCGGG - Intronic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1176076975 20:63253156-63253178 GGTGGGGAGGGGCTGGAAGCAGG - Intronic
1176081641 20:63276351-63276373 GAGGCTGAGTGGCCAGCAGCTGG - Intronic
1176382081 21:6118589-6118611 GGTGCTGCGCTGCCAGAAGGTGG - Intronic
1176428861 21:6564224-6564246 TCTGCTGAGGGTCCAGAAGGAGG + Intergenic
1178536586 21:33414898-33414920 GGTGCTGAGGAGCGGGCAGCTGG - Exonic
1178699308 21:34819859-34819881 TGGGCTGGCGGGCCAGAAGCAGG - Intronic
1179704351 21:43172540-43172562 TCTGCTGAGGGTCCAGAAGGAGG + Exonic
1179741391 21:43419650-43419672 GGTGCTGCGCTGCCAGAAGGTGG + Intronic
1179813092 21:43884689-43884711 GGTGCTGGGTGGCCTGATGCTGG + Intronic
1179841194 21:44075132-44075154 GGAGCTGAGCGACCAGAAACAGG + Exonic
1179984828 21:44914380-44914402 GGGGCTGAGGGGGCAGGACCAGG + Intronic
1180009819 21:45041736-45041758 TGTGCGGAGGGGCCTGAGGCTGG + Intergenic
1180049968 21:45326604-45326626 GATGCTGTGGGGGCAGGAGCAGG - Intergenic
1180075386 21:45459179-45459201 GGAGCTGAGAGGCCAGAAGAGGG - Intronic
1180222749 21:46369851-46369873 GGTGCTGATGCTCCAGGAGCAGG - Intronic
1180649930 22:17369430-17369452 GGGGCGGAGGGGCCGGACGCGGG - Exonic
1180953816 22:19732491-19732513 GTTCCTGAGGGGCCAGCAACAGG - Intergenic
1182421438 22:30250584-30250606 GGTGGTGAGGGGCCAGGAAGGGG - Intergenic
1183359363 22:37375574-37375596 GGTGCCTAGCGGCCAGAGGCTGG + Exonic
1183395387 22:37568407-37568429 GGTGCTGAGGGGTTTGCAGCAGG - Exonic
1183492687 22:38125007-38125029 GGTTCTGAGGCTCCAGAATCTGG + Intronic
1183539214 22:38419819-38419841 TGTGCTGAGAGTCCTGAAGCCGG - Intergenic
1183754397 22:39746730-39746752 GGTGCTGGGAGGCCAGCAGGGGG + Intronic
1184050441 22:41999867-41999889 AGAGCTCAGGGGCCAGCAGCAGG - Intronic
1184473588 22:44709177-44709199 GGTGGTGGGGAGCCACAAGCAGG - Intronic
1184586304 22:45450358-45450380 GAAGCAGAGGGGCCAGAACCCGG - Intergenic
1184739788 22:46421201-46421223 GGTGCTGGGGGGGTAGAGGCGGG + Intronic
1185293740 22:50042100-50042122 GGAGCTGAGGGTCCAGTGGCAGG - Intronic
1185295192 22:50049650-50049672 GAGGCTGAGGGGCCACAGGCAGG + Intronic
949518353 3:4827183-4827205 GGTGCTGTCGGGGCAGGAGCAGG - Intronic
949948666 3:9211130-9211152 GGTGTTGAGGGGGGAGAAGTGGG + Intronic
950046510 3:9951585-9951607 GGTGCTGGGGGCCCAGAGACAGG + Intronic
950097598 3:10338981-10339003 GGGGCTGAGGACCCAGACGCAGG + Intronic
952155805 3:30642254-30642276 GCTGCTGAGGGGACAGCACCTGG - Intronic
952303793 3:32127545-32127567 GGAGCTTGGGGGCCAGAGGCCGG + Intronic
952815354 3:37442666-37442688 GTTGCGGAGGTGGCAGAAGCAGG - Intergenic
952950925 3:38524565-38524587 GCTGCTCAGGGGGCAGAGGCAGG - Exonic
953572051 3:44078960-44078982 GGTGCAGAGGGACCTGAGGCAGG - Intergenic
