ID: 1083720625

View in Genome Browser
Species Human (GRCh38)
Location 11:64601905-64601927
Sequence CTGAGCTCTGGGCAGGTGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 1, 2: 6, 3: 57, 4: 551}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083720625_1083720630 -4 Left 1083720625 11:64601905-64601927 CCGTCCACCTGCCCAGAGCTCAG 0: 1
1: 1
2: 6
3: 57
4: 551
Right 1083720630 11:64601924-64601946 TCAGAGCTAACCACCATCCATGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083720625 Original CRISPR CTGAGCTCTGGGCAGGTGGA CGG (reversed) Exonic
900115278 1:1025518-1025540 CTGAGCCCTGGGCAGGAGAGGGG - Intronic
900208318 1:1440954-1440976 CTGGGCCCAGGGCAGGTGGCTGG + Exonic
900300338 1:1973812-1973834 TGGGGCTCTGGGCAGGTGCAGGG + Intronic
900343102 1:2197838-2197860 CTCTGCTCTGGGCACGTGGCGGG + Intronic
901033293 1:6321061-6321083 CTGAGCTATGGCCATGGGGAAGG + Intronic
901371579 1:8802927-8802949 CAGGGCCCTGGGCAGCTGGATGG - Intronic
901637393 1:10676657-10676679 CTGAGCTGTAGGCTGGTCGAGGG - Intronic
902406133 1:16184658-16184680 CTGGGGTCTGGGCAGGTGGTGGG - Intergenic
902441089 1:16430513-16430535 CTGGGCTCTGGGGAGGGGCATGG + Intronic
903102771 1:21047458-21047480 CTGAGCTCCTGGGAGGTGGCGGG - Intronic
903740640 1:25556545-25556567 CAGACCTCTGGGCAGGGGCATGG + Intronic
904432699 1:30475268-30475290 CTGCCCGCTGGGCAGATGGATGG + Intergenic
904488990 1:30846730-30846752 CTGCGTTCTGGGCAGGAGGAAGG + Intergenic
904625752 1:31800998-31801020 CAGAGCTTTGAGCAGGAGGAGGG - Intronic
904750853 1:32741030-32741052 TTGAACTCTGGGCAGGTGAGAGG - Intergenic
906148775 1:43575672-43575694 CTCTGCTCTGGGGAGGAGGAGGG - Intronic
906791136 1:48659638-48659660 CTGAGCTCTGCTCACCTGGAGGG - Intronic
906966418 1:50461447-50461469 CTGAGTTGTGGGTAGGTAGATGG - Intronic
908168711 1:61483955-61483977 GGGAGCCCTGGGCAGGAGGAGGG + Intergenic
908396401 1:63729158-63729180 CTCATCTCTGGGCAGGTCCATGG - Intergenic
908788001 1:67754157-67754179 CAGATTTCTGGGCAGCTGGAGGG + Intronic
908948054 1:69523955-69523977 ATGAGCTCTGGGGAGGTGAGAGG + Intergenic
911061381 1:93751097-93751119 CTGAGTTCTGGTCAGGATGAAGG - Intronic
911240112 1:95455811-95455833 CTGAGCTCTGGGGAGGTGGTCGG + Intergenic
912449503 1:109760502-109760524 CTGGGCCCTGGGCAGGGGGGTGG - Intronic
912490546 1:110060471-110060493 CTGAACTCTGGGCTGGAGGCAGG - Exonic
912538128 1:110391198-110391220 CTATGCTCAGGGCAGGGGGATGG + Intergenic
912709673 1:111941419-111941441 CCCAGCTCTGGGGAGCTGGACGG - Intronic
912953057 1:114133887-114133909 CTGAGCTCAAGGCTAGTGGAGGG - Intronic
914831864 1:151176063-151176085 TTTAGCTCTGGCCAGGTGGGGGG + Intronic
915140872 1:153767810-153767832 CTGACCTCTGTGTAGATGGAGGG - Exonic
915195688 1:154187956-154187978 CTGGGCTTTGGGCAAGTGGATGG - Intronic
915515532 1:156410345-156410367 CTGATGTCGGGGCAGGGGGATGG - Intronic
915591835 1:156875281-156875303 CTGGGCTCTGTGGGGGTGGAGGG + Intronic
915937348 1:160097336-160097358 CTGGTCCCTGGGCAGGTGGCAGG - Intronic
916353082 1:163874355-163874377 CTGCACTTTGGGCAGGAGGAGGG + Intergenic
916550421 1:165844662-165844684 CTGACCTCTGGGGAGGTGAGAGG + Intronic
916576653 1:166072933-166072955 CACAGCTCTGGGCAGGAAGATGG - Intronic
917319050 1:173759565-173759587 CTCAGCTCTGGGCTGGTAGTAGG - Intronic
917814456 1:178693459-178693481 CTGAGCACTGGGTGTGTGGAAGG - Intergenic
917962406 1:180155219-180155241 CTGCCCACCGGGCAGGTGGAGGG - Intronic
917972526 1:180217959-180217981 ATGAGCTCTGAGCAGGAGCATGG - Intergenic
918972196 1:191433762-191433784 CTGGGCTCTGGGCTGGTGCTGGG - Intergenic
919070678 1:192751445-192751467 CTCAGCTCTTGGGCGGTGGATGG - Intergenic
919820773 1:201470512-201470534 CTGCTCTTTGGGCAGGAGGATGG - Intergenic
920329863 1:205199153-205199175 GTGTGCTCTGGGCAGGATGATGG - Intronic
920558086 1:206919081-206919103 TTGTGCTGTGGGCAGGAGGAAGG - Intronic
921108444 1:212008584-212008606 CTGACGTCGGGGCAGGAGGACGG - Intronic
922608682 1:226908198-226908220 CAGAACTCTTGGCATGTGGAAGG + Intronic
923046689 1:230361178-230361200 ATGAGCACTGTGGAGGTGGAGGG - Intronic
923211976 1:231811662-231811684 CTGAGGATTGGGCAGGTGAAAGG + Intronic
923328346 1:232899912-232899934 CTGAGTTCCAGGCAGGTAGAAGG + Intergenic
923729693 1:236538468-236538490 CTGTGCTTTGGGTAGCTGGATGG + Intronic
924586504 1:245365515-245365537 CTGAGCTGTAGGCTGGTGGGGGG - Intronic
1062774918 10:136185-136207 CGGAGCTCTGGGTGGGAGGAGGG - Intronic
1062842486 10:681818-681840 CTGAGCTCTGAAGAGGAGGAAGG - Intronic
1063320264 10:5045743-5045765 CTGAGCTCCAGGCTGGTGCACGG + Intronic
1063386752 10:5620672-5620694 CTCAGCTCAGGGCTGGTGCAGGG - Intergenic
1063418315 10:5890513-5890535 CCGGGCCGTGGGCAGGTGGAGGG + Intronic
1063677307 10:8152404-8152426 CGGAGCTCTGGGCTAGGGGATGG - Intergenic
1065116503 10:22488382-22488404 CTGAGCCCTGGGAAGATGCAAGG - Intergenic
1065490148 10:26274663-26274685 GTGAGCCCTGGGCATGTGGGAGG + Intronic
1066048524 10:31615272-31615294 CTGAGCTCTGGGGAGGTAGTGGG + Intergenic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1067549683 10:47225698-47225720 CTGAGCGCTGGGGATGTGGAGGG - Intergenic
1067820884 10:49529109-49529131 CTGAGTTCTGGTGATGTGGAAGG - Intronic
1067852683 10:49764320-49764342 GTGAGGTTGGGGCAGGTGGAAGG - Intergenic
1068608654 10:59034108-59034130 CTGAGCCCTTGGCAGCTGGAAGG + Intergenic
1069382042 10:67851201-67851223 CTGGGATCTGGGCAGGAGGCTGG + Intergenic
