ID: 1083714290

View in Genome Browser
Species Human (GRCh38)
Location 11:64567020-64567042
Sequence GCTCCCACGCTCCCAGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 277}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083714290_1083714303 23 Left 1083714290 11:64567020-64567042 CCAGCCCCTGGGAGCGTGGGAGC 0: 1
1: 0
2: 3
3: 30
4: 277
Right 1083714303 11:64567066-64567088 CTGCCCCATGAACCAGTCACAGG 0: 1
1: 0
2: 1
3: 11
4: 180
1083714290_1083714297 -9 Left 1083714290 11:64567020-64567042 CCAGCCCCTGGGAGCGTGGGAGC 0: 1
1: 0
2: 3
3: 30
4: 277
Right 1083714297 11:64567034-64567056 CGTGGGAGCTGGGGCCTTTCTGG 0: 1
1: 0
2: 0
3: 16
4: 280
1083714290_1083714298 -8 Left 1083714290 11:64567020-64567042 CCAGCCCCTGGGAGCGTGGGAGC 0: 1
1: 0
2: 3
3: 30
4: 277
Right 1083714298 11:64567035-64567057 GTGGGAGCTGGGGCCTTTCTGGG 0: 1
1: 0
2: 4
3: 44
4: 331
1083714290_1083714299 -5 Left 1083714290 11:64567020-64567042 CCAGCCCCTGGGAGCGTGGGAGC 0: 1
1: 0
2: 3
3: 30
4: 277
Right 1083714299 11:64567038-64567060 GGAGCTGGGGCCTTTCTGGGTGG 0: 1
1: 1
2: 5
3: 52
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083714290 Original CRISPR GCTCCCACGCTCCCAGGGGC TGG (reversed) Intronic
900346873 1:2214357-2214379 GCTCCCACACTGGCAGGGGATGG + Intergenic
900483178 1:2909239-2909261 GCATCCAGGCGCCCAGGGGCTGG + Intergenic
901588313 1:10317008-10317030 GCTCCAGGGATCCCAGGGGCTGG + Intronic
902602099 1:17547051-17547073 GCGCCAACCCTCCCAGGGCCTGG + Intronic
903044312 1:20553929-20553951 GCCCGCCCGCTCCCTGGGGCCGG - Exonic
903763086 1:25712827-25712849 ATTCCCACGGTCCCTGGGGCTGG + Intronic
905236004 1:36548731-36548753 CCTCACACGGTGCCAGGGGCAGG - Intergenic
905916172 1:41685879-41685901 ACTCCCCCTCTCTCAGGGGCTGG + Intronic
906251161 1:44312017-44312039 GTTCCCACACTCCCAGGGACAGG + Intronic
907437684 1:54459880-54459902 ACTCCCCCACCCCCAGGGGCTGG - Intergenic
908555711 1:65254742-65254764 GCATCCAGGCTCCCAGGGCCGGG - Intronic
912711562 1:111953736-111953758 GCTCCCAAGCTCTCTGGGCCTGG - Intronic
912804466 1:112744264-112744286 CCTCTCTCGCTCCCAGGGCCTGG + Intergenic
913327160 1:117637217-117637239 GTGCTCAAGCTCCCAGGGGCTGG + Intergenic
913600973 1:120420937-120420959 GCTCCCACTCCCCCAGGACCTGG - Intergenic
914086083 1:144455696-144455718 GCTCCCACTCCCCCAGGACCTGG + Intronic
914191975 1:145419647-145419669 GCTCCCACTCCCCCAGGACCTGG + Intergenic
914246020 1:145886180-145886202 GCTGCCGCTCTCCGAGGGGCGGG - Intergenic
914362110 1:146944379-146944401 GCTCCCACTCCCCCAGGACCTGG - Intronic
914489516 1:148142576-148142598 GCTCCCACTCCCCCAGGACCTGG + Intronic
914589882 1:149097597-149097619 GCTCCCACTCCCCCAGGACCTGG + Intronic
915564083 1:156704417-156704439 GCCCTTACGCTCCCAGTGGCTGG + Intronic
916488440 1:165279877-165279899 GGTCCCCCTCTCCCTGGGGCGGG + Intronic
916713718 1:167433184-167433206 GATCCTTCTCTCCCAGGGGCAGG - Intronic
