ID: 1083713708

View in Genome Browser
Species Human (GRCh38)
Location 11:64564022-64564044
Sequence CCTGCACACAGCCAGGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 6, 3: 31, 4: 397}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083713708_1083713724 22 Left 1083713708 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 31
4: 397
Right 1083713724 11:64564067-64564089 CAGCCAGGCGAGCCAGATGGAGG 0: 1
1: 0
2: 2
3: 18
4: 204
1083713708_1083713716 -8 Left 1083713708 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 31
4: 397
Right 1083713716 11:64564037-64564059 TGTGCAGGGCTCAGGTGGGCAGG 0: 1
1: 0
2: 2
3: 77
4: 666
1083713708_1083713718 -1 Left 1083713708 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 31
4: 397
Right 1083713718 11:64564044-64564066 GGCTCAGGTGGGCAGGCCCCGGG 0: 1
1: 0
2: 7
3: 42
4: 651
1083713708_1083713723 19 Left 1083713708 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 31
4: 397
Right 1083713723 11:64564064-64564086 GGGCAGCCAGGCGAGCCAGATGG 0: 1
1: 0
2: 2
3: 27
4: 271
1083713708_1083713717 -2 Left 1083713708 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 31
4: 397
Right 1083713717 11:64564043-64564065 GGGCTCAGGTGGGCAGGCCCCGG 0: 1
1: 0
2: 4
3: 71
4: 647
1083713708_1083713719 7 Left 1083713708 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 31
4: 397
Right 1083713719 11:64564052-64564074 TGGGCAGGCCCCGGGCAGCCAGG 0: 1
1: 0
2: 8
3: 64
4: 497
1083713708_1083713726 25 Left 1083713708 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 31
4: 397
Right 1083713726 11:64564070-64564092 CCAGGCGAGCCAGATGGAGGTGG 0: 1
1: 0
2: 1
3: 25
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083713708 Original CRISPR CCTGCACACAGCCAGGGCAC AGG (reversed) Intronic