1070538138 10:77394501-77394523 CGAAGCAGTGGGCAGGTGGATGG + Intronic
1070592587 10:77811414-77811436 CTGAGCTGAGGACAGGTGGAGGG - Intronic
1071007078 10:80895254-80895276 GCTAGCTCTGGGCAGGTGCAGGG + Intergenic
1071516095 10:86298830-86298852 CTGAGCTCTGGCCTGGTATAAGG + Intronic
1071861445 10:89677501-89677523 CTGAGCTCTAGGCAGGAAGAAGG + Intergenic
1071874285 10:89827465-89827487 CTGGGCTTTGGTCAGGTGGTTGG + Intergenic
1072606702 10:96990166-96990188 CTGGGGGCTGGGCAGGGGGAGGG - Intergenic
1072608729 10:97003056-97003078 CTGAGGTCTGGGCAGCTCCATGG + Intronic
1072726419 10:97816769-97816791 CTGGGCTCTGGCCAGGGGGCTGG + Intergenic
1072751797 10:97986078-97986100 CTGGGCTCTGGGAAGGAGGAAGG + Intronic
1072921257 10:99579034-99579056 CTGTGCTCTGGGCAGGAGCAGGG + Intergenic
1073199653 10:101724997-101725019 CTGTGCACTGGGGAGGAGGAGGG - Intergenic
1074185797 10:111098615-111098637 CTCAGGTCTGGGGAGGTAGAGGG + Intergenic
1075071172 10:119320823-119320845 CTGAGCACGGGGGAGGTGGGAGG + Intronic
1075592642 10:123703644-123703666 CTGAGCTGTGGGCAGAGGGAGGG + Intergenic
1075737440 10:124672649-124672671 CTGAACTCTGGGCTGGAGAAGGG - Intronic
1075914344 10:126154577-126154599 CTGCCCTCTGGGAAGGAGGAAGG - Intronic
1076450256 10:130552190-130552212 CTGTGGGCTGGGGAGGTGGAGGG + Intergenic
1076501348 10:130938870-130938892 CTATGCTCTGGGCAGGGGGCTGG - Intergenic
1076561881 10:131372206-131372228 GGGAGCCCTGGGCAGCTGGATGG - Intergenic
1076618598 10:131772514-131772536 CTCAGCCCTGGGCAGGAGGGAGG + Intergenic
1076738470 10:132468963-132468985 CTGACCCCTGGGCAGGGGGCAGG - Intergenic
1076908993 10:133378187-133378209 CTGAGCTCCAGGCAGGGAGAGGG - Intergenic
1077002826 11:333192-333214 CTGTCCTCTGGGCAGATGGCAGG + Intergenic
1077179198 11:1204604-1204626 CCGAGCTCTGGGCAGCAGGGTGG + Intergenic
1077205526 11:1341331-1341353 GTCAGCTCTGGGGAGGTGAAGGG - Intergenic
1077469175 11:2748796-2748818 CTGTGTTCTGGCCAGGTGAATGG + Intronic
1078008031 11:7547255-7547277 GTGAGCTCAGGGTAGGGGGATGG + Intronic
1079022894 11:16924030-16924052 CTGGGCTCTGGGGAGGTGGGAGG - Intronic
1079344550 11:19640695-19640717 CAGTGTTCTGGGCAGGTGGCTGG + Intronic
1080809560 11:35689796-35689818 CTGAGGACTGGGCAGGGGGAAGG - Intronic
1081663856 11:44904915-44904937 CTGAGGGCTGGGCTGATGGAAGG + Intronic
1081727082 11:45337814-45337836 CAGAGCGCTGGGCAGTGGGAAGG + Intergenic
1082561737 11:54627443-54627465 CTGAGCACTGGGCAGTTGTGTGG + Intergenic
1082778957 11:57271318-57271340 CTGGGATGTGGGCAGGTGAATGG - Intergenic
1082811048 11:57479184-57479206 CTGGGGCCTGGGCAGGGGGAGGG + Intergenic
1083280056 11:61621245-61621267 CTGAGCTCTGCACTGTTGGAAGG - Intergenic
1083470724 11:62881916-62881938 CTGAGCTCTCTGAAGGTGAAGGG + Exonic
1083484672 11:62975879-62975901 GTAGGCTCTGGGCTGGTGGAGGG - Intronic
1083635178 11:64117058-64117080 GTGGGCGCTGGGCAGGTTGAGGG - Exonic
1083642396 11:64152599-64152621 CTGAGGTCTGGGGAGGCTGAGGG + Intronic
1083720625 11:64601905-64601927 CTGAGCTCTGGGCAGGTGGACGG - Exonic
1083766389 11:64843507-64843529 CTGAGCTCTGGGAAGGCACAAGG - Intronic
1083798872 11:65034972-65034994 CCAAGTTCTGGGAAGGTGGAAGG - Intronic
1083853461 11:65380679-65380701 CTAGGCAGTGGGCAGGTGGAGGG - Intronic
1083893375 11:65607939-65607961 AAGGGCTCGGGGCAGGTGGATGG + Exonic
1083964876 11:66037287-66037309 ATGAGATCTGGGCGGGTGGGGGG - Intergenic
1084164476 11:67368744-67368766 GTGAGGTCTGGGCAGGCAGAGGG + Intronic
1084194462 11:67516557-67516579 CTGAGGCCTGGGGAGGTGGTGGG + Intergenic
1084216424 11:67649102-67649124 CTGAGTCCTTGGCAGGTGGTGGG + Intronic
1084429423 11:69102952-69102974 CTGTGCTCTGGCCAGGAGGAAGG + Intergenic
1084569628 11:69951567-69951589 CTGAGCTCTGGGCAGGTCAAGGG + Intergenic
1084616032 11:70236557-70236579 CTGAGCCCAGGCCAGGTGAATGG + Intergenic
1084823246 11:71708949-71708971 CTGAGCTCTCGTCACCTGGAGGG - Intergenic
1085690183 11:78658161-78658183 CTGAGCACAGGGCGGGTGCAAGG - Exonic
1086052212 11:82606575-82606597 GTGAGCTCTGGGAAGGCAGAGGG + Intergenic
1086495728 11:87402718-87402740 CTGAGTTGTGGGCAGGTTTATGG + Intergenic
1087138670 11:94744531-94744553 CTGACCTCTGGGGAGGGGAAAGG - Intronic
1087804387 11:102539700-102539722 CTGGGCTCTGGGCTGGTAGTGGG - Intergenic
1087866067 11:103228486-103228508 CTGGGCTCTGGGCTGGTGTTGGG + Intronic
1088129601 11:106471779-106471801 TAGAACACTGGGCAGGTGGAAGG - Intergenic
1089311305 11:117559979-117560001 AGGAGCTCTGGGCAGGGGGCTGG - Intronic
1089535134 11:119156409-119156431 CTTGGCACTGGGCTGGTGGATGG - Exonic
1089580773 11:119480926-119480948 CCGGGCTCTGAGCAGGGGGATGG - Intergenic
1090071217 11:123546206-123546228 CTGACCTCAGGGAAGGAGGATGG + Intronic
1090410829 11:126508523-126508545 ATGAGCCCTGGGATGGTGGAAGG + Intronic
1090421322 11:126577302-126577324 CTGCGCTCAGGTCAGGTCGATGG + Intronic
1090482112 11:127078020-127078042 CTGGGCTGGGGGCAGGAGGATGG - Intergenic
1090674021 11:128972521-128972543 CAGATCTCTGGGAAGGCGGAGGG + Exonic
1090829419 11:130410670-130410692 CTGCACACTGGGCAGTTGGATGG + Intronic
1091156992 11:133383203-133383225 CTGAGCTGTGGGCAGGACAATGG - Intronic
1091473541 12:751987-752009 CTGAGCTCTGAGTCGGAGGAGGG - Intergenic
1091786944 12:3248888-3248910 CTGGGAGCTGGGCAGGTGGTGGG - Intronic
1092731314 12:11537867-11537889 GTGAGCTCTGGGCATGTGACAGG - Intergenic
1093542871 12:20308595-20308617 ATGAGAACTAGGCAGGTGGAGGG - Intergenic
