ID: 1083720091

View in Genome Browser
Species Human (GRCh38)
Location 11:64599664-64599686
Sequence CAAAGGCGAACCTGGGGCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 211}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083720091_1083720106 20 Left 1083720091 11:64599664-64599686 CCCCTGCCCCAGGTTCGCCTTTG 0: 1
1: 0
2: 0
3: 14
4: 211
Right 1083720106 11:64599707-64599729 GCCCTGGACCTGCAGGCCCTGGG 0: 1
1: 0
2: 2
3: 45
4: 406
1083720091_1083720101 4 Left 1083720091 11:64599664-64599686 CCCCTGCCCCAGGTTCGCCTTTG 0: 1
1: 0
2: 0
3: 14
4: 211
Right 1083720101 11:64599691-64599713 CACCTTCTTCGGCCTGGCCCTGG 0: 1
1: 0
2: 1
3: 26
4: 217
1083720091_1083720100 -2 Left 1083720091 11:64599664-64599686 CCCCTGCCCCAGGTTCGCCTTTG 0: 1
1: 0
2: 0
3: 14
4: 211
Right 1083720100 11:64599685-64599707 TGGCTTCACCTTCTTCGGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 104
1083720091_1083720103 13 Left 1083720091 11:64599664-64599686 CCCCTGCCCCAGGTTCGCCTTTG 0: 1
1: 0
2: 0
3: 14
4: 211
Right 1083720103 11:64599700-64599722 CGGCCTGGCCCTGGACCTGCAGG 0: 3
1: 0
2: 6
3: 50
4: 405
1083720091_1083720098 -7 Left 1083720091 11:64599664-64599686 CCCCTGCCCCAGGTTCGCCTTTG 0: 1
1: 0
2: 0
3: 14
4: 211
Right 1083720098 11:64599680-64599702 GCCTTTGGCTTCACCTTCTTCGG 0: 1
1: 0
2: 3
3: 28
4: 328
1083720091_1083720105 19 Left 1083720091 11:64599664-64599686 CCCCTGCCCCAGGTTCGCCTTTG 0: 1
1: 0
2: 0
3: 14
4: 211
Right 1083720105 11:64599706-64599728 GGCCCTGGACCTGCAGGCCCTGG 0: 1
1: 1
2: 4
3: 69
4: 645

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083720091 Original CRISPR CAAAGGCGAACCTGGGGCAG GGG (reversed) Exonic
900394440 1:2447421-2447443 CACAGCAGAACCTGGGGGAGGGG - Intronic
900540618 1:3200891-3200913 AAGAGCCGAACCGGGGGCAGAGG + Intronic
900626373 1:3610501-3610523 CAAAGGAAAACGTGCGGCAGTGG - Intronic
901660240 1:10794597-10794619 CCAAGCTGAAGCTGGGGCAGAGG + Intronic
902117747 1:14136059-14136081 GAAAGGAGACCCTGGGGAAGAGG + Intergenic
902878268 1:19353793-19353815 CAAAGGCACACCTGCGGGAGGGG + Intronic
903166367 1:21523466-21523488 CAGTGGCCAACCTGGAGCAGAGG - Intronic
904347412 1:29882249-29882271 GTAAGGTGAGCCTGGGGCAGAGG + Intergenic
904577184 1:31512567-31512589 CAAAGGGTGACCTGCGGCAGGGG - Intergenic
905278730 1:36835602-36835624 CAGAGCAGAACCTGAGGCAGGGG - Intronic
905522097 1:38608254-38608276 GGAAAGCGGACCTGGGGCAGAGG + Intergenic
905597524 1:39220770-39220792 TAAAGGCCAGCCAGGGGCAGTGG - Intronic
905834022 1:41100997-41101019 CAAAGCTGAACCTGGGGTTGGGG + Intronic
907415840 1:54313249-54313271 CAAAGAAGAACCTGGGGGAGGGG + Intronic
911528976 1:99020986-99021008 CAGAGGGGAGCATGGGGCAGGGG + Intergenic
912410606 1:109478344-109478366 TAAAGGGGAGCCTGGGGCTGTGG + Intronic
912429911 1:109623620-109623642 AAGAGGCCAACCTGGGGCTGTGG + Intronic
915738006 1:158096745-158096767 GGAAGGCGAGGCTGGGGCAGGGG - Intronic
