ID: 1083713723

View in Genome Browser
Species Human (GRCh38)
Location 11:64564064-64564086
Sequence GGGCAGCCAGGCGAGCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 271}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083713705_1083713723 28 Left 1083713705 11:64564013-64564035 CCCAGGCCACCTGTGCCCTGGCT 0: 1
1: 0
2: 4
3: 56
4: 616
Right 1083713723 11:64564064-64564086 GGGCAGCCAGGCGAGCCAGATGG 0: 1
1: 0
2: 2
3: 27
4: 271
1083713712_1083713723 12 Left 1083713712 11:64564029-64564051 CCTGGCTGTGTGCAGGGCTCAGG 0: 1
1: 0
2: 6
3: 78
4: 755
Right 1083713723 11:64564064-64564086 GGGCAGCCAGGCGAGCCAGATGG 0: 1
1: 0
2: 2
3: 27
4: 271
1083713708_1083713723 19 Left 1083713708 11:64564022-64564044 CCTGTGCCCTGGCTGTGTGCAGG 0: 1
1: 0
2: 6
3: 31
4: 397
Right 1083713723 11:64564064-64564086 GGGCAGCCAGGCGAGCCAGATGG 0: 1
1: 0
2: 2
3: 27
4: 271
1083713706_1083713723 27 Left 1083713706 11:64564014-64564036 CCAGGCCACCTGTGCCCTGGCTG 0: 1
1: 0
2: 5
3: 51
4: 504
Right 1083713723 11:64564064-64564086 GGGCAGCCAGGCGAGCCAGATGG 0: 1
1: 0
2: 2
3: 27
4: 271
1083713707_1083713723 22 Left 1083713707 11:64564019-64564041 CCACCTGTGCCCTGGCTGTGTGC 0: 1
1: 0
2: 6
3: 43
4: 415
Right 1083713723 11:64564064-64564086 GGGCAGCCAGGCGAGCCAGATGG 0: 1
1: 0
2: 2
3: 27
4: 271
1083713711_1083713723 13 Left 1083713711 11:64564028-64564050 CCCTGGCTGTGTGCAGGGCTCAG 0: 1
1: 0
2: 4
3: 83
4: 436
Right 1083713723 11:64564064-64564086 GGGCAGCCAGGCGAGCCAGATGG 0: 1
1: 0
2: 2
3: 27
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083713723 Original CRISPR GGGCAGCCAGGCGAGCCAGA TGG Intronic