ID: 1083713717

View in Genome Browser
Species Human (GRCh38)
Location 11:64564043-64564065
Sequence GGGCTCAGGTGGGCAGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 647}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083713702_1083713717 13 Left 1083713702 11:64564007-64564029 CCCATGCCCAGGCCACCTGTGCC 0: 1
1: 0
2: 7
3: 53
4: 342
Right 1083713717 11:64564043-64564065 GGGCTCAGGTGGGCAGGCCCCGG 0: 1
1: 0
2: 4
3: 71
4: 647
1083713711_1083713717 -8 Left 1083713711 11:64564028-64564050 CCCTGGCTGTGTGCAGGGCTCAG 0: 1
1: 0
2: 4
3: 83
4: 436
Right 1083713717 11:64564043-64564065 GGGCTCAGGTGGGCAGGCCCCGG 0: 1
1: 0
2: 4
3: 71
4: 647
1083713707_1083713717 1 Left 1083713707 11:64564019-64564041 CCACCTGTGCCCTGGCTGTGTGC 0: 1
1: 0
2: 6
3: 43
4: 415
Right 1083713717 11:64564043-64564065 GGGCTCAGGTGGGCAGGCCCCGG 0: 1
1: 0
2: 4
3: 71
4: 647
1083713700_1083713717 28 Left 1083713700 11:64563992-64564014 CCAACTCTAGGGACACCCATGCC 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1083713717 11:64564043-64564065 GGGCTCAGGTGGGCAGGCCCCGG 0: 1
1: 0
2: 4
3: 71
4: 647
1083713712_1083713717 -9 Left 1083713712 11:64564029-64564051 CCTGGCTGTGTGCAGGGCTCAGG 0: 1
1: 0
2: 6
3: 78
4: 755
Right 1083713717 11:64564043-64564065 GGGCTCAGGTGGGCAGGCCCCGG 0: 1
1: 0
2: 4
3: 71
4: 647
1083713706_1083713717 6 Left 1083713706 11:64564014-64564036 CCAGGCCACCTGTGCCCTGGCTG 0: 1
1: 0
2: 5
3: 51
4: 504
Right 1083713717 11:64564043-64564065 GGGCTCAGGTGGGCAGGCCCCGG 0: 1
1: 0
2: 4
3: 71
4: 647
1083713708_1083713717 -2 Left 1083713708 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 31
4: 397
Right 1083713717 11:64564043-64564065 GGGCTCAGGTGGGCAGGCCCCGG 0: 1
1: 0
2: 4
3: 71
4: 647
1083713703_1083713717 12 Left 1083713703 11:64564008-64564030 CCATGCCCAGGCCACCTGTGCCC 0: 1
1: 2
2: 6
3: 91
4: 694
Right 1083713717 11:64564043-64564065 GGGCTCAGGTGGGCAGGCCCCGG 0: 1
1: 0
2: 4
3: 71
4: 647
1083713705_1083713717 7 Left 1083713705 11:64564013-64564035 CCCAGGCCACCTGTGCCCTGGCT 0: 1
1: 0
2: 4
3: 56
4: 616
Right 1083713717 11:64564043-64564065 GGGCTCAGGTGGGCAGGCCCCGG 0: 1
1: 0
2: 4
3: 71
4: 647

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083713717 Original CRISPR GGGCTCAGGTGGGCAGGCCC CGG Intronic