917371828 1:174301403-174301425 CACAGGCCAAACTGGGGCAAGGG - Intronic
919303328 1:195798652-195798674 CAATGGCGAAGCTGGGACATGGG - Intergenic
920697141 1:208189518-208189540 AAAAAGCGAACCTGGGGCTGAGG + Intronic
922419431 1:225449570-225449592 CTGAGGAGCACCTGGGGCAGAGG + Intergenic
1062857943 10:788882-788904 CAGAGGCCACTCTGGGGCAGGGG + Intergenic
1064271695 10:13871577-13871599 CAAAGCTAAACCTGGGGAAGGGG - Intronic
1065228933 10:23576984-23577006 CAATGGAGAACCTGGAGCAGTGG - Intergenic
1065313613 10:24440449-24440471 CAGAGGCGATTCTGGGGCACCGG - Intronic
1067460310 10:46453307-46453329 GAAAGCAGAAGCTGGGGCAGAGG - Intergenic
1067626880 10:47931296-47931318 GAAAGCAGAATCTGGGGCAGAGG + Intergenic
1074275744 10:112000214-112000236 CCAAGAGGACCCTGGGGCAGAGG + Intergenic
1074422517 10:113322024-113322046 CAAAGCAGAACCTGGGGGAGGGG + Intergenic
1076729252 10:132430006-132430028 CAAAGCCCAACCTGGGGCACAGG - Intergenic
1077997735 11:7468476-7468498 CAGAGGGGAACCTTGAGCAGAGG - Exonic
1078902232 11:15652074-15652096 CAAAAACGAAACTGGGGAAGGGG + Intergenic
1079363159 11:19786692-19786714 CAAGTGGGAACCTGGGGGAGAGG + Intronic
1082739455 11:56894494-56894516 CAGAGGCAAGGCTGGGGCAGGGG + Intergenic
1083090458 11:60193961-60193983 TAAAGGAGAATCTGGTGCAGTGG + Intergenic
1083720091 11:64599664-64599686 CAAAGGCGAACCTGGGGCAGGGG - Exonic
1084500463 11:69531941-69531963 CACAAGGGAACCTGGGGCACTGG - Intergenic
1084873491 11:72113486-72113508 TAAAGGCGAAGCTGAGTCAGAGG - Intergenic
1085212062 11:74790611-74790633 TAAAGGCGAGCCAGGTGCAGAGG + Intronic
1085618903 11:78022804-78022826 CAAGGGAGAAGGTGGGGCAGAGG + Intronic
1085807927 11:79653560-79653582 CAAAGGAAATCCAGGGGCAGAGG + Intergenic
1086888361 11:92227257-92227279 CAAAGGCGAGTCCGGGGTAGTGG + Intergenic
1088276816 11:108096200-108096222 AAAAGGAGAGGCTGGGGCAGTGG + Intronic
1088817737 11:113433154-113433176 CAAAGAGGAACCTGGAGCAATGG + Intronic
1089198745 11:116710780-116710802 CCAGGATGAACCTGGGGCAGTGG - Intergenic
1089700418 11:120240865-120240887 CAGAGGTGCCCCTGGGGCAGGGG + Intronic
1090381344 11:126329661-126329683 CAGAGGCGAACCTGGAACTGAGG - Intronic
1090456326 11:126852730-126852752 CAAAGGAGAAACTGAGGCATGGG + Intronic
1092410741 12:8251241-8251263 CAAAAGAGAACCAGCGGCAGGGG + Intergenic
1093925581 12:24905098-24905120 CAAAAGAGAGCCTGGGGCTGCGG + Intronic
1094314165 12:29119552-29119574 CAAAGGGGTACCTGGGTCTGTGG - Intergenic
1095411747 12:41932588-41932610 CAACGGCGACCCCTGGGCAGGGG - Intergenic
1100272761 12:93042171-93042193 AAAATGCGAGCCTGGGGCGGTGG - Intergenic
1102184224 12:110935078-110935100 CAAAGCAGAAGCTGGGGCGGGGG + Intergenic
1104757441 12:131277939-131277961 AAAAGGCAAACCTGGGGCCTCGG - Intergenic
1104862219 12:131929649-131929671 CAGAGGCGGAGCTGGGGCACTGG + Exonic
1106312070 13:28563219-28563241 CAAAGGCTACCCAGGGCCAGGGG + Intergenic
1107640668 13:42440016-42440038 CAAAGGCAAGCCAGAGGCAGGGG + Intergenic
