ID: 1083713883

View in Genome Browser
Species Human (GRCh38)
Location 11:64564852-64564874
Sequence ATCGAGAACCCCCATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083713883_1083713890 25 Left 1083713883 11:64564852-64564874 CCCACCTCATGGGGGTTCTCGAT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1083713890 11:64564900-64564922 ATTTGAAGGTAGCTGCTTTCAGG 0: 1
1: 0
2: 4
3: 13
4: 182
1083713883_1083713889 11 Left 1083713883 11:64564852-64564874 CCCACCTCATGGGGGTTCTCGAT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1083713889 11:64564886-64564908 AACAGAATGTGTTTATTTGAAGG 0: 1
1: 0
2: 4
3: 44
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083713883 Original CRISPR ATCGAGAACCCCCATGAGGT GGG (reversed) Intronic
902566268 1:17313706-17313728 ATCAACCACCCCCATGAGGGTGG - Intronic
910357243 1:86373860-86373882 AATGTGAACTCCCATGAGGTAGG + Intronic
919214443 1:194534449-194534471 ATCGAGAAAGACCATCAGGTAGG + Intergenic
1063732389 10:8712777-8712799 ATAAAGAATCCCCATTAGGTTGG + Intergenic
1064253924 10:13728256-13728278 ATCATAAACCCCCATGTGGTGGG + Intronic
1064366790 10:14715789-14715811 CTTGAGAACCACCAGGAGGTTGG - Intronic
1071480433 10:86061099-86061121 GTAGAGTACCCCCAGGAGGTGGG - Intronic
1072318761 10:94228558-94228580 AGTGAGAACCCTCATGAGGATGG - Intronic
1076020086 10:127065466-127065488 AACCACAACCACCATGAGGTGGG - Intronic
1079853361 11:25566997-25567019 AGCGAGAACTGCCAAGAGGTGGG - Intergenic
1083713883 11:64564852-64564874 ATCGAGAACCCCCATGAGGTGGG - Intronic
1084944150 11:72629848-72629870 TTACAGCACCCCCATGAGGTAGG - Intronic
1097189122 12:57211119-57211141 ATGGAGAGCCCTCATGAGGGTGG + Intronic
1097347710 12:58512855-58512877 ATCAAGAACACCCATGAAATGGG - Intergenic
1102579103 12:113874770-113874792 CTCCAGAACCCCCATGATGTTGG + Intronic
1102719733 12:115005716-115005738 TTTCAGAACCCCCATGGGGTCGG + Intergenic
1111968008 13:94880651-94880673 ATCAAGAAGCCACATGAGGCAGG + Intergenic
1115320510 14:32076069-32076091 ATCGAGAAGCCCCGTGGGGCGGG - Intergenic
1116964109 14:50997083-50997105 ATGGAGAATCCCGGTGAGGTGGG + Intronic
1118004395 14:61552743-61552765 TTCAATACCCCCCATGAGGTGGG + Intronic
1118824642 14:69369101-69369123 ATCGAGAGTCACCCTGAGGTAGG + Intergenic
1132153329 15:99477562-99477584 CACTAGAACCCCTATGAGGTGGG + Intergenic
1135389504 16:22078052-22078074 ATAGGGAACCCCCATCATGTGGG - Intronic
1137673561 16:50292808-50292830 ATCGAGAAGCGCCAGCAGGTGGG + Exonic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1143404644 17:6669141-6669163 AGCGAGAACACCCAGGAAGTGGG - Intergenic
1144733336 17:17541164-17541186 ATAGAGCACCCATATGAGGTAGG + Intronic
1147163712 17:38582245-38582267 ACTGAGATCCCCCAGGAGGTAGG - Intronic
1147623715 17:41885658-41885680 CTCCAGTAGCCCCATGAGGTGGG + Intronic
1151367544 17:73627116-73627138 TTCAACAACCCCCATGAGTTTGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
932434666 2:71695937-71695959 ATCCAGAACTCCCACCAGGTGGG + Intergenic
939052325 2:137322466-137322488 TTCAAGAAATCCCATGAGGTGGG + Intronic
941548924 2:166889727-166889749 ATCAAGAACCCCAAGCAGGTAGG - Intronic
943593796 2:189831014-189831036 ATCTAGGACCCCCAGGTGGTTGG + Intronic
949624596 3:5852136-5852158 ATACAGAACCACCATGGGGTTGG + Intergenic
960938178 3:122916085-122916107 ATCCAGCACCCCAATGAAGTGGG + Intronic
961205329 3:125076838-125076860 ATCCAGAGACCCCATGAGGATGG - Intergenic
961843656 3:129740517-129740539 GTTGAGAACTCCCATGAGTTAGG - Intronic
963296006 3:143547536-143547558 ATGGAGAGCCCAAATGAGGTGGG - Intronic
967434647 3:189430503-189430525 TGCGAGATCCCCTATGAGGTAGG - Intergenic
968280901 3:197476039-197476061 AGTGACAACCCCCCTGAGGTTGG - Intergenic
968447684 4:660596-660618 TTCCAGATCCCCCAGGAGGTGGG + Exonic
969492157 4:7505579-7505601 CTCCAGAACACCCATGAGGAGGG - Intronic
975194619 4:71509549-71509571 ATCACAAACCCCCATGAAGTAGG - Intronic
981876868 4:149557471-149557493 TTTGAGAACCCCATTGAGGTTGG - Intergenic
988229149 5:28451367-28451389 ATGAAGAACCTCCAAGAGGTTGG - Intergenic
990233345 5:53739377-53739399 ATCGGGAAGCACCATCAGGTGGG - Intergenic
1018463230 6:164018784-164018806 ATGGAGGACCTCCATGAGGCTGG - Intergenic
1022207878 7:28180586-28180608 ATCGAGAGCCCCCCTGGTGTCGG + Exonic
1024019094 7:45348998-45349020 ATCGAGAGCCCACTGGAGGTGGG + Intergenic
1044362538 8:91305022-91305044 ATTCAGAAGCCCTATGAGGTAGG - Intronic
1045779840 8:105849866-105849888 ATAGGGAACCACCATCAGGTGGG - Intergenic
1045974517 8:108116232-108116254 ATCTAGAACTCTAATGAGGTAGG + Intergenic
1047504082 8:125465008-125465030 ACCGAGAACGGCCATGAGGAAGG - Intergenic
1056804321 9:89716707-89716729 AGCGAGAAGCCACATGAGTTTGG - Intergenic
1186503850 X:10074301-10074323 AGCGAGAGCCCCAATGAGGCCGG - Intronic
1196654958 X:118208356-118208378 AGCGTGGAACCCCATGAGGTAGG - Intergenic
1199602923 X:149553589-149553611 ATCCTGAACTCCTATGAGGTTGG + Intergenic
1199647466 X:149925886-149925908 ATCCTGAACTCCTATGAGGTTGG - Intergenic