953741526 3:45542994-45543016 GGTGCAGAGGGGCCAGGGCCTGG - Intronic
954156186 3:48686054-48686076 GGGGATGAGGGGCCTGGAGCCGG - Intronic
954952712 3:54489291-54489313 GGTGCTGAGGGATCAGATGTGGG + Intronic
955746548 3:62146421-62146443 AGTGCTGTGGGGTCTGAAGCAGG - Intronic
955934743 3:64091832-64091854 GGTACTGAGGAGGCTGAAGCAGG - Intergenic
956162698 3:66371806-66371828 GGTGCTTAGGGGCCGGGTGCGGG + Intronic
957774046 3:84732454-84732476 GGAGCTGAGGGTCCTGCAGCTGG + Intergenic
959015611 3:101130750-101130772 TGTGCTGAGGGGACAAAAGAGGG - Intergenic
961099176 3:124183985-124184007 GGTGCTGTGGGGACAGAAGAAGG + Intronic
962078626 3:132113897-132113919 GGTGCTGAGCTGCCTGGAGCTGG + Intronic
962431875 3:135327622-135327644 GGTCCTGAGAGGACTGAAGCAGG - Intergenic
963888894 3:150611774-150611796 GGGGCTGAGGGGCCGGGCGCAGG - Intronic
965059897 3:163772557-163772579 GGTGCTGAGTTGCCTGGAGCTGG + Intergenic
965590488 3:170357163-170357185 TGTGGTGATGGGCCAGACGCGGG - Intergenic
966759907 3:183408468-183408490 GGTCCCTAGGGGCCAGAACCAGG - Intronic
967649964 3:191973869-191973891 GCTCTTGAGGGGCCAGCAGCAGG - Intergenic
968229731 3:196998297-196998319 GGTGCTAACAAGCCAGAAGCTGG - Intronic
968451669 4:678878-678900 GGTGCTGAGGAACCGGGAGCAGG + Intronic
968658333 4:1788073-1788095 GGTGCTGGGGGGGCAGAAGTGGG + Intergenic
968913920 4:3488989-3489011 GGTGCTGAGGGGCCAGTGAGAGG + Intronic
968978006 4:3831749-3831771 CGTGCTGAGGGGGCAGGAGAAGG - Intergenic
968981738 4:3853833-3853855 GGTGCTGAGGGGCTGGGGGCCGG - Intergenic
969295674 4:6269653-6269675 GGGCCCGAGGGGCCAGAAGGCGG - Intergenic
969489163 4:7489208-7489230 GGTGCTGGGTGGCAGGAAGCTGG + Intronic
969524379 4:7696756-7696778 GGTGCAGAGGAGCCAGAGGCAGG - Intronic
969718054 4:8877873-8877895 CCTGCTGAGGGGCCAGACGTTGG - Intergenic
970664307 4:18319337-18319359 GGTGCTGGGGGAGCAGGAGCGGG + Intergenic
970915426 4:21328436-21328458 TGTGCTGAGGTGCCTGGAGCTGG + Intronic
971396159 4:26229420-26229442 GGTGCTGTGGGGCCACCAACAGG - Intronic
971690445 4:29827421-29827443 TGTGCTGAGCTGCCTGAAGCTGG - Intergenic
973728934 4:53804579-53804601 GTTTCTGAGGAGCCAGAAGTTGG + Intronic
975849540 4:78557581-78557603 GGTGGGGAGGGGCCAAAAACAGG + Intronic
975986195 4:80203001-80203023 GCTGGTGCTGGGCCAGAAGCTGG + Exonic
976255694 4:83098338-83098360 ACTGCTGTGGGGCCAGAATCTGG + Intronic
977290316 4:95158960-95158982 GGGGCTGATGGGCCAGAGGAGGG + Intergenic
979158210 4:117425213-117425235 TGTGCTGAATGGCCAAAAGCTGG - Intergenic
980678229 4:136118944-136118966 AGTGCTCAGGGGGCTGAAGCAGG - Intergenic
984201430 4:176725413-176725435 GCTGCTGAGGAGGCAGAGGCAGG - Intronic
984245341 4:177268610-177268632 GGTGCTGAGAGGGCAGGGGCTGG + Intergenic
