ID: 1083713719

View in Genome Browser
Species Human (GRCh38)
Location 11:64564052-64564074
Sequence TGGGCAGGCCCCGGGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 0, 2: 8, 3: 64, 4: 497}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083713702_1083713719 22 Left 1083713702 11:64564007-64564029 CCCATGCCCAGGCCACCTGTGCC 0: 1
1: 0
2: 7
3: 53
4: 342
Right 1083713719 11:64564052-64564074 TGGGCAGGCCCCGGGCAGCCAGG 0: 1
1: 0
2: 8
3: 64
4: 497
1083713705_1083713719 16 Left 1083713705 11:64564013-64564035 CCCAGGCCACCTGTGCCCTGGCT 0: 1
1: 0
2: 4
3: 56
4: 616
Right 1083713719 11:64564052-64564074 TGGGCAGGCCCCGGGCAGCCAGG 0: 1
1: 0
2: 8
3: 64
4: 497
1083713707_1083713719 10 Left 1083713707 11:64564019-64564041 CCACCTGTGCCCTGGCTGTGTGC 0: 1
1: 0
2: 6
3: 43
4: 415
Right 1083713719 11:64564052-64564074 TGGGCAGGCCCCGGGCAGCCAGG 0: 1
1: 0
2: 8
3: 64
4: 497
1083713703_1083713719 21 Left 1083713703 11:64564008-64564030 CCATGCCCAGGCCACCTGTGCCC 0: 1
1: 2
2: 6
3: 91
4: 694
Right 1083713719 11:64564052-64564074 TGGGCAGGCCCCGGGCAGCCAGG 0: 1
1: 0
2: 8
3: 64
4: 497
1083713712_1083713719 0 Left 1083713712 11:64564029-64564051 CCTGGCTGTGTGCAGGGCTCAGG 0: 1
1: 0
2: 6
3: 78
4: 755
Right 1083713719 11:64564052-64564074 TGGGCAGGCCCCGGGCAGCCAGG 0: 1
1: 0
2: 8
3: 64
4: 497
1083713706_1083713719 15 Left 1083713706 11:64564014-64564036 CCAGGCCACCTGTGCCCTGGCTG 0: 1
1: 0
2: 5
3: 51
4: 504
Right 1083713719 11:64564052-64564074 TGGGCAGGCCCCGGGCAGCCAGG 0: 1
1: 0
2: 8
3: 64
4: 497
1083713708_1083713719 7 Left 1083713708 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 31
4: 397
Right 1083713719 11:64564052-64564074 TGGGCAGGCCCCGGGCAGCCAGG 0: 1
1: 0
2: 8
3: 64
4: 497
1083713711_1083713719 1 Left 1083713711 11:64564028-64564050 CCCTGGCTGTGTGCAGGGCTCAG 0: 1
1: 0
2: 4
3: 83
4: 436
Right 1083713719 11:64564052-64564074 TGGGCAGGCCCCGGGCAGCCAGG 0: 1
1: 0
2: 8
3: 64
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083713719 Original CRISPR TGGGCAGGCCCCGGGCAGCC AGG Intronic