ID: 1083713709

View in Genome Browser
Species Human (GRCh38)
Location 11:64564022-64564044
Sequence CCTGTGCCCTGGCTGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 6, 3: 52, 4: 445}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083713696_1083713709 29 Left 1083713696 11:64563970-64563992 CCCAGAATCACTGGTGAAGCAGC 0: 1
1: 0
2: 2
3: 12
4: 160
Right 1083713709 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 52
4: 445
1083713697_1083713709 28 Left 1083713697 11:64563971-64563993 CCAGAATCACTGGTGAAGCAGCC 0: 1
1: 0
2: 0
3: 10
4: 127
Right 1083713709 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 52
4: 445
1083713702_1083713709 -8 Left 1083713702 11:64564007-64564029 CCCATGCCCAGGCCACCTGTGCC 0: 1
1: 0
2: 7
3: 53
4: 342
Right 1083713709 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 52
4: 445
1083713700_1083713709 7 Left 1083713700 11:64563992-64564014 CCAACTCTAGGGACACCCATGCC 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1083713709 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 52
4: 445
1083713695_1083713709 30 Left 1083713695 11:64563969-64563991 CCCCAGAATCACTGGTGAAGCAG 0: 1
1: 1
2: 2
3: 15
4: 179
Right 1083713709 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 52
4: 445
1083713703_1083713709 -9 Left 1083713703 11:64564008-64564030 CCATGCCCAGGCCACCTGTGCCC 0: 1
1: 2
2: 6
3: 91
4: 694
Right 1083713709 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 52
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083713709 Original CRISPR CCTGTGCCCTGGCTGTGTGC AGG Intronic