985553138 5:543305-543327 GCCGCTGAGGGGCCGGATGCTGG + Intergenic
986418609 5:7553656-7553678 TAAGCTGAGGGGACAGAAGCAGG + Intronic
986631053 5:9774798-9774820 TGTGCTGAGCTGCCTGAAGCTGG + Intergenic
986896781 5:12380819-12380841 TGTACTGAAGGGCCAAAAGCTGG - Intergenic
987152389 5:15056203-15056225 CATCCTGAGGGGCAAGAAGCAGG + Intergenic
988155268 5:27441726-27441748 TTTGCTGATGGGCCAGCAGCTGG + Intergenic
988684328 5:33513139-33513161 GAGGCTGATGGGCCAGAAGTGGG + Intergenic
989288043 5:39725866-39725888 GGAGCTGAGATGCCAAAAGCTGG - Intergenic
991209029 5:64083776-64083798 TGTGCTGAGCTGCCTGAAGCTGG + Intergenic
993373943 5:87127046-87127068 AGTGCTGAGGGGCCATGAGCAGG - Intergenic
996089402 5:119336115-119336137 GGTGGTGAGGGGCTAGATGGTGG + Intronic
996142491 5:119929238-119929260 GGGACTGCTGGGCCAGAAGCTGG + Intergenic
996741087 5:126799584-126799606 GGTACTGAGGGTCCAGAAGAAGG + Intronic
997212459 5:132085497-132085519 GCTGCTGTGGGGAGAGAAGCAGG - Intergenic
997257307 5:132438910-132438932 GGTGGTGAGGGGCAAGGAACAGG + Intronic
997752830 5:136365303-136365325 GGTGTTGAGTCGCCAGAAGCTGG + Exonic
999178816 5:149654303-149654325 GGTGCAGGGGGGCAGGAAGCAGG + Intergenic
1000209153 5:159095353-159095375 GGTGCTGAGTGGCGAGAAAAAGG - Intronic
1001057861 5:168464327-168464349 GGTGCTGAGAGTACTGAAGCTGG + Intronic
1001280863 5:170385414-170385436 GCTGGTGATGGCCCAGAAGCGGG - Exonic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002197260 5:177508278-177508300 GGTGCTGAGCAGCCAGTAGATGG + Exonic
1002337460 5:178489721-178489743 CGTGGTGAGGTGCAAGAAGCTGG - Intronic
1002352074 5:178590233-178590255 GGTGCTGCTGGGGCAGAGGCTGG + Exonic
1005879306 6:30042996-30043018 GGTGCTGAGGGGTGTGAGGCAGG + Intergenic
1006154358 6:32006285-32006307 GGTGTTGAGGAGGCAGAAGAAGG + Intergenic
1007265302 6:40591146-40591168 GGAGCTGAGGGCCCAGCACCAGG + Intergenic
1007324339 6:41048717-41048739 GGAGCAGAGAGGCCAGGAGCAGG - Intronic
1007664520 6:43506414-43506436 GGGGCTCAGGGGCCTCAAGCTGG + Exonic
1007757141 6:44107224-44107246 GGTGCTGATGGGTCAGAGGGAGG - Intergenic
1012201188 6:96407947-96407969 GCTGATGTGGGGCCAGAATCTGG + Intergenic
1014265258 6:119269618-119269640 GGTACTGCTGGGCCAGAAGGTGG - Intronic
1015186698 6:130425098-130425120 TGGGCTGAGGGCCTAGAAGCAGG - Intronic
1015275045 6:131375521-131375543 ACTGCTGGAGGGCCAGAAGCTGG - Intergenic
1018085441 6:160297607-160297629 GATGCTGAGGGGCCTTACGCTGG - Intergenic
1018752232 6:166817194-166817216 GGTGCTAAGGGGGGAGCAGCAGG - Intronic
1018936370 6:168276306-168276328 GGGGCTGAGGGGACAGGAGGAGG + Intergenic
1019169447 6:170123970-170123992 GCTGCTGTGGTGCCAGCAGCAGG - Intergenic
1019404034 7:873526-873548 GGTGCAGAGGGGTCAGCAGCAGG + Exonic
