ID: 1083713728

View in Genome Browser
Species Human (GRCh38)
Location 11:64564079-64564101
Sequence CCAGATGGAGGTGGCTCGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083713721_1083713728 -5 Left 1083713721 11:64564061-64564083 CCCGGGCAGCCAGGCGAGCCAGA 0: 1
1: 0
2: 0
3: 28
4: 324
Right 1083713728 11:64564079-64564101 CCAGATGGAGGTGGCTCGCTTGG 0: 1
1: 0
2: 2
3: 19
4: 135
1083713722_1083713728 -6 Left 1083713722 11:64564062-64564084 CCGGGCAGCCAGGCGAGCCAGAT 0: 1
1: 0
2: 1
3: 16
4: 246
Right 1083713728 11:64564079-64564101 CCAGATGGAGGTGGCTCGCTTGG 0: 1
1: 0
2: 2
3: 19
4: 135
1083713712_1083713728 27 Left 1083713712 11:64564029-64564051 CCTGGCTGTGTGCAGGGCTCAGG 0: 1
1: 0
2: 6
3: 78
4: 755
Right 1083713728 11:64564079-64564101 CCAGATGGAGGTGGCTCGCTTGG 0: 1
1: 0
2: 2
3: 19
4: 135
1083713711_1083713728 28 Left 1083713711 11:64564028-64564050 CCCTGGCTGTGTGCAGGGCTCAG 0: 1
1: 0
2: 4
3: 83
4: 436
Right 1083713728 11:64564079-64564101 CCAGATGGAGGTGGCTCGCTTGG 0: 1
1: 0
2: 2
3: 19
4: 135
1083713720_1083713728 -4 Left 1083713720 11:64564060-64564082 CCCCGGGCAGCCAGGCGAGCCAG 0: 1
1: 0
2: 1
3: 25
4: 225
Right 1083713728 11:64564079-64564101 CCAGATGGAGGTGGCTCGCTTGG 0: 1
1: 0
2: 2
3: 19
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083713728 Original CRISPR CCAGATGGAGGTGGCTCGCT TGG Intronic