1095507980 12:42918495-42918517 CAGAGCTCTGGGTGGGGGGAAGG - Intergenic
1096199923 12:49674160-49674182 CCGAGCTCTGGAGAGGAGGATGG - Intronic
1096490259 12:52009174-52009196 CTGAGCCCTGGGCAGTAAGATGG - Exonic
1097177528 12:57152015-57152037 CTGGCCTTTGGGGAGGTGGAAGG + Intronic
1097515057 12:60594436-60594458 CTGCGCTGTGGGCGGTTGGAAGG - Intergenic
1098918364 12:76280040-76280062 CTGGGCTAGGGCCAGGTGGAAGG + Intergenic
1098918389 12:76280215-76280237 CTGGGCTAGGGCCAGGTGGAAGG + Intergenic
1099392365 12:82097423-82097445 CTGGGCTCTGGGCTGGTACAGGG + Intergenic
1102217712 12:111173324-111173346 TTGATCTGTGGGCTGGTGGATGG + Intronic
1102259583 12:111436042-111436064 CTGGGGACAGGGCAGGTGGATGG + Intronic
1102352474 12:112204290-112204312 CTGAGTTCTGGGAAGTGGGAAGG + Intronic
1102540595 12:113616470-113616492 GTCACCTCTGGGCTGGTGGATGG + Intergenic
1102961644 12:117097264-117097286 CTGAGCTCTGGGCAGCAAGAAGG + Intronic
1103342929 12:120230654-120230676 ATGTGCTCTGGGCTGGGGGAGGG - Intronic
1103902789 12:124311940-124311962 CTGGGCTCTGCGCGGGAGGAGGG + Intronic
1103970319 12:124666777-124666799 CTCAGCCCTGGGCAAGGGGAGGG - Intergenic
1104131747 12:125900364-125900386 CTCAGCCCTGGGCAGGTGTCAGG - Intergenic
1104467033 12:128999064-128999086 CTGAGTTCTGGACAGGAAGAAGG - Intergenic
1104558939 12:129826268-129826290 CTCAGCTCTGGTCAGCAGGATGG - Intronic
1104798024 12:131533238-131533260 CTGGGCTCTGGACAGGTGCGTGG + Intergenic
1104803474 12:131570284-131570306 CTGAGCTCGGAGCTGGTGGAGGG + Intergenic
1104804413 12:131575896-131575918 CTGAGCCCAGGGCAGGTGGCAGG - Intergenic
1104880525 12:132067695-132067717 CTGAGGTCTTGGCAGGGGGATGG + Intronic
1104974022 12:132544029-132544051 CGGGGCCCTGGGCAGGAGGAAGG + Intronic
1105600836 13:21885664-21885686 CTGAGCACCTGGCAGGTGGCAGG + Intergenic
1105631861 13:22177359-22177381 TTCTGCTCTGGGCAAGTGGATGG + Intergenic
1106100339 13:26689858-26689880 CTGAGCTCTGGGAGGCAGGAAGG + Intergenic
1106385316 13:29279281-29279303 CTGTGCTGTGGTCAAGTGGAAGG + Intronic
1113728497 13:112623446-112623468 CAGATCTCTGTGCTGGTGGAGGG - Intergenic
1113767936 13:112892672-112892694 CTGGGCTCAGGGAAGGAGGAGGG - Intergenic
1114698093 14:24646177-24646199 CTGAGGTCTTTTCAGGTGGAAGG - Intergenic
1116867429 14:50042202-50042224 CTGAGTTCTGGACAATTGGAAGG + Intergenic
1117410990 14:55450921-55450943 CTGAGCTGGGGGCAGGAGGCAGG + Intronic
1117479320 14:56127622-56127644 CTGAGTGCTGTGCAGGTGGCTGG - Intronic
1117516251 14:56504735-56504757 CTCAGCTCTGGTCCTGTGGAAGG - Intronic
1118137313 14:63044871-63044893 CTGGGCTCTGGACAGGTGGGAGG + Intronic
1118181404 14:63497013-63497035 TAGAGCTGTGGGCAGGGGGAGGG - Intronic
1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG + Intronic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1120401436 14:84037444-84037466 CTGAGCTCTGGGAAGCAAGAGGG - Intergenic
1120641689 14:87020969-87020991 CCGAGCGCCGGGCATGTGGAGGG + Intergenic
1120711633 14:87798702-87798724 CTAAGCTGGGGGCAGGGGGATGG + Intergenic
1121096238 14:91219897-91219919 CAGAGCTCTGGGCAGGGGGTGGG + Intronic
1121301252 14:92873021-92873043 CAGAGGTTTGGGCAGGAGGAAGG + Intergenic
1121687895 14:95852767-95852789 CTGTGTTTTGGGCAGGAGGATGG + Intergenic
1121738002 14:96232058-96232080 AGGAGATCTGGCCAGGTGGAAGG + Intronic
1121783204 14:96635891-96635913 CTGAGCTATGGGCAGGCCCAAGG + Intergenic
1121876807 14:97460197-97460219 CTGTGCTCTGAGCAGGTGTTTGG + Intergenic
1122325787 14:100880075-100880097 CAGAGCTCAGGGCAAGAGGAAGG + Intergenic
1122631278 14:103108823-103108845 CTGAGACCTGGTCAGGAGGAAGG + Intronic
1122637325 14:103136173-103136195 CTGAGGTCTGGGCAGGGGCAGGG + Exonic
1122689656 14:103526192-103526214 CGGCGCTCTGGGAGGGTGGAAGG - Intergenic
1122718020 14:103706961-103706983 GTGGGGTCTGGGCAGGTGGGCGG - Intronic
1122985382 14:105209377-105209399 CTGAGCTCTGGGCGGGGGTAGGG + Exonic
1123054441 14:105562374-105562396 GGGAGCCCTGGGCAGGTGGTGGG + Intergenic
1123079025 14:105682793-105682815 GGGAGCCCTGGGCAGGTGGTGGG + Intergenic
1123105377 14:105839004-105839026 CCCAGGTCTGGCCAGGTGGATGG + Intergenic
1123154318 14:106209838-106209860 CTGTGCTCCCTGCAGGTGGAGGG - Intergenic
1125501526 15:40242716-40242738 CTGAGCTCTGGTGGGGTGGAGGG - Intronic
1125930799 15:43598739-43598761 CAGAGCTCTGAGCAGGTTCAGGG + Intronic
1125943965 15:43698553-43698575 CAGAGCTCTGAGCAGGTTCAGGG + Intronic
1126201538 15:45992207-45992229 CAGAGCTGAGGGCAGGGGGAAGG + Intergenic
1127562237 15:60150822-60150844 CTGAACTCCAGGCAGGTGGGTGG + Intergenic
1127739348 15:61885027-61885049 CTGACCTCAGTGCAGGTGTAAGG - Intronic
1127758324 15:62113950-62113972 CTGCCCTGAGGGCAGGTGGAGGG - Intergenic
1127826536 15:62708805-62708827 CTGTGCTGTGGGTGGGTGGATGG + Intronic
1128538056 15:68505329-68505351 TTCTGCTCTGAGCAGGTGGAGGG + Intergenic
1128562164 15:68676031-68676053 CAGGGGTGTGGGCAGGTGGAGGG + Intronic
1128800039 15:70491572-70491594 CTGAGCTCTGCCCAGGCAGATGG - Intergenic
1128801363 15:70499159-70499181 CTGAGCCCAGTGCAGGTGTATGG - Intergenic
1129207473 15:74045518-74045540 TTGGCCTCTGGGCAGGTGGAGGG - Exonic
1129880846 15:79005190-79005212 CTGAGGTGGGGGCAGGAGGAGGG + Intronic
1130099144 15:80878899-80878921 CTAAGCTCTGGGGCAGTGGAGGG - Intronic
1130960765 15:88657355-88657377 CTGACCTCTGGGAAGCTGGAGGG + Intergenic
1131441278 15:92461453-92461475 CTGAGCTCTGGGGTCCTGGAAGG - Intronic