918042206 1:180920223-180920245 GCTCCCTCTCTCCCCGGAGCAGG + Intronic
919822003 1:201479333-201479355 TCTCACAAGCTCCCAGGGGTAGG - Intergenic
922791196 1:228312029-228312051 GCTTCCACACCCCCAGGGACAGG + Intronic
923031194 1:230250216-230250238 GTTCCCACAGTGCCAGGGGCTGG - Intronic
923033396 1:230267471-230267493 ATTCCCAGGCTCCCAGGGCCTGG + Intronic
924179335 1:241424719-241424741 GAGCCCACCCTCCCAGGTGCAGG + Intergenic
1063145463 10:3291201-3291223 GCACCCACTAGCCCAGGGGCAGG + Intergenic
1063174625 10:3540193-3540215 GTTCTCACACTCCCTGGGGCTGG + Intergenic
1063459147 10:6204250-6204272 GCGCCCCGGCTCCCATGGGCTGG + Intronic
1065687799 10:28303068-28303090 GCCCCCACCCTCGGAGGGGCGGG + Intronic
1067203951 10:44197981-44198003 GGTCCCAGCCTCCCAGGGGCAGG - Intergenic
1067742747 10:48908241-48908263 GCTCCCACACCACCAGGGGTGGG + Intronic
1069661637 10:70127160-70127182 GGTTGCACGCTGCCAGGGGCTGG - Intronic
1070314394 10:75296245-75296267 CCACCCATCCTCCCAGGGGCTGG - Intergenic
1071465033 10:85931965-85931987 GCTCCCAGGATGCCAGCGGCTGG - Intronic
1071532581 10:86401029-86401051 TCTCCCCCGCACCCTGGGGCGGG - Intergenic
1071956953 10:90770437-90770459 GCTCCCACCCTCCCAGGCACAGG + Intronic
1074555560 10:114485949-114485971 GCTCCCACGTACCCAGAGCCGGG - Intronic
1075519425 10:123135204-123135226 GCTCCCCCGCCCCCTGGGGCTGG - Intergenic
1076029793 10:127147604-127147626 CCTCCCAGTCTCCCAGGGCCTGG + Intronic
1076373526 10:129969142-129969164 GCTCCCACCCACCCCGGGGCAGG + Intergenic
1076421953 10:130338202-130338224 GCTCCCAGGCTGCCGGGGACTGG + Intergenic
1076845738 10:133068699-133068721 GCCCCCACACACCCAGGGGGAGG - Intergenic
1076872511 10:133200763-133200785 GCTCCCACTGTCCCAGTGGCCGG - Intronic
1076911421 10:133392090-133392112 ACTCCCTGGCTCCCATGGGCTGG - Intronic
1077176927 11:1195325-1195347 CCTCCCACCCTTCCAAGGGCTGG + Intronic
1077330853 11:1983275-1983297 GCCCCCACTCTCCAAGGGGTCGG - Intronic
1077390818 11:2300033-2300055 TCTTCCAGGCTCCCAGCGGCCGG + Intronic
1077464788 11:2728582-2728604 GCCCTCACGCTCCCAAGGCCCGG - Intronic
1077526413 11:3068225-3068247 GCTCAGACCCTCCCAGGGGATGG - Intergenic
1078153501 11:8778651-8778673 GCTCCCACGTACCCGGGGGCTGG + Intronic
1083714290 11:64567020-64567042 GCTCCCACGCTCCCAGGGGCTGG - Intronic
1084007287 11:66330080-66330102 GCTCGGAGGATCCCAGGGGCCGG - Intergenic
1084409803 11:69000157-69000179 GCACACACCCTCCCAGGAGCTGG - Intergenic
1084659892 11:70540475-70540497 ACTCCCAGGCTCCCGCGGGCAGG - Intronic
1084743608 11:71154722-71154744 CCACCCACGCTCCCAGAGGAGGG + Intronic
1084743657 11:71154859-71154881 CCGCCCACGCTCCCAGAGGAGGG + Intronic
1084743682 11:71154926-71154948 CCGCCCACGCTCCCAGAGGAGGG + Intronic
1084743863 11:71155430-71155452 CCGCCCACGCTCCCAGAGGAGGG + Intronic
1084860943 11:72017891-72017913 GCTCCCAGAACCCCAGGGGCTGG + Intronic
1084948075 11:72649687-72649709 GCTTGCACACTCCCAGGGACAGG + Intronic
