ID: 1083713703

View in Genome Browser
Species Human (GRCh38)
Location 11:64564008-64564030
Sequence GGGCACAGGTGGCCTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 794
Summary {0: 1, 1: 2, 2: 6, 3: 91, 4: 694}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083713703_1083713709 -9 Left 1083713703 11:64564008-64564030 CCATGCCCAGGCCACCTGTGCCC 0: 1
1: 2
2: 6
3: 91
4: 694
Right 1083713709 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 52
4: 445
1083713703_1083713718 13 Left 1083713703 11:64564008-64564030 CCATGCCCAGGCCACCTGTGCCC 0: 1
1: 2
2: 6
3: 91
4: 694
Right 1083713718 11:64564044-64564066 GGCTCAGGTGGGCAGGCCCCGGG 0: 1
1: 0
2: 7
3: 42
4: 651
1083713703_1083713714 1 Left 1083713703 11:64564008-64564030 CCATGCCCAGGCCACCTGTGCCC 0: 1
1: 2
2: 6
3: 91
4: 694
Right 1083713714 11:64564032-64564054 GGCTGTGTGCAGGGCTCAGGTGG 0: 1
1: 0
2: 3
3: 59
4: 519
1083713703_1083713710 -8 Left 1083713703 11:64564008-64564030 CCATGCCCAGGCCACCTGTGCCC 0: 1
1: 2
2: 6
3: 91
4: 694
Right 1083713710 11:64564023-64564045 CTGTGCCCTGGCTGTGTGCAGGG 0: 1
1: 0
2: 7
3: 55
4: 524
1083713703_1083713715 2 Left 1083713703 11:64564008-64564030 CCATGCCCAGGCCACCTGTGCCC 0: 1
1: 2
2: 6
3: 91
4: 694
Right 1083713715 11:64564033-64564055 GCTGTGTGCAGGGCTCAGGTGGG 0: 1
1: 0
2: 4
3: 72
4: 539
1083713703_1083713713 -2 Left 1083713703 11:64564008-64564030 CCATGCCCAGGCCACCTGTGCCC 0: 1
1: 2
2: 6
3: 91
4: 694
Right 1083713713 11:64564029-64564051 CCTGGCTGTGTGCAGGGCTCAGG 0: 1
1: 1
2: 3
3: 75
4: 602
1083713703_1083713719 21 Left 1083713703 11:64564008-64564030 CCATGCCCAGGCCACCTGTGCCC 0: 1
1: 2
2: 6
3: 91
4: 694
Right 1083713719 11:64564052-64564074 TGGGCAGGCCCCGGGCAGCCAGG 0: 1
1: 0
2: 8
3: 64
4: 497
1083713703_1083713717 12 Left 1083713703 11:64564008-64564030 CCATGCCCAGGCCACCTGTGCCC 0: 1
1: 2
2: 6
3: 91
4: 694
Right 1083713717 11:64564043-64564065 GGGCTCAGGTGGGCAGGCCCCGG 0: 1
1: 0
2: 4
3: 71
4: 647
1083713703_1083713716 6 Left 1083713703 11:64564008-64564030 CCATGCCCAGGCCACCTGTGCCC 0: 1
1: 2
2: 6
3: 91
4: 694
Right 1083713716 11:64564037-64564059 TGTGCAGGGCTCAGGTGGGCAGG 0: 1
1: 0
2: 2
3: 77
4: 666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083713703 Original CRISPR GGGCACAGGTGGCCTGGGCA TGG (reversed) Intronic