1132200679 15:99952632-99952654 ATGGGCTGGGGGCAGGTGGAGGG + Intergenic
1132639268 16:970426-970448 AGGAGAGCTGGGCAGGTGGAGGG - Intronic
1132744339 16:1430480-1430502 CTGAGCTCTGGGCAGGTGGGCGG + Intergenic
1132860814 16:2070898-2070920 CAGAGGGCTGGGCAGGTGGGCGG + Intronic
1134198086 16:12174480-12174502 TTGAGCTCTGGGCAGATGGGAGG + Intronic
1134237738 16:12480766-12480788 CTGAGCTCTGAGGAGTGGGAGGG + Intronic
1135340593 16:21643975-21643997 GTGAGGTGTGGGCAGGTGGAGGG - Intronic
1135912089 16:26570673-26570695 CTGCAGTCTGGGCAGGTGGGAGG + Intergenic
1136556093 16:31008646-31008668 CTGACCTCCTGGCAAGTGGACGG - Intronic
1136631715 16:31492882-31492904 CCGAGCTCTGGGCAGTTTGGAGG - Intronic
1136654493 16:31701829-31701851 CTGATCTCTGGGAAGGAGGATGG + Intergenic
1137794467 16:51203655-51203677 CTGAGCTCTGTCCATGTGAAAGG - Intergenic
1138457916 16:57131932-57131954 CAGGGCTCTGGGCAGGAAGAAGG - Intronic
1139661255 16:68422395-68422417 CTGTGATCTGGGCAGGTGCTTGG + Intronic
1139750769 16:69107638-69107660 CTGCGCTCTGGGTAGGGGAAGGG - Exonic
1139908224 16:70381027-70381049 CCGAACTCCGGACAGGTGGAGGG - Exonic
1140266099 16:73422564-73422586 CTGACCTCTGGGAAGTTGGAAGG - Intergenic
1140770052 16:78195167-78195189 CTGAGATCTGAACAAGTGGAAGG - Intronic
1141697333 16:85626259-85626281 CTGAGCTTGGAGCACGTGGAGGG + Intronic
1141889980 16:86919935-86919957 GTGAGCTGTGGGCTGATGGATGG + Intergenic
1141951981 16:87345244-87345266 TTGAGCTCTGGGCAGGCAGCTGG - Intronic
1141952263 16:87346665-87346687 TTGAGCTCTGGGCAGGTGGCTGG - Intronic
1142276358 16:89120922-89120944 CTCTGCTCTTGGCAGGTGGGCGG + Intronic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142401747 16:89862474-89862496 GTGAGCCCAGGGCAGATGGAAGG - Intronic
1142864499 17:2782416-2782438 CTGAGGGCGGGTCAGGTGGAGGG - Intronic
1142940367 17:3375897-3375919 CTGGGCTCTGGGCTGGTGCTGGG + Intergenic
1143100853 17:4503928-4503950 CTGAGCTGGGTGCAGGAGGAGGG + Intronic
1143481004 17:7227375-7227397 CTGGGTCCTGGGCAGGTGGCTGG - Intronic
1143519713 17:7438344-7438366 CAGAGCACTGGGCCGGTGGCTGG - Intronic
1143731255 17:8884277-8884299 GAGAGCTGTGGGGAGGTGGAGGG - Intronic
1143767341 17:9146358-9146380 ATGAGCTCAGGGCAGGAGGTGGG - Intronic
1144278292 17:13698815-13698837 CTGTGCTCTGGGCTGGTGCTGGG + Intergenic
1144586034 17:16488349-16488371 CTGAACCCTGGCCAGGTAGATGG + Intronic
1145246961 17:21275736-21275758 GTCAGCTCAGGGCAGGCGGATGG - Intergenic
1145840841 17:27993051-27993073 CTGTGATCTGGGTGGGTGGAAGG - Intergenic
1145897996 17:28471800-28471822 CTTTGCCCTGGGCAGGTGGCAGG + Intronic
1146424409 17:32722942-32722964 CTGACCTCTGGGCAGGTTAGGGG + Intronic
1147169092 17:38607652-38607674 CTGAGTTGGGGGCAGGTGAAGGG - Intergenic
1147583245 17:41638498-41638520 CAGGGCCCTGGGAAGGTGGAGGG - Intergenic
1147608907 17:41789974-41789996 CTGAGCCCTGGGCAAGAGGAAGG - Intergenic
1148074425 17:44927330-44927352 CGCAGAGCTGGGCAGGTGGAAGG - Intronic
1148323342 17:46770401-46770423 CTGGACTTTGGGAAGGTGGAGGG - Intronic
1148467708 17:47874908-47874930 CACAGGTTTGGGCAGGTGGAGGG - Intergenic
1148927935 17:51104081-51104103 CTGATTTCTGGCCAGGTAGATGG + Intronic
1149983837 17:61332365-61332387 CTGACCTCTCGGATGGTGGAGGG - Intronic
1150135290 17:62692094-62692116 CTCAGCTGTGGGCAAGAGGAGGG - Exonic
1150655773 17:67038498-67038520 GTTAGGTCTGGGCAGGTGAAGGG - Intergenic
1151489992 17:74427184-74427206 CTGAGCCCTGGGCAGGGAGGGGG + Intronic
1151520829 17:74628185-74628207 CTGAGCTCTGTGCAGTTCCACGG - Intergenic
1151568769 17:74915670-74915692 CTGGGCTCTGGGCCTCTGGAGGG - Intergenic
1151620299 17:75240914-75240936 CTGAGGCCTGGGGTGGTGGAGGG + Exonic
1151873427 17:76851842-76851864 CTGAGATCTGGGATGATGGATGG + Intergenic
1152234530 17:79131817-79131839 TTGGGCTCTGGCCAGGTGGCCGG - Intronic
1152732385 17:81978635-81978657 CCCAGGCCTGGGCAGGTGGAGGG + Intronic
1152742489 17:82024421-82024443 CTGGGGTCTGGGCAGGTGGCTGG + Intronic
1153446197 18:5175328-5175350 CTGAGTTGTAGGTAGGTGGAAGG + Intronic
1155185334 18:23382732-23382754 CTGATCTCTGTGCAGTTGGAGGG - Intronic
1156545018 18:37955807-37955829 CTGAGCTGTGAGTAGGTAGAGGG - Intergenic
1156756723 18:40536732-40536754 CTGAGCCATGGCCAGGAGGAAGG - Intergenic
1157072343 18:44422675-44422697 CAGAGCTCTGGGAATGTGGGAGG - Intergenic
1157321696 18:46639611-46639633 CTGACCTCTGGGCATGTCCATGG + Intronic
1157489211 18:48110697-48110719 CTCAGGTCTGGGCAGAAGGAAGG - Intronic
1157556300 18:48615271-48615293 CTGAGAGCTGTGGAGGTGGACGG + Intronic
1158302351 18:56066067-56066089 CTTAGCATTGGGGAGGTGGAGGG + Intergenic
1160521668 18:79511583-79511605 CTGAGCTGTGGAGGGGTGGAGGG + Intronic
1160555045 18:79719309-79719331 CTGGGATGTGGGCAGGTGCAGGG + Intronic
1160701256 19:508498-508520 CTGAGCCCAGGGAAGGTGGTTGG + Intronic
1161497110 19:4592718-4592740 CTGGGCTCTGGGAAGCTGGCAGG - Intergenic
1161622366 19:5304977-5304999 CTGAGCTCTGGGGGGGTAGTGGG - Intronic
1161723073 19:5914377-5914399 CTGGGCTCTGGGCAGCTGGAAGG - Exonic
1161920222 19:7260431-7260453 CTCAGCTCTGGGCATTTTGAGGG - Intronic
1163761082 19:19137224-19137246 CTGAGCTGTGGGGAGGTGGAGGG - Intronic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1165434165 19:35787567-35787589 CCCAGCTCAGGGCAGGTGGCGGG + Exonic
1166416604 19:42599855-42599877 CTGAGCACTGGGCAGGGGTTTGG + Intronic
1166683719 19:44782539-44782561 CTGGGCTCTGGGCTGGTGCGTGG + Intronic