1085450343 11:76628533-76628555 CCTCCCACGCACCCAGGGTTTGG - Intergenic
1087105190 11:94401262-94401284 GCCCGCAGGCTCCCAGGGGAGGG - Exonic
1090405617 11:126474418-126474440 GCTCCCAGGTTCCCTGGGCCTGG - Intronic
1091340210 11:134806264-134806286 CTTCCCACGCTCCCAGTGACTGG + Intergenic
1202813833 11_KI270721v1_random:38454-38476 GCCCCCACTCTCCAAGGGGTCGG - Intergenic
1091677488 12:2501784-2501806 GCTCCCAGGCTCCCTGGGATGGG + Intronic
1091692240 12:2605201-2605223 GCTCCCACTCCCCAATGGGCTGG - Intronic
1092264395 12:6970057-6970079 GCACCCACTATCCTAGGGGCAGG + Intronic
1095233471 12:39769855-39769877 TCTCCCACCCTCCCAGATGCTGG + Intronic
1095803573 12:46293959-46293981 GCTCCCACATTCCCATGGGAGGG - Intergenic
1097916066 12:65021569-65021591 GCTCCCACGCTGGCAGTGGGAGG - Intergenic
1102197001 12:111033400-111033422 GCTCCCACCCTCCCTCCGGCCGG + Intergenic
1102507354 12:113392101-113392123 GCTCACACACGCCCAGGGGAGGG + Intergenic
1104289782 12:127456320-127456342 GCTCCTCCGCTCCGATGGGCGGG + Intergenic
1106477739 13:30112779-30112801 GCTCCCTGCCTCCCAGGTGCAGG - Intergenic
1107540167 13:41382073-41382095 GTTCACAGGCTCCCAGAGGCTGG - Intergenic
1108498240 13:51045590-51045612 GCTTGCACACTCCCAGGGACTGG + Intergenic
1108503234 13:51086793-51086815 GCCCCCTCACTCCCAGGGGCAGG + Intergenic
1110713660 13:78677314-78677336 GCTCCTTCTCTCCCAGAGGCAGG - Intergenic
1112026665 13:95417687-95417709 GCACCCAGTCTTCCAGGGGCAGG - Intergenic
1112344356 13:98577308-98577330 GCTCCCACGCCCCCGCGGGCGGG + Intronic
1113942629 13:114026335-114026357 GCTGCCAGGCTCCCAGGGGGAGG - Intronic
1118318308 14:64738643-64738665 CCTCCCACGCCCCAAGGGGCTGG - Intronic
1118318628 14:64740676-64740698 GGCCCCAGGTTCCCAGGGGCTGG - Intronic
1118389971 14:65287635-65287657 GCTCCCAGGCCCCCAGAGGGCGG - Intergenic
1119618287 14:76112801-76112823 GCCCCCACCCTCCCAAGGCCTGG - Intergenic
1119788003 14:77327138-77327160 CCACCCACCCTCCCAGGGTCAGG - Intronic
1120690438 14:87586721-87586743 ACTACCAAGCTTCCAGGGGCAGG + Intergenic
1121451552 14:94011442-94011464 GCTCCCAGCCTCCCCTGGGCAGG + Intergenic
1121636216 14:95455511-95455533 GCTCCCAGGCTCCCCTGGACCGG + Exonic
1122943904 14:104996352-104996374 GCTGCCAAGCCCCCAGGGTCTGG + Intronic
1122977384 14:105176450-105176472 GCTTGCACACTCCCAGGGACGGG + Intronic
1123057325 14:105577539-105577561 GCTCCGCCGCTCCCAGCTGCAGG + Intergenic
1123063747 14:105606073-105606095 GCACCCAGGGTCCCAGGGGCAGG - Intergenic
1123080489 14:105691535-105691557 GCTCCGCCGCTCCCAGCTGCAGG - Intergenic
1124103614 15:26717404-26717426 GCTCTGAAGCTCCCAGGGACTGG + Intronic
1126185824 15:45829667-45829689 GCGCCCACCCTCCCAGGCACAGG - Intergenic
1126473824 15:49046138-49046160 GCTGCCAGGCTCCCAGGTGAGGG + Intronic
1129231887 15:74201559-74201581 GCTCCCACCCTCACCTGGGCTGG + Intronic
1129723360 15:77889683-77889705 GCTCCCACTGCCCCAGGGTCAGG - Intergenic
