ID: 1083717530

View in Genome Browser
Species Human (GRCh38)
Location 11:64586417-64586439
Sequence GAAGAAGGGGTTCCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083717530_1083717538 22 Left 1083717530 11:64586417-64586439 CCTCCTGGGGGAACCCCTTCTTC No data
Right 1083717538 11:64586462-64586484 TGTTCTCCACACAGCAGCCAGGG No data
1083717530_1083717537 21 Left 1083717530 11:64586417-64586439 CCTCCTGGGGGAACCCCTTCTTC No data
Right 1083717537 11:64586461-64586483 CTGTTCTCCACACAGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083717530 Original CRISPR GAAGAAGGGGTTCCCCCAGG AGG (reversed) Intergenic
No off target data available for this crispr