1107962209 13:45568572-45568594 AAAATGGGAACCAGGGGCAGGGG + Intronic
1109687915 13:65844668-65844690 CAAGGGCGAGCCAGGTGCAGAGG - Intergenic
1113503724 13:110798725-110798747 CAAAGGTGAACCTGAGGCTATGG - Intergenic
1117784314 14:59266728-59266750 CTCAAGAGAACCTGGGGCAGAGG - Intronic
1118708346 14:68500397-68500419 CACAGGCAAACCTGGGGCCAAGG - Intronic
1121479803 14:94256128-94256150 CAAGGGAGTACCAGGGGCAGGGG - Intronic
1123104963 14:105837004-105837026 CAGAGGGGAGCCGGGGGCAGGGG + Intergenic
1125264955 15:37868008-37868030 CAAAGGCGGAGCTATGGCAGAGG - Intergenic
1125898499 15:43323547-43323569 AAAAGGCTAATCTGGGGGAGTGG - Intergenic
1127488692 15:59441861-59441883 CAGAGGTGAGGCTGGGGCAGGGG - Intronic
1128232719 15:66046835-66046857 CACAGGTGAGCCTTGGGCAGAGG - Intronic
1130897401 15:88182065-88182087 CAGAGGCTACCCTGGGGCAAGGG + Intronic
1131179191 15:90228593-90228615 CCAAGGCGGACCCGGGGCCGGGG - Exonic
1132814200 16:1818125-1818147 CAGAGGCGAACTTGGGGCCTGGG + Intronic
1132995536 16:2820593-2820615 CAAAGCCAGACCTGGGGGAGGGG - Intronic
1133262202 16:4558227-4558249 CAAAGGTGAGCCAGGGTCAGAGG - Intronic
1136395512 16:29990706-29990728 CCCAGGCCTACCTGGGGCAGGGG + Intronic
1136455692 16:30378560-30378582 CAGAGGGGGACCTGGGGCATCGG + Intronic
1138554291 16:57762912-57762934 CAGAGGAGTACCCGGGGCAGAGG - Intronic
1138660960 16:58516511-58516533 CACAGGCGTACCTGAGGCCGTGG + Exonic
1141192039 16:81831927-81831949 CACAGGCAAAGCGGGGGCAGGGG + Intronic
1142153974 16:88524854-88524876 CAGAGGAGAACCTGAGCCAGGGG + Intronic
1142412805 16:89924765-89924787 CCAAGGAGAGCCTGGGGGAGGGG + Intronic
1142669849 17:1483049-1483071 CCACGGCAAACCTGGGGCGGAGG + Exonic
1143166430 17:4899374-4899396 TCCAGGAGAACCTGGGGCAGGGG + Exonic
1143757247 17:9075972-9075994 CAAGGGTGAACCTGGGGTTGAGG - Intronic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1146201220 17:30860309-30860331 CAAAGGCAATCCAGGTGCAGTGG - Intronic
1146261895 17:31427454-31427476 CAAAAGCCTACCTGGGACAGAGG - Intronic
1147177948 17:38668515-38668537 CTATGGAGAACCTGGGTCAGGGG - Intergenic
1148470551 17:47890337-47890359 GACAGGGGAACCAGGGGCAGAGG + Intergenic
1150226579 17:63527782-63527804 GCAAGGACAACCTGGGGCAGGGG + Intronic
1150791636 17:68204769-68204791 CAAAGTCCCACCTGGGGCACTGG + Intergenic
1150972612 17:70046414-70046436 CAGAGGAGAATCAGGGGCAGAGG - Intergenic
1151318108 17:73336397-73336419 CAAAGGAGAACCAAGGGCTGAGG - Exonic
1151341205 17:73472082-73472104 CAATGGGGACCCAGGGGCAGGGG - Intronic
1152358398 17:79817792-79817814 CAGAGGTTAACCTGGGGCTGAGG + Intergenic
1152751398 17:82064086-82064108 CATGGGGGCACCTGGGGCAGGGG - Intronic
1154131342 18:11739245-11739267 AAGAGGCGAACCTGGGTGAGGGG - Intronic
1155674582 18:28414566-28414588 CAAAAGCAAACCTGGGACAGAGG - Intergenic
1160616988 18:80137902-80137924 CAAAGGAGAAGCTTGGGGAGCGG + Exonic
1160790068 19:919061-919083 CATAGGAGAACCAGGGGCTGGGG + Intronic