1130557885 15:84935592-84935614 GCTCTCCCGCTCCCTGGGCCTGG + Intronic
1130995534 15:88901769-88901791 GATCCACAGCTCCCAGGGGCAGG + Intronic
1131179230 15:90228753-90228775 GCCCCAAGGCTCCCAAGGGCCGG - Exonic
1131910971 15:97200936-97200958 GCTTCCACCCTCACAGGGGAAGG - Intergenic
1132577861 16:672186-672208 GCACCCACCCTCCCTGGGCCTGG + Intronic
1132655935 16:1041665-1041687 GCTCCCAGGCTGCCAGGGGATGG - Intergenic
1132697377 16:1207958-1207980 GCTGCCAGGCTCCCAGGACCAGG - Intronic
1132749053 16:1448924-1448946 GCACCCACGCTCTCAGGGTGAGG + Intronic
1132939974 16:2501651-2501673 GCTCCCACCCTCCCTGGGGGTGG - Exonic
1133026603 16:2991404-2991426 GCTGGCACTCTTCCAGGGGCAGG + Intergenic
1133271548 16:4613090-4613112 GTTCCCTCGCTGCCTGGGGCTGG - Intronic
1136687338 16:32003052-32003074 GCTCCGACCCTGCCTGGGGCGGG - Intergenic
1136787948 16:32946603-32946625 GCTCCAACCCTGCCTGGGGCGGG - Intergenic
1136881833 16:33907186-33907208 GCTCCAACCCTGCCTGGGGCGGG + Intergenic
1137272510 16:46911474-46911496 TCCCCCACACTCCCAGGAGCTGG - Intronic
1139361391 16:66402336-66402358 GTTCCCCCACACCCAGGGGCAGG - Intronic
1139639888 16:68283736-68283758 GGTCCCACGCTCCTTGGTGCAGG + Intronic
1139671371 16:68494022-68494044 GCTCCCAGCATCCCAGGGGATGG + Intergenic
1140855686 16:78975796-78975818 CCTCCCACCCTCCAAGGGCCTGG - Intronic
1141750837 16:85956924-85956946 GATCCCTGGCACCCAGGGGCTGG - Intergenic
1142121476 16:88388623-88388645 GCTCCCACGCCCCCTCTGGCTGG - Intergenic
1203090178 16_KI270728v1_random:1208260-1208282 GCTCCAACCCTGCCTGGGGCGGG - Intergenic
1143651236 17:8265318-8265340 GCAGCCAAGCTCCCAGGGGAGGG + Exonic
1143741642 17:8958634-8958656 CCTCCCAAGTTCCCAGGGACAGG - Intronic
1144154437 17:12485416-12485438 GCTCCAAGGGCCCCAGGGGCAGG + Intergenic
1144952318 17:19000881-19000903 CTTCCCAGGCTCACAGGGGCAGG - Intronic
1145000593 17:19301998-19302020 GCTCACAGCCGCCCAGGGGCAGG - Intronic
1145866928 17:28247663-28247685 GGGCCCAGGGTCCCAGGGGCTGG - Intergenic
1146469089 17:33110309-33110331 GCCCCCACGGTCCCAGGGCCTGG + Intronic
1146797903 17:35795616-35795638 CCTCCCTCGGTCCCCGGGGCCGG - Intronic
1147148317 17:38498721-38498743 GCTCCGACCCTGCCCGGGGCGGG - Intronic
1147582290 17:41634253-41634275 CCTCCCACCCACCCAGGGCCTGG + Intergenic
1147917412 17:43896942-43896964 CCTTCCACACTCCCTGGGGCAGG + Intronic
1147925159 17:43941413-43941435 GGGCCCAGGGTCCCAGGGGCTGG + Intronic
1148052305 17:44775320-44775342 GCTCCCATGCTCCCCGCCGCGGG - Intronic
1148481091 17:47959927-47959949 TGTCCCACTCTCCCTGGGGCAGG + Intergenic
1148556131 17:48579648-48579670 GGACCAAGGCTCCCAGGGGCAGG + Exonic
1148664242 17:49362357-49362379 GCGCCGCCGCTCCCAGCGGCCGG - Intronic
1148796961 17:50201688-50201710 GCTCCCCCTCTCCGAGGGGCAGG - Intergenic
1149597218 17:57871406-57871428 GCTCCTGGGCTCCCAGGGGCAGG + Intronic
1150285244 17:63950444-63950466 AGTCCCAGGCTCCCCGGGGCCGG - Intronic
