ID: 1083713715

View in Genome Browser
Species Human (GRCh38)
Location 11:64564033-64564055
Sequence GCTGTGTGCAGGGCTCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 0, 2: 4, 3: 72, 4: 539}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083713700_1083713715 18 Left 1083713700 11:64563992-64564014 CCAACTCTAGGGACACCCATGCC 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1083713715 11:64564033-64564055 GCTGTGTGCAGGGCTCAGGTGGG 0: 1
1: 0
2: 4
3: 72
4: 539
1083713703_1083713715 2 Left 1083713703 11:64564008-64564030 CCATGCCCAGGCCACCTGTGCCC 0: 1
1: 2
2: 6
3: 91
4: 694
Right 1083713715 11:64564033-64564055 GCTGTGTGCAGGGCTCAGGTGGG 0: 1
1: 0
2: 4
3: 72
4: 539
1083713706_1083713715 -4 Left 1083713706 11:64564014-64564036 CCAGGCCACCTGTGCCCTGGCTG 0: 1
1: 0
2: 5
3: 51
4: 504
Right 1083713715 11:64564033-64564055 GCTGTGTGCAGGGCTCAGGTGGG 0: 1
1: 0
2: 4
3: 72
4: 539
1083713707_1083713715 -9 Left 1083713707 11:64564019-64564041 CCACCTGTGCCCTGGCTGTGTGC 0: 1
1: 0
2: 6
3: 43
4: 415
Right 1083713715 11:64564033-64564055 GCTGTGTGCAGGGCTCAGGTGGG 0: 1
1: 0
2: 4
3: 72
4: 539
1083713705_1083713715 -3 Left 1083713705 11:64564013-64564035 CCCAGGCCACCTGTGCCCTGGCT 0: 1
1: 0
2: 4
3: 56
4: 616
Right 1083713715 11:64564033-64564055 GCTGTGTGCAGGGCTCAGGTGGG 0: 1
1: 0
2: 4
3: 72
4: 539
1083713702_1083713715 3 Left 1083713702 11:64564007-64564029 CCCATGCCCAGGCCACCTGTGCC 0: 1
1: 0
2: 7
3: 53
4: 342
Right 1083713715 11:64564033-64564055 GCTGTGTGCAGGGCTCAGGTGGG 0: 1
1: 0
2: 4
3: 72
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083713715 Original CRISPR GCTGTGTGCAGGGCTCAGGT GGG Intronic