1166827157 19:45616691-45616713 CAGAGCTCTTGGCAGGGGGAGGG - Intronic
1166853123 19:45769711-45769733 CAGAGCTTTGGGCAGATGGAGGG + Exonic
1167335847 19:48885336-48885358 CTGGTCCCTGAGCAGGTGGAAGG + Intronic
1167399405 19:49255071-49255093 TTGTCCTCAGGGCAGGTGGAAGG + Intergenic
1167590887 19:50403598-50403620 GTGAGGGCTGGGCAGGTGGGAGG + Intronic
1167853104 19:52216680-52216702 CTCAGCTCTGGGTTTGTGGAGGG + Intronic
1168098583 19:54128968-54128990 CTGGGCTTCGGGCTGGTGGAGGG + Intronic
1168327960 19:55547552-55547574 CTGGCCTCTGGGGAGCTGGAAGG + Intergenic
1168385202 19:55957222-55957244 CTGAGCTCTTGGAATGTGGCTGG + Intronic
1168405544 19:56108418-56108440 GAGAGCTCTGGGCAGGGGCAGGG - Intronic
925254682 2:2473110-2473132 CTGATCCCTGGGCAAGTTGAAGG + Intergenic
925292160 2:2755255-2755277 CTGAGGTCAGAGCAGGTGGGTGG - Intergenic
925296348 2:2780024-2780046 GTGAACTCTGGGAAGGTGCAGGG - Intergenic
925296382 2:2780169-2780191 ATGAACTCTGGGAAGGTGCAGGG - Intergenic
925296502 2:2780712-2780734 GTGATCTCTGGGCAGTTGCAGGG - Intergenic
925296530 2:2780904-2780926 GTGAACTCTGGGAAGGTGCAGGG - Intergenic
925735262 2:6958228-6958250 CTCTGCTCTGGGCTGGTGAAGGG + Intronic
925745042 2:7036754-7036776 CTGAGATCTGGTAAGGTGAATGG - Intronic
925884485 2:8382725-8382747 CTGAGGTCTGGGCAGATTGAAGG + Intergenic
925886008 2:8394260-8394282 CTGAGCTCTTGGCCTGTAGAGGG - Intergenic
926270953 2:11365588-11365610 CTGATCTTTGGACAGGAGGATGG - Intergenic
926359035 2:12067778-12067800 CTGATCTCTGAGCAGAGGGAAGG + Intergenic
928087652 2:28355918-28355940 CTGGGCTCTGGACAGCAGGATGG + Intergenic
928324048 2:30306001-30306023 CCCAGCTCTGGACAGCTGGATGG - Intronic
928916932 2:36482073-36482095 CTGAGCTCTGTTGAGGTGGAGGG - Intronic
929594385 2:43167195-43167217 CTCAGCTCTTTGTAGGTGGATGG + Intergenic
929791047 2:45023446-45023468 GTGAGCTCAGGGCTGGTGGAGGG - Intergenic
930012479 2:46948048-46948070 CTCTGGTCCGGGCAGGTGGATGG + Intronic
930025147 2:47025144-47025166 CTGAGCTCCAGGCCGGCGGAGGG + Intronic
931535881 2:63276071-63276093 CTGGGCTCTGGGCTGGTAGTGGG - Intronic
931984045 2:67724418-67724440 CTGCGCTTTGGGCAGGTGGCTGG - Intergenic
932579913 2:72986384-72986406 CAGAGCTCTGGGCTGTAGGAAGG + Intronic
932705875 2:74024569-74024591 ATGAGCTGAGGGCTGGTGGAAGG + Intronic
933632674 2:84674792-84674814 CTGAGCGCTGGCCTGGTGGGAGG - Intronic
933649002 2:84833947-84833969 CTGGGTTCTGGGCTGGTGGGAGG - Intronic
934945085 2:98534958-98534980 CTTAGCCAAGGGCAGGTGGAGGG + Intronic
935011535 2:99141117-99141139 ATGAGCTCTGGGCAGGACGGCGG - Intronic
935717629 2:105952975-105952997 AGGAGCTCTGGGCAGGAGAAGGG - Intergenic
936006708 2:108895421-108895443 CTGAGCTCTTGGCAGTTACAGGG + Exonic
936040960 2:109149103-109149125 CTGGGCTCTGGGAAGGAGCAGGG + Intronic
936149776 2:110009318-110009340 CTGCACTCAGGGCAGGTGTAAGG - Intergenic
936245972 2:110827585-110827607 CTGAGTTCTTGGCTGGAGGAAGG + Intronic
936555980 2:113499255-113499277 CTCAGCTCTTGGCAGGTTCATGG - Exonic
937320867 2:120959965-120959987 GTGAGCTCTGTGCAGGCGCAGGG + Intronic
937362450 2:121238445-121238467 CTGAGCGCTCTCCAGGTGGACGG + Intronic
938086773 2:128407077-128407099 CTGGGGCCTGGCCAGGTGGACGG + Intergenic
938222901 2:129587217-129587239 CTAAGATCTGGACAGGTGGTGGG + Intergenic
938255725 2:129858518-129858540 CTGAGCTTGGGAAAGGTGGACGG - Intergenic
938293195 2:130161145-130161167 ATGCACTCTGGGCAGGAGGAAGG + Intronic
938463355 2:131511820-131511842 ATGCACTCTGGGCAGGGGGAAGG - Intergenic
939305308 2:140402666-140402688 CTGAGGTCTTATCAGGTGGAAGG - Intronic
939679658 2:145114836-145114858 GGGTGCTTTGGGCAGGTGGAAGG + Intergenic
942545267 2:177056828-177056850 CTGGGCTGTGGGCAGCTGGCAGG - Intergenic
944098264 2:195994317-195994339 CTGAGCCTTGGGGAGGAGGAAGG - Intronic
944933560 2:204545283-204545305 CGGAGCTCTGGGGAGTTGTAAGG - Intergenic
945179859 2:207080827-207080849 GTGACGTCTGTGCAGGTGGACGG - Exonic
945815556 2:214601285-214601307 TTAAGCTCTGGGCAGGTACATGG - Intergenic
946326852 2:218989082-218989104 CTGGGTTCTGGGCAAGTGGCAGG - Intergenic
946774950 2:223127699-223127721 TTGAGCTCTTGGAAGGTGGCAGG + Intronic
947452368 2:230220553-230220575 CTGAGAGCTGGGCAGGTAGTTGG + Intronic
947746998 2:232512987-232513009 GGGAGCTCTGGGCAGGGGGCTGG + Intergenic
948172387 2:235915107-235915129 GTGGGCTCTGAGCAGGTGTATGG - Intronic
948198495 2:236112746-236112768 CTGGTCCCTGGGCAGGTTGAAGG + Intronic
948613183 2:239182313-239182335 GTGAGCTCTGAGCAGCGGGAGGG - Intronic
948794594 2:240395740-240395762 CTGAGCACTGGGCAGGCTGCGGG + Intergenic
948884749 2:240877090-240877112 CTCAGCTCTGGACAGGTGAGGGG - Intronic
1168938301 20:1686827-1686849 CTCAGTTCGGGGCAGGAGGAGGG + Intergenic
1169091959 20:2866350-2866372 CTGAGCTGTGGGCTGGTGAGAGG + Intronic
1169878953 20:10326603-10326625 CTGAGCTCTGGGCAAGGTGCTGG + Intergenic
1170441455 20:16383874-16383896 CTGAGCACTGGGCATTCGGATGG + Intronic
1170796055 20:19547708-19547730 CTGGGCTCAGGGCAAGGGGAGGG - Intronic
1170930568 20:20766602-20766624 GTGAGCACTGGGTAGGTGGGTGG + Intergenic
1170940758 20:20846107-20846129 CTGGGCACTGGGCAGGTTGGTGG + Intergenic
1171211002 20:23316848-23316870 CTGGGCTCTGTGCAGGGTGAGGG + Intergenic
1171396674 20:24838894-24838916 CTGAGCCCTGGTGAGGTGGATGG + Intergenic
1171431613 20:25086392-25086414 CAGAGATCTGGGCAGGGAGATGG - Intergenic
1171493892 20:25540727-25540749 CTGAGGTCTGTTCAGCTGGAAGG - Intronic