1151187349 17:72373994-72374016 GCTGCCTGGCTCCCAGGAGCTGG - Intergenic
1152907290 17:82976290-82976312 GATTCCATCCTCCCAGGGGCTGG + Intronic
1152907488 17:82976903-82976925 GATTCCATCCTCCCAGGGGCTGG + Intronic
1152938676 17:83154505-83154527 GGTCCCACCCTCCCAGGCCCAGG - Intergenic
1155120775 18:22816652-22816674 GCTCCCGCTCTCCTAGGCGCAGG - Intronic
1155997307 18:32343832-32343854 TCTCCCAGGCTGCCAGGAGCGGG - Intronic
1156664533 18:39389885-39389907 CCTACCAAGCTCCCAGGGGGAGG + Intergenic
1157992164 18:52510285-52510307 GCTAGCACTCTCCCAGTGGCTGG + Intronic
1160266298 18:77342829-77342851 GCTGCGAGGCTCCCAGGGTCGGG + Intergenic
1160698360 19:495170-495192 GCTCCCCTCCACCCAGGGGCCGG - Intronic
1160843608 19:1157124-1157146 GGGCCCACGCCCCCAAGGGCTGG + Intronic
1161333879 19:3700608-3700630 GCCCCCTCGCGCCCAGGGGTGGG + Intergenic
1161535895 19:4818257-4818279 ACGCCCAGGCTGCCAGGGGCAGG - Exonic
1161590895 19:5128710-5128732 GCTCCCAGCCTCCCAGGGAGGGG + Intronic
1161625982 19:5327083-5327105 GCTGCCACGCTGGCAGGAGCTGG - Intronic
1162768882 19:12937423-12937445 ACTCCCGCGCTCCCAGGTCCAGG + Intergenic
1162951319 19:14073462-14073484 GCTCCCGCGCGCCCTGGAGCGGG + Exonic
1163127470 19:15251944-15251966 GCTCCCAGGCTCCCAGGCTCTGG - Intronic
1163612815 19:18309909-18309931 CCTCCCGCGCTCCCAGGGCTGGG - Intronic
1166352074 19:42203989-42204011 CCCCCCACCCTCCCAGGGACAGG - Intronic
1166369030 19:42291298-42291320 GCTGCCTTGGTCCCAGGGGCTGG - Exonic
1166792423 19:45405896-45405918 GTTTACACGCTCCCTGGGGCAGG + Intronic
1166917311 19:46204259-46204281 GATCCCAGGCACCCGGGGGCTGG - Intergenic
1167294032 19:48639123-48639145 GCCCACCTGCTCCCAGGGGCGGG - Intronic
1167667291 19:50830297-50830319 ACTCCCACCCACACAGGGGCAGG + Intronic
926170627 2:10550618-10550640 GGGGCCACGCTCCCAGGGCCCGG + Intergenic
926699752 2:15795908-15795930 GCTCCCACTCTTCCAGGAGCAGG + Intergenic
926796651 2:16625228-16625250 GCTCCCAGGCCCCCAGAGGCTGG + Intronic
928116800 2:28550960-28550982 GCTTCCAGGCACCCAGGGGATGG - Intronic
932424183 2:71618909-71618931 GCTCCCAGGCTCCCAGGCGCTGG + Intronic
933721174 2:85398640-85398662 GCTCCCACCCTCCCTGCTGCCGG + Intronic
933984226 2:87577225-87577247 CCTCCCGCACCCCCAGGGGCCGG - Intergenic
936037975 2:109128248-109128270 GCTCTGACGCTCCCAGAAGCCGG + Intergenic
936309628 2:111373571-111373593 CCTCCCGCACCCCCAGGGGCCGG + Intergenic
937265305 2:120611581-120611603 GATCCCTCCCTCCAAGGGGCAGG + Intergenic
938084975 2:128393625-128393647 GATCCCATGCTCCCAAGAGCTGG - Intergenic
938314243 2:130315245-130315267 CCTCACAGGCTCCCAGGTGCTGG + Intergenic
941412852 2:165181534-165181556 GCTGTCAAGCTCCCAGTGGCAGG + Intronic
941542508 2:166804261-166804283 GAGCCCAGGCTGCCAGGGGCAGG + Intergenic
943887553 2:193241166-193241188 ACTCCCATGGTCCCAGGGGAGGG - Intergenic
946225221 2:218260951-218260973 GGTCCCACCCTCCCAGAGGCGGG + Intronic
948377688 2:237532466-237532488 GCCCCCTCACTCCCAAGGGCCGG + Intronic
