ID: 1083713705

View in Genome Browser
Species Human (GRCh38)
Location 11:64564013-64564035
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 677
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 616}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083713705_1083713718 8 Left 1083713705 11:64564013-64564035 CCCAGGCCACCTGTGCCCTGGCT 0: 1
1: 0
2: 4
3: 56
4: 616
Right 1083713718 11:64564044-64564066 GGCTCAGGTGGGCAGGCCCCGGG 0: 1
1: 0
2: 7
3: 42
4: 651
1083713705_1083713717 7 Left 1083713705 11:64564013-64564035 CCCAGGCCACCTGTGCCCTGGCT 0: 1
1: 0
2: 4
3: 56
4: 616
Right 1083713717 11:64564043-64564065 GGGCTCAGGTGGGCAGGCCCCGG 0: 1
1: 0
2: 4
3: 71
4: 647
1083713705_1083713715 -3 Left 1083713705 11:64564013-64564035 CCCAGGCCACCTGTGCCCTGGCT 0: 1
1: 0
2: 4
3: 56
4: 616
Right 1083713715 11:64564033-64564055 GCTGTGTGCAGGGCTCAGGTGGG 0: 1
1: 0
2: 4
3: 72
4: 539
1083713705_1083713713 -7 Left 1083713705 11:64564013-64564035 CCCAGGCCACCTGTGCCCTGGCT 0: 1
1: 0
2: 4
3: 56
4: 616
Right 1083713713 11:64564029-64564051 CCTGGCTGTGTGCAGGGCTCAGG 0: 1
1: 1
2: 3
3: 75
4: 602
1083713705_1083713714 -4 Left 1083713705 11:64564013-64564035 CCCAGGCCACCTGTGCCCTGGCT 0: 1
1: 0
2: 4
3: 56
4: 616
Right 1083713714 11:64564032-64564054 GGCTGTGTGCAGGGCTCAGGTGG 0: 1
1: 0
2: 3
3: 59
4: 519
1083713705_1083713716 1 Left 1083713705 11:64564013-64564035 CCCAGGCCACCTGTGCCCTGGCT 0: 1
1: 0
2: 4
3: 56
4: 616
Right 1083713716 11:64564037-64564059 TGTGCAGGGCTCAGGTGGGCAGG 0: 1
1: 0
2: 2
3: 77
4: 666
1083713705_1083713723 28 Left 1083713705 11:64564013-64564035 CCCAGGCCACCTGTGCCCTGGCT 0: 1
1: 0
2: 4
3: 56
4: 616
Right 1083713723 11:64564064-64564086 GGGCAGCCAGGCGAGCCAGATGG 0: 1
1: 0
2: 2
3: 27
4: 271
1083713705_1083713719 16 Left 1083713705 11:64564013-64564035 CCCAGGCCACCTGTGCCCTGGCT 0: 1
1: 0
2: 4
3: 56
4: 616
Right 1083713719 11:64564052-64564074 TGGGCAGGCCCCGGGCAGCCAGG 0: 1
1: 0
2: 8
3: 64
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083713705 Original CRISPR AGCCAGGGCACAGGTGGCCT GGG (reversed) Intronic