1172526559 20:35603268-35603290 TTGAGCTCTGGACACCTGGAAGG + Intergenic
1172529402 20:35619472-35619494 TGGAGCTCTGGGCGGGTCGATGG + Intronic
1172575904 20:36008480-36008502 CTCAGCCCTGGGCAGATAGACGG + Intronic
1173170617 20:40720654-40720676 TTGATCTCAGGGCAGGTGGTTGG - Intergenic
1173354055 20:42270366-42270388 CAGAGCCCTGGGCGGGTGGGAGG - Intronic
1173903379 20:46607397-46607419 CTGAGCTTTGACCAGGTGGCAGG - Intronic
1174123587 20:48286498-48286520 CTGAGTCCTGGCAAGGTGGAAGG + Intergenic
1174348888 20:49952588-49952610 TTCAGCTCTGGTCAGGTGCACGG - Exonic
1174861148 20:54092479-54092501 CTGAGCTAGAGGCAGGTGGGTGG - Intergenic
1175311433 20:58014430-58014452 CTGAGGTCAGGGCATGGGGATGG + Intergenic
1175334618 20:58187199-58187221 CTGGGCTCTGGGAGAGTGGAAGG + Intergenic
1175676804 20:60953151-60953173 CAGAGCTCAGGACAGGTGGCAGG + Intergenic
1175779940 20:61675973-61675995 CTGTGCTCTGGGCAGGAGGAGGG - Intronic
1175780926 20:61681641-61681663 CTCAGCTCTGTGCCTGTGGAAGG - Intronic
1175788237 20:61725240-61725262 CTGCGGTGTGTGCAGGTGGACGG - Intronic
1175943627 20:62549026-62549048 CTCTGCACTGGGCAGGTGCAGGG + Intergenic
1176064611 20:63188104-63188126 ATCAGCCCTGGGGAGGTGGAAGG + Intergenic
1176248082 20:64106854-64106876 TTGCGCCCTGGGCAGGTGGGAGG + Exonic
1176249115 20:64111876-64111898 CTTAGCTCAGGGCAGGTGAGAGG + Intergenic
1178272023 21:31199483-31199505 CTAAGGCCTGGGCAGGGGGAGGG - Intronic
1178516553 21:33252808-33252830 CTGATTCCTGGCCAGGTGGAAGG - Exonic
1179064570 21:38012475-38012497 CAGAGCTACGGGCAAGTGGAAGG + Intronic
1179083610 21:38196306-38196328 CTGAGCTGTGGGCAGGGATAAGG - Intronic
1179167487 21:38946042-38946064 CTGAGGACTGGGCTCGTGGACGG - Intergenic
1179627622 21:42657605-42657627 CTCAGCACTGGGGAGCTGGAGGG + Intronic
1179721137 21:43316553-43316575 CTGAGCTCTGTGCAGCTGCTGGG - Intergenic
1179799214 21:43803072-43803094 CGGAGCTCTGGGCAAGGGAAGGG - Intronic
1180081391 21:45489354-45489376 CTCGGCTCTGGGCTGGGGGAGGG + Intronic
1180082158 21:45491870-45491892 CTGAGCCCTGGGCAGATGCAGGG + Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180189464 21:46155546-46155568 CTCCTCTCTGGGCAGATGGAAGG + Exonic
1180582977 22:16859055-16859077 CTGCACTCAGGGCAGGTGTAGGG + Intergenic
1181310911 22:21944254-21944276 CTGAGCTCTAGGCAGCTGTGGGG + Intronic
1182085272 22:27556927-27556949 CTGTGCTGGGGCCAGGTGGAGGG - Intergenic
1183059039 22:35324082-35324104 GTGTGCTCTGGGCAAGTGAATGG - Intronic
1183303579 22:37070387-37070409 CTGAGCTCTTTGCAGATAGAGGG - Intronic
1183467869 22:37988920-37988942 CTATGCACTGGGAAGGTGGAGGG + Intronic
1183781251 22:40000334-40000356 TTGAGGTCTGGGCAGCTGGTGGG + Intronic
1184088796 22:42281852-42281874 CCCAGCTCTGGGCAGGTGCCAGG + Intronic
1184841941 22:47057223-47057245 ATGAGCGCTGGGCAGCTGGCTGG + Intronic
1185050996 22:48553890-48553912 CCAAGAGCTGGGCAGGTGGACGG - Intronic
1185114247 22:48922353-48922375 CTAATGTCTGGGCAGGAGGAGGG + Intergenic
1185336913 22:50274874-50274896 GGGAGCTGTGGGGAGGTGGAGGG - Intergenic
1185393655 22:50576108-50576130 CTCACCTGTGGGGAGGTGGAAGG + Exonic
950121559 3:10485361-10485383 CTGAGCTCTGTGCTGGGCGAGGG + Intronic
950202748 3:11056615-11056637 CTGGGCTCTGGGCTGCTGCAAGG - Intergenic
950658556 3:14452514-14452536 CCGGGCTCTGGGCTGGTGGCTGG - Intronic
952651248 3:35729352-35729374 GTGTGCTCTGGAGAGGTGGATGG - Exonic
952902479 3:38119370-38119392 CAGAGCTCTGGGCATGAGCAAGG - Intronic
953412644 3:42698898-42698920 CGGAGCTGTGGGCAGGGAGAAGG + Exonic
954068947 3:48128952-48128974 CTGATCTCTGGGCAGGTTCTGGG - Intergenic
954108305 3:48420766-48420788 CTGTGCTCTGTGCAGGTGCCAGG - Exonic
954645362 3:52128143-52128165 GTGAGCTCTGGGCAGGCAAAAGG - Intronic
954680747 3:52344681-52344703 GGGGGCTCTGGCCAGGTGGATGG - Intronic
954762560 3:52887270-52887292 GTGAGATCTTGGGAGGTGGAAGG - Intronic
955321627 3:57978707-57978729 CTGAGCTTGTGGCAGGTGCAGGG + Intergenic
955949244 3:64225532-64225554 CTCAGCACTGGGCAGCAGGATGG - Intronic
956364386 3:68484239-68484261 CTGAGCCCTGGAAAGGTGGCTGG - Intronic
958921831 3:100115216-100115238 TTGAGCACTGGGCAGGTGGTAGG - Intronic
959865714 3:111267715-111267737 CAGAGTTCTGGGTAAGTGGAAGG + Intronic
960283435 3:115800713-115800735 CTGACCTCTGGGCAGGGGAGGGG + Intergenic
961361490 3:126370898-126370920 CTGGGCTCTGGGCTGGGGGCTGG - Intergenic
962708570 3:138067531-138067553 CTGAGCCCTGGCCAGGGGGCTGG + Exonic
964043720 3:152296366-152296388 CTTAACTGTGGGCAGGAGGAGGG + Intronic
964418183 3:156472039-156472061 TGGAGCTCTTGGCAGCTGGATGG - Intronic
965060966 3:163785881-163785903 CTGAGCTCTGGGCTGGTACTAGG + Intergenic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
967504659 3:190239821-190239843 CTGAGTTCTGGGCTGGTGCTGGG - Intergenic
967821647 3:193844229-193844251 CTGAGCTCTGGGAGTGGGGAGGG + Intergenic
968129929 3:196187123-196187145 CTGACAGCTGGGCAGGTGGCAGG + Intergenic
968541146 4:1169046-1169068 ATGAGCTCTGAGCAGGAGGCAGG - Intronic
968589499 4:1450333-1450355 CTGAGCTCTGGGAAAGGGGAGGG + Intergenic
968598086 4:1495670-1495692 CTGACCTCGGGGGCGGTGGAGGG - Intergenic
968598652 4:1498580-1498602 ATGAGGGGTGGGCAGGTGGATGG + Intergenic
968628340 4:1637917-1637939 CAGAGCCGTGGACAGGTGGATGG - Intronic
969258716 4:6020718-6020740 CTGAGCTCTGGGGCGGTGGTGGG + Intergenic
969314629 4:6374317-6374339 TTGAGCTCTGGTTTGGTGGATGG - Intronic
969445975 4:7244942-7244964 CTGAGAAGTGGGCAGTTGGAAGG + Intronic
