ID: 1083713712

View in Genome Browser
Species Human (GRCh38)
Location 11:64564029-64564051
Sequence CCTGAGCCCTGCACACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 840
Summary {0: 1, 1: 0, 2: 6, 3: 78, 4: 755}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083713712_1083713724 15 Left 1083713712 11:64564029-64564051 CCTGGCTGTGTGCAGGGCTCAGG 0: 1
1: 0
2: 6
3: 78
4: 755
Right 1083713724 11:64564067-64564089 CAGCCAGGCGAGCCAGATGGAGG 0: 1
1: 0
2: 2
3: 18
4: 204
1083713712_1083713726 18 Left 1083713712 11:64564029-64564051 CCTGGCTGTGTGCAGGGCTCAGG 0: 1
1: 0
2: 6
3: 78
4: 755
Right 1083713726 11:64564070-64564092 CCAGGCGAGCCAGATGGAGGTGG 0: 1
1: 0
2: 1
3: 25
4: 268
1083713712_1083713729 28 Left 1083713712 11:64564029-64564051 CCTGGCTGTGTGCAGGGCTCAGG 0: 1
1: 0
2: 6
3: 78
4: 755
Right 1083713729 11:64564080-64564102 CAGATGGAGGTGGCTCGCTTGGG 0: 1
1: 0
2: 0
3: 32
4: 174
1083713712_1083713717 -9 Left 1083713712 11:64564029-64564051 CCTGGCTGTGTGCAGGGCTCAGG 0: 1
1: 0
2: 6
3: 78
4: 755
Right 1083713717 11:64564043-64564065 GGGCTCAGGTGGGCAGGCCCCGG 0: 1
1: 0
2: 4
3: 71
4: 647
1083713712_1083713723 12 Left 1083713712 11:64564029-64564051 CCTGGCTGTGTGCAGGGCTCAGG 0: 1
1: 0
2: 6
3: 78
4: 755
Right 1083713723 11:64564064-64564086 GGGCAGCCAGGCGAGCCAGATGG 0: 1
1: 0
2: 2
3: 27
4: 271
1083713712_1083713719 0 Left 1083713712 11:64564029-64564051 CCTGGCTGTGTGCAGGGCTCAGG 0: 1
1: 0
2: 6
3: 78
4: 755
Right 1083713719 11:64564052-64564074 TGGGCAGGCCCCGGGCAGCCAGG 0: 1
1: 0
2: 8
3: 64
4: 497
1083713712_1083713718 -8 Left 1083713712 11:64564029-64564051 CCTGGCTGTGTGCAGGGCTCAGG 0: 1
1: 0
2: 6
3: 78
4: 755
Right 1083713718 11:64564044-64564066 GGCTCAGGTGGGCAGGCCCCGGG 0: 1
1: 0
2: 7
3: 42
4: 651
1083713712_1083713728 27 Left 1083713712 11:64564029-64564051 CCTGGCTGTGTGCAGGGCTCAGG 0: 1
1: 0
2: 6
3: 78
4: 755
Right 1083713728 11:64564079-64564101 CCAGATGGAGGTGGCTCGCTTGG 0: 1
1: 0
2: 2
3: 19
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083713712 Original CRISPR CCTGAGCCCTGCACACAGCC AGG (reversed) Intronic