1160865215 19:1253204-1253226 CAAAGGCTGTCTTGGGGCAGGGG + Intronic
1162095160 19:8305927-8305949 CAAAAGGGAAACTGAGGCAGTGG + Intronic
1165425894 19:35745231-35745253 CAAAGGTGAACCGAGGGCCGGGG + Exonic
926269701 2:11355847-11355869 CAGAGGTCAAGCTGGGGCAGAGG - Intergenic
927326607 2:21812548-21812570 CCAAGTGGAACCTGGGGCAGGGG + Intergenic
927686496 2:25174854-25174876 CAGAGCCCAACATGGGGCAGGGG + Intergenic
929528125 2:42725514-42725536 CAACAGAGAACATGGGGCAGGGG + Intronic
929542235 2:42831269-42831291 CAATAGGGAACCTGGGGAAGGGG + Intergenic
929896088 2:45962022-45962044 CAAAGGCGAGGCTGGGGTTGAGG - Intronic
930747007 2:54895261-54895283 CAAAAGCAAGCCTGGGGAAGGGG - Exonic
931428554 2:62192386-62192408 CAGAGGCAAACCTCTGGCAGAGG - Intergenic
933560953 2:83885418-83885440 CACATGGGAACCTGGGGCAAAGG + Intergenic
934657308 2:96123010-96123032 GAAAGCCGGAGCTGGGGCAGAGG + Intergenic
936471081 2:112799264-112799286 AAAAGGAGAGCCTGGGCCAGGGG + Intergenic
936921716 2:117695965-117695987 CAAAAGTGAACATGTGGCAGGGG + Intergenic
937039055 2:118807108-118807130 CAGAGGGAAACGTGGGGCAGAGG + Intergenic
938342290 2:130543821-130543843 CAGAGGAGACCCTGTGGCAGAGG + Intronic
938347542 2:130576888-130576910 CAGAGGAGACCCTGTGGCAGAGG - Exonic
938500639 2:131829971-131829993 GGAAGTCGAAGCTGGGGCAGTGG + Intergenic
940748244 2:157595387-157595409 CAAAGTCTAAACTGGGCCAGAGG - Intronic
945115770 2:206406451-206406473 CAAAGGCTAACTTGGGTGAGTGG + Intergenic
945167424 2:206960840-206960862 CAAAGACGATCCTGTAGCAGAGG - Exonic
945689723 2:213018527-213018549 TAAATGCCTACCTGGGGCAGGGG - Intronic
946194139 2:218023059-218023081 CAAAGGCCAATCTGGGGAGGAGG + Intergenic
947766783 2:232642984-232643006 CAAGGGTGGCCCTGGGGCAGTGG + Intronic
1168834357 20:868079-868101 CAGAGGGGAACCTGAGGCACAGG + Intergenic
1168945133 20:1748114-1748136 CAAATGCCTCCCTGGGGCAGAGG + Intergenic
1171457555 20:25280592-25280614 CAAAGAGGAACCTGAGGCTGTGG - Intronic
1171460249 20:25294051-25294073 CCAGGGCCATCCTGGGGCAGGGG + Intronic
1172905288 20:38364520-38364542 CAAAGCCTATCGTGGGGCAGGGG - Intronic
1175835396 20:61990602-61990624 CGCAGTCAAACCTGGGGCAGGGG + Intronic
1180980608 22:19876422-19876444 CACAGGCATCCCTGGGGCAGAGG + Intronic
1182073104 22:27477128-27477150 CAACGGCTGACCTGGGGCAGGGG + Intergenic
1183034004 22:35127027-35127049 CAAAGGAGAGCCTGGGTCAAAGG - Intergenic
1183412341 22:37662319-37662341 CAAAGGCAAAGATGGGGAAGGGG - Intronic
1183518677 22:38283475-38283497 GAAAGGCCCACCTGGGGCAAAGG - Intergenic
1183973602 22:41496955-41496977 CAGAAGGGAGCCTGGGGCAGTGG + Intronic
1184169799 22:42752156-42752178 CAGAGGCAATCCCGGGGCAGCGG - Intergenic
950161602 3:10764746-10764768 CAGAGGCGAGGCAGGGGCAGTGG - Intergenic
952336657 3:32409255-32409277 AAACGGAGAACCTGGGGCAAGGG - Intronic
952842533 3:37660539-37660561 GAAAGGCCAGACTGGGGCAGTGG - Intronic
954007115 3:47600352-47600374 CACTGGTGTACCTGGGGCAGTGG + Intronic