969486284 4:7474142-7474164 CTGAGCGCTGAGCAGGTGCCAGG - Intronic
969513310 4:7631938-7631960 CTGCCTTCTGGGCAGGTGCAAGG + Intronic
969521422 4:7679983-7680005 CTGTCCTCAGGGCAGGTAGAAGG - Intronic
969683036 4:8653641-8653663 CTGGGGTCTGGGCAGGTGGTGGG + Intergenic
971222926 4:24725613-24725635 CTGAGATGGGGGGAGGTGGACGG - Intergenic
972685218 4:41346019-41346041 CTCAGCTCTGGGTATGTGGGGGG - Intergenic
972900186 4:43672713-43672735 CTCAGCTCTTGGGTGGTGGATGG - Intergenic
974107208 4:57483801-57483823 CTGGCCTCTGGGAAGGTAGAAGG + Intergenic
974521532 4:62987186-62987208 CTGTGCTGTGGGCAGTGGGAAGG - Intergenic
978254823 4:106681453-106681475 CTTAGCTCTTGGGCGGTGGATGG + Intergenic
978896902 4:113899732-113899754 TAGAGCCCTGGGCAGGTGGCAGG + Intergenic
979137294 4:117125577-117125599 CTGAGGTCTGGGGGAGTGGATGG - Intergenic
980738151 4:136917625-136917647 CTGTGCTCTTGGCAGGGGGCAGG + Intergenic
984126088 4:175812671-175812693 CTGAGCTGTGAACAGATGGAGGG + Intronic
984713282 4:182903683-182903705 CTGGGCTGTGGGCAGGCGGATGG - Intronic
985472166 5:53258-53280 CTGACCTCTGGGCCGCGGGAGGG + Intergenic
985796486 5:1966070-1966092 CAGAGAGCTGGGCAGGGGGATGG + Intergenic
986634058 5:9802268-9802290 CTGAGCTCTGGGCTGGTACTGGG - Intergenic
990252704 5:53932748-53932770 CTGAGATCTGAGCAAGTGGCTGG + Intronic
994211239 5:97089505-97089527 CTGTGGTCTCTGCAGGTGGAAGG - Intronic
994651485 5:102534593-102534615 CAGAGGTTTGGGCAGGAGGAAGG + Intergenic
994887520 5:105583261-105583283 CTGGGCTCTGGGCTGGTGCTGGG - Intergenic
996219579 5:120913660-120913682 CTGAGCTCTGAGCCCTTGGAAGG - Intergenic
996536238 5:124581000-124581022 CTGAGCTTTGGGGAAGGGGAGGG - Intergenic
996851554 5:127958806-127958828 TTGAACTCTGGGCAGGTGTATGG - Intergenic
997283034 5:132660460-132660482 CTGAGCCCTGGGCAAGGGGAAGG - Exonic
998463597 5:142326071-142326093 CCGAGAACTGGCCAGGTGGATGG + Intronic
998758670 5:145407990-145408012 CTGGGCTCTGGGCTGGTGCTGGG - Intergenic
1000672240 5:164077169-164077191 CTGATCTCTGGGTGGGGGGAGGG + Intergenic
1001582352 5:172807423-172807445 CTGAGATCTGGGCTGGGGGCTGG - Intergenic
1002189633 5:177472007-177472029 AGGAGCTCTGGGCAAGTGGCCGG - Intronic
1002302733 5:178266724-178266746 CTGAGCTGTGAGCAGGAGCAGGG - Intronic
1002330024 5:178434748-178434770 CTGAGGCCTGGGATGGTGGAGGG + Intronic
1003048895 6:2763342-2763364 CTCAGCTCTGGGGTGGTGAACGG + Intergenic
1003084873 6:3053224-3053246 CTCATCTCTGGGCAGGTGCTGGG + Intergenic
1003439977 6:6131487-6131509 CTGGGCTCTGCGAAGATGGAGGG + Intergenic
1003612593 6:7627099-7627121 CTGTGGTCTGGTCAGGAGGAAGG - Intergenic
1003612945 6:7629870-7629892 CTGAGCTGTGGGCAGAGGCAAGG - Intergenic
1004017392 6:11744580-11744602 CTGAGATGGGGCCAGGTGGAAGG + Intronic
1004436550 6:15600701-15600723 CTGAGAACTGAGCAGGTGGTAGG + Intronic
1006113235 6:31761457-31761479 CTGCCCTCTTTGCAGGTGGATGG + Exonic
1006581275 6:35079140-35079162 CCAAGCTCTGGACAGGTAGAAGG - Intronic
1007161292 6:39793346-39793368 CTGAGCTGTGGGGTGGAGGAAGG + Intronic
1007315340 6:40983780-40983802 CTGGGATGGGGGCAGGTGGAAGG - Intergenic
1007348124 6:41248462-41248484 CTGAGCTTAGGGCAGGCAGAGGG + Intergenic
1007637201 6:43306649-43306671 CTCAGCTCTGGGCCTGTAGAAGG - Intronic
1010055366 6:71558159-71558181 CTGGGCTCTGGGCTGGTGCTGGG + Intergenic
1010559723 6:77334078-77334100 CTGAGGTCTGGGCCCCTGGAAGG - Intergenic
1011622674 6:89257492-89257514 CTGGGGTCAGGGCAGCTGGAAGG + Intronic
1012412028 6:98969575-98969597 TTTTGCTCTGGGCAGGTGGTGGG - Intergenic
1017778757 6:157700039-157700061 CTGAGATAAGGGCAGGTGGATGG + Intergenic
1017982290 6:159410908-159410930 TTTACCTCAGGGCAGGTGGATGG + Intergenic
1018349762 6:162943958-162943980 CTGTGGGCTGGGCAGGTGGGTGG - Intronic
1018598344 6:165508933-165508955 CTGAGCTCTCTGTAGGTGCAGGG - Intronic
1018720230 6:166566529-166566551 CAGAGCTCTGCACAGGTGCAGGG + Intronic
1018738358 6:166707225-166707247 CTGCTCTCTGTGCAGATGGACGG + Intronic
1019045035 6:169139417-169139439 CGGAGCACTGGGCATCTGGAGGG - Intergenic
1019363164 7:616338-616360 CGTGACTCTGGGCAGGTGGAGGG - Intronic
1019430459 7:996647-996669 CAGAGCTCTGGGCAGCTGCCGGG - Intergenic
1022031116 7:26492601-26492623 CTGAGCTCGGGGCAGGGGTGAGG - Intergenic
1023634769 7:42198495-42198517 CTGAGCTCCGGGGATGTGGGAGG + Intronic
1023710183 7:42984164-42984186 CTGATCTGTGGGCAGCTGAATGG + Intergenic
1023871235 7:44264076-44264098 CTCAGCACTGGGCAGGTAGAGGG - Intronic
1024013173 7:45287956-45287978 CTGGCCTCTGGGAAGGAGGAGGG - Intergenic
1024290665 7:47801265-47801287 CTAAGCTCTGGCCAGGTGCGGGG - Intronic
1024357437 7:48428471-48428493 CTGAGCTCTAGGGATGTGGAGGG + Intronic
1024759881 7:52582956-52582978 TTGTGCTTTGGGCAGGGGGAGGG + Intergenic
1026523361 7:71134492-71134514 CAGATCTCTGAGCAGGTGAAAGG + Intronic
1026534420 7:71228333-71228355 CTGAGCTGAGTGGAGGTGGACGG - Intronic
1026665225 7:72336031-72336053 CTGAGCTCCAAGCAGCTGGATGG - Intronic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1027267910 7:76504211-76504233 CTGAGCTGTGGAGAAGTGGAGGG - Intronic
1027319721 7:77004073-77004095 CTGAGCTGTGGAGAAGTGGAGGG - Intergenic
1029220888 7:98989382-98989404 CTGAGCTCAGGGCTGCTGGGGGG - Intronic
1029296408 7:99543692-99543714 CCCAGCTCTGGGCAGAGGGAAGG + Intergenic
1029707596 7:102283969-102283991 CTGTGCTCTGGGACGCTGGAGGG + Intergenic
1029871451 7:103697263-103697285 ATGAATTCTGGGGAGGTGGAGGG + Intronic
