ID: 1083716748

View in Genome Browser
Species Human (GRCh38)
Location 11:64581803-64581825
Sequence TCCTGGGCTCTGAGGGCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083716736_1083716748 25 Left 1083716736 11:64581755-64581777 CCAGCGGGAGAGGAGGCCAAGCT No data
Right 1083716748 11:64581803-64581825 TCCTGGGCTCTGAGGGCACTAGG No data
1083716741_1083716748 9 Left 1083716741 11:64581771-64581793 CCAAGCTGGAGGGTGGAAAGTGT No data
Right 1083716748 11:64581803-64581825 TCCTGGGCTCTGAGGGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083716748 Original CRISPR TCCTGGGCTCTGAGGGCACT AGG Intergenic
No off target data available for this crispr