956824270 3:72983301-72983323 CAAAGGGGAATATGGGGTAGGGG - Intronic
957226312 3:77452487-77452509 CAAAGGGGTACCTGGGGGATTGG - Intronic
961650804 3:128415859-128415881 CAGAGGGGAAACTGAGGCAGGGG + Intergenic
961788094 3:129359423-129359445 GTAAGGCTGACCTGGGGCAGGGG + Intergenic
962389038 3:134956459-134956481 CTAAGGTCATCCTGGGGCAGGGG - Intronic
966526743 3:180927922-180927944 CAAAGGAGAAAAGGGGGCAGAGG - Intronic
967291584 3:187926102-187926124 CAAAGACTAACCAGGCGCAGTGG + Intergenic
968255930 3:197271498-197271520 AAAAGCAGAACCTGAGGCAGAGG - Intronic
968998772 4:3963661-3963683 CAAATGAGAACCAGCGGCAGGGG + Intergenic
969327428 4:6452059-6452081 CACAGGCCACTCTGGGGCAGAGG - Intronic
970155652 4:13139462-13139484 CAAAGGCTGACCTCAGGCAGAGG + Intergenic
971439108 4:26660742-26660764 CAAAGGCAGACCAGGGGTAGTGG - Intronic
977809869 4:101346633-101346655 CAGAGGAGAACCTGGGGCGGGGG + Intronic
981567902 4:146120059-146120081 CCAAGGTGAACCTGGTGCAGTGG + Intergenic
981780690 4:148426199-148426221 AAGAGGAGAACCTGGGGCATGGG - Intronic
982689426 4:158531313-158531335 CAAAGGCAGACCAGGTGCAGTGG - Intronic
985018485 4:185661963-185661985 CCAGGGAGAAACTGGGGCAGAGG - Intronic
985521883 5:377641-377663 CACAGGAGGATCTGGGGCAGGGG - Intronic
985867135 5:2522864-2522886 CAATGGAGAAGCTGGGGAAGTGG + Intergenic
986525007 5:8664270-8664292 CATAGGCGAACCTGTGTCATGGG - Intergenic
992001853 5:72443932-72443954 CAAGGGTGACCTTGGGGCAGAGG - Exonic
992015670 5:72573013-72573035 GAAAGGGGAAGCTGGGGCTGGGG + Intergenic
995417424 5:111926198-111926220 TAAAAGCGAAACTGGGGAAGTGG + Intronic
996416020 5:123211240-123211262 CAAAGCCTGACATGGGGCAGAGG - Intergenic
996423373 5:123286086-123286108 CAAAGACGAACTTCAGGCAGAGG - Intergenic
997400994 5:133602234-133602256 CAAAAGCTACCCTGGAGCAGGGG + Intronic
998186493 5:139983527-139983549 CAATGGAGAACCAGGGGCAATGG - Intronic
1001011803 5:168105431-168105453 GGAAGGGGAACCTGGGGCAGAGG + Intronic
1001237534 5:170042739-170042761 ATAAGGGTAACCTGGGGCAGTGG - Intronic
1003591332 6:7439467-7439489 CAAAGGAGAAATTGGGGAAGTGG - Intergenic
1006629166 6:35418920-35418942 CCAAGGGGAAGCTGGGGGAGTGG + Intronic
1009930234 6:70168660-70168682 AAAAGGCGATCCTGGCCCAGTGG + Exonic
1010369448 6:75090164-75090186 CAGAGGAGAACCTGGGCCTGGGG - Exonic
1011547788 6:88499838-88499860 CAAAGGCTAACCTGGCACATTGG - Intergenic
1017305621 6:152914933-152914955 CACAGGTGAAGGTGGGGCAGTGG + Intergenic
1017991047 6:159490037-159490059 CCAAGTCTAACCTGGGGAAGGGG + Intergenic
1018997405 6:168720379-168720401 CAAAGGTGAAGCAGGAGCAGGGG - Intergenic
1019313700 7:375029-375051 CACAGGAGACGCTGGGGCAGAGG - Intergenic
1020006521 7:4786320-4786342 CAAAGGCCAGCATGGGGCTGTGG - Exonic
1021915865 7:25431833-25431855 CAATGCTGAACCTGGGGAAGGGG + Intergenic
1022965062 7:35465037-35465059 GAAGGGAGAACTTGGGGCAGGGG - Intergenic
1025128797 7:56364979-56365001 CAGAGGCTAGACTGGGGCAGGGG + Intergenic