1019455820 7:1126957-1126979 GATGGTGAGGGGCCTGCAGCAGG - Intronic
1019614738 7:1954100-1954122 GGTTCTGATGGGCCACATGCGGG - Intronic
1019913218 7:4114246-4114268 GGTGGTGCGGGGCCGGACGCGGG + Exonic
1019932753 7:4234597-4234619 GGGGCTGGGGGGCCACAACCAGG - Intronic
1020077657 7:5269106-5269128 GGTGCTGAGCTGCCAGGAGATGG - Intergenic
1020117874 7:5486539-5486561 GGTACTGAGGAGGCTGAAGCAGG + Intronic
1021472776 7:21024632-21024654 GGAACTGAGGCTCCAGAAGCAGG - Intergenic
1023075999 7:36483247-36483269 GGGACTGTTGGGCCAGAAGCTGG + Intergenic
1024022862 7:45387329-45387351 GGGGCTCTGGGGGCAGAAGCAGG - Intergenic
1027516456 7:79147897-79147919 TGTTCTGAGGGGTCAGAACCTGG + Intronic
1028163823 7:87515314-87515336 GGTGAAGAAGGGCCAGACGCTGG - Exonic
1028567094 7:92245808-92245830 GGTGCTGAGGTGCGAGGAGAGGG - Intronic
1029042219 7:97588355-97588377 GGCCCAGAGGGGCCAGAATCAGG - Intergenic
1029061832 7:97806403-97806425 CGTGCTCAGGAGCCAGGAGCAGG - Intergenic
1029257531 7:99279665-99279687 GGAGCTGAGCGACCTGAAGCGGG + Intergenic
1031878482 7:127168859-127168881 GGGGCTGAGGGGCCAGGGGAGGG + Intronic
1033247420 7:139729519-139729541 GATGCTGAGGGGCATGAAGAGGG - Intronic
1033997335 7:147367655-147367677 GGTGATGAGTGGCCAGAATAAGG - Intronic
1034267317 7:149787504-149787526 GGGGCTGAGGCGCCAGGAGTGGG - Intergenic
1034400366 7:150857799-150857821 GGGGCTGAAGGGCCAGGTGCTGG + Exonic
1034840566 7:154391651-154391673 GCTGGTGAGAGGCTAGAAGCAGG - Intronic
1035239808 7:157522233-157522255 GGTGCTAAGGGGCACCAAGCTGG - Intergenic
1035278129 7:157760129-157760151 GGTGATGTGGGGGCAGAAGGAGG - Intronic
1035325662 7:158064417-158064439 GGAGCTGTGGGGCCAGAGACTGG + Intronic
1035830377 8:2688719-2688741 AGTGGTAAGGGGCCAGGAGCAGG - Intergenic
1037286946 8:17311531-17311553 GGTAGTGAGGGTCCAGCAGCAGG + Exonic
1037631527 8:20661049-20661071 GGTGAGAAGGGGCCAGATGCTGG - Intergenic
1039797654 8:40928929-40928951 GCTGCTGAGGAGGCTGAAGCAGG - Intergenic
1040386422 8:46917818-46917840 GGCGCTGCGGGGCCAGCAGGGGG + Intergenic
1043928637 8:86065856-86065878 GCTACTGAGGGGACTGAAGCAGG + Intronic
1044964702 8:97563608-97563630 GAAGCTGAAGGGCCTGAAGCAGG - Intergenic
1045498317 8:102726816-102726838 GGTGCTCAGGAGCCAGGAGTGGG + Intergenic
1046463174 8:114569384-114569406 TGTGCTGAGCTGCCTGAAGCTGG + Intergenic
1047727141 8:127693862-127693884 GTTGCTTAGGGGCCAGCAGGAGG - Intergenic
1048623369 8:136159039-136159061 GGTACACTGGGGCCAGAAGCCGG - Intergenic
1048808245 8:138260960-138260982 GTTGCTAAGGGGCTAGAAACTGG - Intronic
1049510054 8:143022760-143022782 GGTGCAGAGGGTACAAAAGCTGG + Intronic
1049610686 8:143553451-143553473 GGTCCTGGGGGGCCAGAGCCTGG - Exonic
1049740856 8:144240208-144240230 GGTGCTGGGGTGGCAGAGGCTGG + Intronic
