ID: 1083713710

View in Genome Browser
Species Human (GRCh38)
Location 11:64564023-64564045
Sequence CTGTGCCCTGGCTGTGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 7, 3: 55, 4: 524}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083713700_1083713710 8 Left 1083713700 11:64563992-64564014 CCAACTCTAGGGACACCCATGCC 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1083713710 11:64564023-64564045 CTGTGCCCTGGCTGTGTGCAGGG 0: 1
1: 0
2: 7
3: 55
4: 524
1083713703_1083713710 -8 Left 1083713703 11:64564008-64564030 CCATGCCCAGGCCACCTGTGCCC 0: 1
1: 2
2: 6
3: 91
4: 694
Right 1083713710 11:64564023-64564045 CTGTGCCCTGGCTGTGTGCAGGG 0: 1
1: 0
2: 7
3: 55
4: 524
1083713697_1083713710 29 Left 1083713697 11:64563971-64563993 CCAGAATCACTGGTGAAGCAGCC 0: 1
1: 0
2: 0
3: 10
4: 127
Right 1083713710 11:64564023-64564045 CTGTGCCCTGGCTGTGTGCAGGG 0: 1
1: 0
2: 7
3: 55
4: 524
1083713702_1083713710 -7 Left 1083713702 11:64564007-64564029 CCCATGCCCAGGCCACCTGTGCC 0: 1
1: 0
2: 7
3: 53
4: 342
Right 1083713710 11:64564023-64564045 CTGTGCCCTGGCTGTGTGCAGGG 0: 1
1: 0
2: 7
3: 55
4: 524
1083713696_1083713710 30 Left 1083713696 11:64563970-64563992 CCCAGAATCACTGGTGAAGCAGC 0: 1
1: 0
2: 2
3: 12
4: 160
Right 1083713710 11:64564023-64564045 CTGTGCCCTGGCTGTGTGCAGGG 0: 1
1: 0
2: 7
3: 55
4: 524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083713710 Original CRISPR CTGTGCCCTGGCTGTGTGCA GGG Intronic