1169077105 20:2768102-2768124 GCTCCCAGGCTGGCAGGGGAGGG - Intergenic
1171457955 20:25282547-25282569 GGTCCCACCCTCCCAGCGGCTGG - Intronic
1171975797 20:31593908-31593930 CCTCCCAGGCTGCCAGGGTCAGG + Intergenic
1172032607 20:31992439-31992461 GCTCACACGCTCCCCAGGACAGG - Intronic
1172061496 20:32190091-32190113 GCTTCCCCGCGCCCAGGGGAAGG + Intergenic
1172118725 20:32585499-32585521 GCCCCCGCGCCCCCAGGGGCCGG - Intronic
1172220777 20:33273374-33273396 GCTCCCCCACTCCATGGGGCTGG + Intergenic
1172303093 20:33863388-33863410 ACTCCCACCCTCCCACGAGCGGG - Intergenic
1173465655 20:43279077-43279099 TGTCCCAGGCCCCCAGGGGCAGG + Intergenic
1174340026 20:49889751-49889773 GCCCGCACTCGCCCAGGGGCAGG - Exonic
1174340510 20:49892326-49892348 GCTGCCACCGGCCCAGGGGCTGG - Intergenic
1175678732 20:60968947-60968969 CCGCCCAGGCTCCCGGGGGCTGG + Intergenic
1176301393 21:5100703-5100725 GCCCTCGCGGTCCCAGGGGCTGG + Intergenic
1177464540 21:21458315-21458337 GCAGCCACGCTCCCAGGGCCTGG - Intronic
1178492385 21:33060976-33060998 CCACCCCCTCTCCCAGGGGCAGG + Intergenic
1178661496 21:34510909-34510931 GCCCCCACCCTCCCAGGGGCAGG - Intergenic
1179054268 21:37916647-37916669 GCACCCACGTTTCCAGTGGCGGG - Intergenic
1179149661 21:38799082-38799104 GCTCCCACCCTCCCAGCAGAGGG - Intergenic
1179482064 21:41684826-41684848 GCTCCTGCAGTCCCAGGGGCAGG - Intergenic
1179635214 21:42704328-42704350 GTCCCCACGCACCCAGAGGCGGG - Intronic
1179730460 21:43364627-43364649 GCTCCCACGCCCCCCAGTGCTGG + Intergenic
1179855638 21:44161196-44161218 GCCCTCGCGGTCCCAGGGGCTGG - Intergenic
1179996889 21:44978247-44978269 GATCCCACGCTCCCTCGGCCGGG + Intergenic
1180061123 21:45385596-45385618 GCTCCCGCACTCCCTTGGGCAGG - Intergenic
1180229269 21:46416719-46416741 GCTGCCACAGACCCAGGGGCCGG + Exonic
1181022801 22:20112506-20112528 GCTCCCAGGGCCCCAGGGGCGGG - Exonic
1184613504 22:45622059-45622081 GCAGCCACCCTCCCAGGTGCAGG + Intergenic
1184912549 22:47546085-47546107 AGTCCCACACTTCCAGGGGCAGG - Intergenic
950096961 3:10336061-10336083 GCTCCCAGGCGGGCAGGGGCTGG - Intronic
950548913 3:13654935-13654957 GCTCCCATGCCCACTGGGGCAGG + Intergenic
950915044 3:16636298-16636320 GCTCCCAAGCCCCCAGGGATTGG - Intronic
951464959 3:22991041-22991063 CCTCCCACACTCCCATAGGCTGG - Intergenic
952933012 3:38374592-38374614 GATCCCAGGGTCCCAGGGTCTGG + Intronic
954257566 3:49417223-49417245 TCTCCCACTCTGCCAGGTGCTGG - Exonic
954407845 3:50355398-50355420 GCTCCCACACCCCCAGGGAAGGG - Exonic
955911744 3:63864415-63864437 GCGCCCACGCGCGCTGGGGCGGG + Intergenic
961170867 3:124796865-124796887 TCTCCCATTCACCCAGGGGCAGG + Intronic
961508634 3:127387969-127387991 ACTCCCAGGTCCCCAGGGGCAGG - Intergenic
961820377 3:129572782-129572804 GCACGCACACTCCCGGGGGCTGG - Intronic
961828107 3:129609128-129609150 TCTCACACCCTCCCAGGGGCAGG - Intergenic
964622238 3:158729855-158729877 GCTCCCTGGTTACCAGGGGCAGG - Intronic