1049746353 8:144264885-144264907 GGTGGGGTGGGGCCAGCAGCCGG - Intronic
1050130417 9:2406547-2406569 GTTACTGGGGGGCCAGGAGCAGG + Intergenic
1051250899 9:15157780-15157802 GGCACTGAGGGGACAGTAGCAGG - Intergenic
1052342894 9:27380665-27380687 GGTGGGGAGGGGCCAGAAGCTGG - Intronic
1052825460 9:33170904-33170926 AGTGCTGATTGGCCAAAAGCTGG + Intergenic
1055010788 9:71562446-71562468 GGTTCTGAGGGTCAAGAATCTGG - Intergenic
1055693631 9:78859595-78859617 GGTGCTGCGGGAACAGAAGAAGG + Intergenic
1055893120 9:81144500-81144522 GGTGGTGATGGGACAGAAGAGGG - Intergenic
1056384030 9:86080752-86080774 CATCCTGAGAGGCCAGAAGCTGG - Intronic
1056923831 9:90815360-90815382 GGAGCCGAGGGGCCAGTGGCAGG - Intronic
1057138864 9:92714797-92714819 GGTGCTGAGGGAGCAGGACCAGG + Exonic
1057939940 9:99273114-99273136 GGAGCAGTGGGGCCAGAAGTTGG - Intergenic
1058530571 9:105901653-105901675 GGTGCTCAGGGGCCACCTGCTGG - Intergenic
1059580120 9:115536341-115536363 GGTGCTCAGGAGACAGAAGAGGG + Intergenic
1059642304 9:116229102-116229124 GGTGCTGGGGGCCCATAAGAAGG + Intronic
1060546751 9:124466355-124466377 GGTGCTGTGGTTGCAGAAGCAGG - Exonic
1060896976 9:127224753-127224775 TGTGCCGAGGGGCAAGCAGCAGG + Intronic
1061260006 9:129474996-129475018 GGTGCTCAGGGAACAGGAGCTGG - Intergenic
1061626445 9:131843298-131843320 GGCTCTGAGGGGGCAGAAGAGGG - Intergenic
1061931693 9:133836180-133836202 GGGGCTGAGGAGCCACAACCTGG + Intronic
1062285924 9:135772444-135772466 GGTGCTGAGGCCACAGCAGCTGG + Intronic
1062428564 9:136517052-136517074 GGTGCAGACGGCCCAGGAGCAGG + Intronic
1062482058 9:136757099-136757121 GGTGCTGACGGCCCCGAAGCGGG - Exonic
1062575436 9:137205099-137205121 GATGCTGTTGTGCCAGAAGCTGG - Exonic
1062702208 9:137913234-137913256 TGTGCTGAGGCCCCTGAAGCTGG + Exonic
1186786598 X:12961941-12961963 GGTGATGAGTGGACAGATGCTGG - Intergenic
1190712686 X:53081612-53081634 GGGGGTGAAGGGGCAGAAGCGGG + Intergenic
1190808219 X:53860234-53860256 CGTGCTGAGCTGCCTGAAGCTGG + Intergenic
1191991123 X:67038343-67038365 TGTGCTGAGGTGCCTGGAGCTGG + Intergenic
1192270907 X:69578476-69578498 CATGCTGAAGGGCCTGAAGCTGG + Intergenic
1192432473 X:71121759-71121781 GGTGCTGAGGGCACATAAGCAGG - Exonic
1193460765 X:81788774-81788796 GGGGGTGAGGGGCCAGGAGAAGG - Intergenic
1196286819 X:113892455-113892477 GATTTTGATGGGCCAGAAGCAGG - Intergenic
1197608309 X:128609725-128609747 GGTGCTGGGGAGGCTGAAGCAGG + Intergenic
1198073542 X:133172739-133172761 GGTGGTAAGGGGGCAGTAGCAGG + Intergenic
1198312432 X:135435566-135435588 GGAGCTGATGGCCCAGAAGCTGG + Intergenic
1198529255 X:137533912-137533934 GGTGCTGAGTGGCCAGGAAATGG + Intergenic
1201077380 Y:10197972-10197994 GGTGCTGAGAGGCAAGGGGCGGG - Intergenic