ID: 1083715563

View in Genome Browser
Species Human (GRCh38)
Location 11:64573614-64573636
Sequence TCGTAGTCCTAGATTTGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083715563_1083715565 3 Left 1083715563 11:64573614-64573636 CCACTACAAATCTAGGACTACGA No data
Right 1083715565 11:64573640-64573662 CGAACATTAAAACGATAATAAGG No data
1083715563_1083715566 4 Left 1083715563 11:64573614-64573636 CCACTACAAATCTAGGACTACGA No data
Right 1083715566 11:64573641-64573663 GAACATTAAAACGATAATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083715563 Original CRISPR TCGTAGTCCTAGATTTGTAG TGG (reversed) Intergenic
No off target data available for this crispr