965695023 3:171399344-171399366 CCTCCCTCCCTCCCAGAGGCAGG + Intronic
967295306 3:187958573-187958595 GCTCCCAGGCTCCCATGTCCTGG + Intergenic
967853858 3:194101845-194101867 CCTCCCACACCCCCAGGTGCAGG + Intergenic
968462765 4:733512-733534 GGTCCCAGGCTCCCATGTGCAGG - Intronic
969666455 4:8560213-8560235 CCTCCCTCGCTCCCATGGACAGG + Intronic
970823852 4:20251683-20251705 GCCCCCTCGCTCCCACGCGCGGG - Intergenic
976272915 4:83248509-83248531 TCTCCCACTCTGCCAGGTGCTGG + Intergenic
984627562 4:182024832-182024854 GCTACCACCCTCCCAGCGTCTGG + Intergenic
984789897 4:183605813-183605835 GCTTCCACGCCCTCTGGGGCAGG + Intergenic
985665814 5:1181073-1181095 GCTCCCACGTGCTCAGGGTCGGG + Intergenic
985677160 5:1238132-1238154 CCTCTCACGCTCCCAGGTGAGGG - Intronic
985714271 5:1446597-1446619 GCTCCCCCGCTCCCCGGCTCCGG + Intergenic
985778307 5:1856896-1856918 ACGCCCCCGCTCCCAGGGCCGGG + Intergenic
985980180 5:3456345-3456367 CCTCCCATCCTGCCAGGGGCTGG - Intergenic
988882590 5:35519707-35519729 TCTCCCTCTCTCACAGGGGCAGG + Intergenic
991041651 5:62182514-62182536 CCTCCCAGGCCCCCATGGGCAGG + Intergenic
994790904 5:104224277-104224299 GCTGCCGCCCTCCCAGGCGCAGG - Intergenic
996121749 5:119680893-119680915 GCTCCCCCTATGCCAGGGGCAGG - Intergenic
997818356 5:137039601-137039623 GGTCCCACGCCCCCATGGGCAGG + Intronic
999281972 5:150372084-150372106 TCCCCCACCTTCCCAGGGGCTGG - Exonic
999637848 5:153641222-153641244 GCTGCCACATTCCCAGGGACAGG + Intronic
1001355956 5:171022814-171022836 CCTACCAAGCTCCCAGGGGGAGG - Intronic
1001532289 5:172471900-172471922 GCTTCAAATCTCCCAGGGGCAGG + Intergenic
1002291811 5:178205265-178205287 GCTCGCGCGCTGCCAGGGCCAGG + Intronic
1002347099 5:178555751-178555773 GTTCCCAGGCTCCAAGGTGCCGG + Intronic
1002716281 5:181230144-181230166 GCTCCCACGCTCACAGCTGAGGG - Intronic
1003008175 6:2401056-2401078 GCTTCCAAGCTTCAAGGGGCAGG + Intergenic
1003644357 6:7902388-7902410 GCTCCCACGCTCCCTAGAGATGG - Intronic
1005340615 6:24840365-24840387 GCTCCCATGATGCCAGGGCCTGG - Intronic
1006718530 6:36135559-36135581 GCTCCCAGTCTCCCTGTGGCGGG - Intronic
1006987415 6:38185111-38185133 GCTCCCAAACTCCAAGGGCCAGG + Intronic
1010142149 6:72623244-72623266 GCTCCCGCGCTGCAGGGGGCGGG + Intronic
1016462816 6:144296129-144296151 GCTCCCCAACTCCCAGGGCCTGG + Intronic
1018885466 6:167931900-167931922 GCTCCAAGGCTGCCAGTGGCAGG - Intronic
1019661252 7:2225236-2225258 GCCCCCTTGCTCCCAGGGACTGG + Intronic
1020281976 7:6654493-6654515 GCTGCCGCGCTCACCGGGGCCGG - Exonic
1021717708 7:23474317-23474339 GCTCCCGCGCTCCCCGGGGCCGG + Intergenic
1021868288 7:24979909-24979931 GCTCCCTAGTTCCCCGGGGCCGG + Exonic
1023512364 7:40967252-40967274 GCTGCCAGGCTCCCAGAGGCAGG + Intergenic
1024291903 7:47811118-47811140 CTTCCCACACTCCCAGAGGCTGG - Intronic
1024579775 7:50792793-50792815 GCGCCCACCCTCCCAGGCGGCGG + Intronic