1025788523 7:64666378-64666400 CCAAGGAGAACTTGGGGCCGCGG - Intronic
1026896795 7:74014023-74014045 CCATGGCCAAGCTGGGGCAGAGG + Intergenic
1026959416 7:74398957-74398979 AAGAGGCTACCCTGGGGCAGAGG - Intronic
1027131130 7:75592188-75592210 CGGAGGTGAACCTAGGGCAGGGG + Intronic
1029002179 7:97165992-97166014 TAGAGGCAAACCTGGGGCAGGGG + Intronic
1030561010 7:111086064-111086086 CAAAGGTAAACATGGGGCATGGG - Intronic
1030890878 7:114997460-114997482 GAAAGGGTCACCTGGGGCAGTGG + Intronic
1031844002 7:126782280-126782302 CAAAGGTGAAACTGAGACAGAGG + Intronic
1032087536 7:128891688-128891710 CACAGGGGGCCCTGGGGCAGGGG + Exonic
1033134910 7:138776270-138776292 CGATTGTGAACCTGGGGCAGTGG + Intronic
1034231819 7:149535601-149535623 CAAAGGTGAAGCTGGGGCAAAGG - Intergenic
1034306855 7:150050076-150050098 CAAAAGCACAGCTGGGGCAGAGG - Intergenic
1034457764 7:151180633-151180655 TAAAGGCGGACTGGGGGCAGTGG - Intronic
1034584516 7:152077338-152077360 CAAAAGCGGCCCTGGGTCAGAGG - Intronic
1034799990 7:154050568-154050590 CAAAAGCACAGCTGGGGCAGAGG + Intronic
1034999229 7:155598478-155598500 CAAAGGGAAATCAGGGGCAGGGG - Intergenic
1035724213 8:1814457-1814479 CAAAGGCAAAAGAGGGGCAGAGG - Intergenic
1036851111 8:12202355-12202377 CAAATGAGAACCAGCGGCAGGGG + Intergenic
1036872475 8:12444629-12444651 CAAATGAGAACCAGCGGCAGGGG + Intergenic
1039441620 8:37598992-37599014 CAAAGGTTAAACTGGGGAAGGGG + Intergenic
1042951385 8:74203879-74203901 AAAAGCAGAACCTGGGGCAGGGG + Intergenic
1044994722 8:97828304-97828326 GAAGGGAGACCCTGGGGCAGGGG + Intronic
1045101677 8:98850790-98850812 CAGAGTTTAACCTGGGGCAGTGG + Intronic
1045342412 8:101266587-101266609 CAGAGGGGAGCCTGGAGCAGAGG - Intergenic
1056379846 9:86047223-86047245 AAAGGGCCAAGCTGGGGCAGAGG + Intronic
1057035878 9:91811368-91811390 CTGGGGCGGACCTGGGGCAGTGG - Intronic
1058108597 9:101004068-101004090 CAAAGGAGATCCTGGGGAACAGG + Intergenic
1059123549 9:111662628-111662650 CAAAGGAGAAACTGAGGCACAGG - Intronic
1061116361 9:128615620-128615642 TTCAGGCGATCCTGGGGCAGGGG - Exonic
1061221169 9:129253181-129253203 CAGAGGGTGACCTGGGGCAGAGG - Intergenic
1061907973 9:133708519-133708541 CAAAGGGGACTCTGGTGCAGGGG - Intronic
1062494056 9:136823285-136823307 CAACGGCGAACCGGGCCCAGGGG - Intronic
1062541562 9:137043907-137043929 CAGAGGGGAAACTGAGGCAGAGG - Intronic
1062623730 9:137433871-137433893 CAAGGGCGAGGCAGGGGCAGGGG + Intronic
1186506356 X:10096124-10096146 CAAAAGCTCACCTGGGGGAGGGG + Intronic
1186977038 X:14918539-14918561 CTTAGGTGAACCTGGGGAAGAGG + Intronic
1187437511 X:19286454-19286476 CAAAGAATAACCTTGGGCAGTGG - Intergenic
1198177750 X:134172686-134172708 TAAAGGCGCGCCTGGGACAGCGG + Intergenic
1198343715 X:135739711-135739733 TAAAGGCTAACATGGAGCAGAGG - Intergenic
1200134675 X:153869127-153869149 CAGAGGCGCATCTGAGGCAGAGG - Intronic
1200137903 X:153883764-153883786 CATGGGAGAACCTGGGGTAGTGG - Intronic