1024751858 7:52475663-52475685 TCTCCCACACTCTCAGTGGCAGG + Intergenic
1026966950 7:74446164-74446186 GATCCAGAGCTCCCAGGGGCAGG + Intergenic
1027140125 7:75650830-75650852 GCTGCCACCCTCCCCAGGGCGGG - Intronic
1029424855 7:100488969-100488991 GCTCCCGCTCCCCCCGGGGCTGG - Exonic
1030049052 7:105522052-105522074 GCGCCCGCGCTCCCAGGCTCCGG - Exonic
1030285090 7:107817517-107817539 GCTCCCACTGTCCCCCGGGCTGG - Intergenic
1032394639 7:131580855-131580877 GCTCCCACGCTCACACTGCCTGG - Intergenic
1033355696 7:140597742-140597764 GGTCCCACACCCCCAGGGACAGG - Intronic
1035181116 7:157090416-157090438 GATTCCATGCTGCCAGGGGCTGG + Intergenic
1035320410 7:158025808-158025830 GCACCCACACTCCCAGCGCCAGG + Intronic
1035618853 8:1022691-1022713 GCACCCACCCTCCCTGGGGGTGG + Intergenic
1036123050 8:6038606-6038628 CCTCCCACACTCCCTGGGGGTGG - Intergenic
1036707713 8:11057575-11057597 GTTCCCACGGTCACAGAGGCTGG + Intronic
1037942491 8:22962924-22962946 GCTCACATGCACCCATGGGCAGG + Intronic
1039711567 8:40061081-40061103 GCTCCCATGCACCCATGGGAAGG + Intergenic
1040561561 8:48527388-48527410 GCACCCACTCTGCCAGGTGCTGG - Intergenic
1042837322 8:73090541-73090563 GCTCTCACCCTCGGAGGGGCAGG + Intronic
1042857118 8:73278480-73278502 GCCCCAAGGGTCCCAGGGGCAGG + Intergenic
1043924940 8:86026192-86026214 GCTCCCACTCACCCAGGGAGTGG + Intronic
1049264573 8:141660548-141660570 GCTCCCACCCTCCCTCGAGCTGG - Intergenic
1049475543 8:142795468-142795490 GCTCCCAAGCACCCAGGAGCAGG - Intergenic
1049595993 8:143483612-143483634 GCCCCCACGATCTCAGGGGCAGG + Intronic
1054916597 9:70500250-70500272 GCTCCCAAGATGTCAGGGGCAGG - Intergenic
1056785853 9:89592042-89592064 GCACCCACGCTGCCATGTGCTGG - Intergenic
1057072859 9:92115256-92115278 CCTCCCACCCTCCCCGGGCCCGG + Intronic
1057551898 9:96057264-96057286 GGCCCCACTCTCACAGGGGCAGG + Intergenic
1059352250 9:113673718-113673740 GCTCCCACCCTGCCGTGGGCTGG + Intergenic
1062625948 9:137441572-137441594 CCTCCCACCCCCCCGGGGGCGGG - Intronic
1186802983 X:13112074-13112096 GTTCCCAGGGTCCCAGGGTCAGG + Intergenic
1189351639 X:40280020-40280042 GCTCCCAGGGACCCAGGGACTGG - Intergenic
1192174853 X:68879264-68879286 CCTGCCACCCTCCCAGGAGCTGG + Intergenic
1193573302 X:83172133-83172155 GCTCCCACCCTCACATGGCCAGG + Intergenic
1194157944 X:90416142-90416164 GATCCCAGGATCCCAGGGGATGG - Intergenic
1194695360 X:97042023-97042045 GCTGCCATGCCACCAGGGGCAGG + Intronic
1197767258 X:130067190-130067212 CCACCCACGGTCACAGGGGCTGG - Exonic
1199677375 X:150199680-150199702 GCTGCAAAGCTCCCAAGGGCAGG + Intergenic
1200002786 X:153070889-153070911 GCTCCCACGCTGCCAGTGCGAGG + Intergenic
1200004937 X:153079120-153079142 GCTCCCACGCTGCCAGTGCGAGG - Intergenic
1200155464 X:153972507-153972529 GCTCCCAGGCTCCCAGGCTGCGG + Exonic
1200306115 X:155027223-155027245 GCTCAGCCGCTCCCAGGGTCCGG + Intronic
1200504268 Y:3993111-3993133 GATCCCAGGATCCCAGGGGATGG - Intergenic