1031272181 7:119665851-119665873 CTCAGTTCTGGGCTGCTGGATGG - Intergenic
1031324692 7:120379717-120379739 CTGATGTCTGGGCAGGGGCAGGG + Intronic
1031999185 7:128253875-128253897 CAGTGCTGTGGGCAGATGGATGG + Intronic
1032205097 7:129856625-129856647 CTGAGATTTGGACATGTGGAGGG + Intronic
1032321161 7:130887852-130887874 ATGAGCTCAGGGCAGGCTGATGG + Intergenic
1032327509 7:130944785-130944807 CACAGCTCTGGGCAAGTGGCAGG + Intergenic
1032468709 7:132162925-132162947 CTCAGCTCAGAGCAGTTGGAGGG + Intronic
1032785951 7:135199512-135199534 CTAAGATCTGGGGAGGTGGTAGG + Intronic
1033401175 7:141026711-141026733 CTGAGCCCTGGGCTGGTGCTAGG + Intergenic
1033570005 7:142618428-142618450 CTGGGCTCTGTGCAGCAGGACGG + Intergenic
1033666233 7:143443346-143443368 CTGCGCTTGGGGCAGCTGGAGGG + Intergenic
1033786047 7:144731800-144731822 CTGAGCTGTGTCCAGGTCGATGG - Intronic
1034154166 7:148940968-148940990 CTGGGCTCTGGGGAGGGAGAGGG - Intergenic
1034392981 7:150800620-150800642 CTGGGCTCTGGGGAGCTGGGAGG - Exonic
1034462419 7:151205189-151205211 CAGTGATCTGGGCTGGTGGATGG + Intronic
1034636482 7:152571370-152571392 CTGAGCTATGGGCAGTAGAAGGG + Intergenic
1034844271 7:154430024-154430046 CTGAGAACTGGGAGGGTGGATGG - Intronic
1035075850 7:156176821-156176843 CAGAGCTGTGGCCAGGAGGAGGG + Intergenic
1035282495 7:157786849-157786871 CTGAGCTCTGGGCACTGGGCAGG - Intronic
1035398553 7:158550469-158550491 CTGAGGTCTGGGCAGGGAGAGGG + Intronic
1035640897 8:1184509-1184531 CTGTTCTCAGGGCAGTTGGAGGG + Intergenic
1035766189 8:2107510-2107532 CTGTGGGCTGGGCAGGAGGATGG + Intronic
1039485053 8:37903813-37903835 ACGTGCTCTGGGCTGGTGGAGGG - Intergenic
1039925738 8:41930383-41930405 CTCAGCTCTGAGCATGTGCAAGG - Exonic
1041178166 8:55219401-55219423 CTGAGCTCTGCACAGGAGCATGG + Intronic
1041662386 8:60412887-60412909 CCCAGCACTGGGCAGGAGGAGGG - Intergenic
1041798794 8:61775368-61775390 GTCAGTTATGGGCAGGTGGAAGG - Intergenic
1042768362 8:72352287-72352309 CTGAGCTCTGGGCTGGTACTGGG + Intergenic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1045114966 8:98972512-98972534 CGGGGCTCTGGGCACGTGGCCGG + Intergenic
1045288225 8:100810151-100810173 CTGGGCTCTGGGCAGGAGGCAGG - Intergenic
1046710221 8:117502974-117502996 CATGGCTCTGGGCAGATGGAAGG + Intergenic
1046826386 8:118696176-118696198 CTGAGGTCTTTGCAGGGGGAAGG + Intergenic
1047950787 8:129932980-129933002 CTATCCTCTGGGCTGGTGGAAGG + Intronic
1048802378 8:138206301-138206323 TAGAGCTGTGGGTAGGTGGAGGG - Intronic
1048802487 8:138206861-138206883 TAGAGCTGTGGGTAGGTGGAGGG - Intronic
1049172346 8:141169367-141169389 CTGCGCTCTGTGTGGGTGGAAGG + Intronic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049494822 8:142924746-142924768 CTCAGCCCGGGGCAGGCGGATGG - Intergenic
1049628287 8:143636438-143636460 CTGGGCTCAGGGCGGGGGGAAGG - Intronic
1052326135 9:27218287-27218309 CTGATGTCTGGGCATGAGGAGGG + Intronic
1052801296 9:32970576-32970598 CTGATCTCTGGGCATGAAGAGGG + Intergenic
1052844396 9:33322334-33322356 CTGAGCTGAGGGGAGGAGGAAGG - Intronic
1053222070 9:36320545-36320567 CTAAGCACTGGGCAGTGGGAGGG + Intergenic
1053377754 9:37622193-37622215 CTGAGCTCTGGGCACATGGGTGG + Intronic
1053416728 9:37951629-37951651 CTGAGCTCAGGGAGGGTGGATGG - Intronic
1053740148 9:41128363-41128385 CTCAGCTCTTGGCAGGTTCATGG + Exonic
1054443112 9:65284357-65284379 CTCAGCTCTTGGCAGGTTCATGG + Exonic
1054487169 9:65737144-65737166 CTCAGCTCTTGGCAGGTTCATGG - Exonic
1054688202 9:68302950-68302972 CTCAGCTCTTGGCAGGTTCATGG - Exonic
1056382590 9:86068524-86068546 CTGAGACCTGGGCAGGGGCAGGG - Intronic
1056419427 9:86409384-86409406 CTCAGCTTTGTGGAGGTGGAAGG + Intergenic
1057301920 9:93891477-93891499 CTGGGGTGAGGGCAGGTGGATGG + Intergenic
1057501867 9:95602551-95602573 CTGAGCTCTCAGCAGCGGGAAGG + Intergenic
1057506450 9:95637485-95637507 CTGAGCACTGGGAATGTGGCTGG + Intergenic
1057953217 9:99386344-99386366 CTGGGTTCTGGGCAGGGAGAGGG - Intergenic
1058005326 9:99907372-99907394 GGGAGCTCTGGGCCGATGGAAGG + Intronic
1060106274 9:120875584-120875606 CTGAGACCAGGGCAGGAGGATGG - Intronic
1060281550 9:122218966-122218988 CCCAACTCTGGGAAGGTGGAAGG - Intronic
1060311119 9:122463725-122463747 CTGGGCTCTGGGCTGGTATAGGG + Intergenic
1061010604 9:127952274-127952296 CTGAGCTCTGGTCAGTGGGAAGG + Intronic
1061670040 9:132183482-132183504 CTGGACTCAGGACAGGTGGAGGG - Intronic
1062189301 9:135239514-135239536 CTGAGCTCTGGGGACATGGCAGG - Intergenic
1062249447 9:135587004-135587026 CTGGGATCTGGGCAGATGCATGG - Intergenic
1062264238 9:135679599-135679621 CTGACCTGTGGGGAGGGGGAGGG - Intergenic
1062264333 9:135679855-135679877 CTGACCTGTGGGGAGGGGGAGGG - Intergenic
1062264354 9:135679914-135679936 CTGACCTGTGGGGAGGGGGAGGG - Intergenic
1062264375 9:135679973-135679995 CTGACCTGTGGGGAGGGGGAGGG - Intergenic
1062489657 9:136799084-136799106 CTGCTCTGTGGGCAGGTGGAGGG - Exonic
1062577959 9:137217321-137217343 CTGCGTTCTGGGCAGGTGCTGGG + Intergenic
1062676176 9:137745827-137745849 CTCAGGTCTCTGCAGGTGGAAGG - Intronic
1187802131 X:23075659-23075681 CTGAGCGCTGGGAAGCCGGAAGG + Intergenic
1189071593 X:37869471-37869493 GTGATCTCTGAGCAGGTAGAAGG + Intronic
1190024635 X:46912473-46912495 CTCAGCGCTGGGCAGGCGGTTGG - Exonic
1190137230 X:47807963-47807985 CTGACCTCAGGGCATGGGGAGGG + Intergenic
1190532265 X:51391308-51391330 TTAAGCTCTTGGCAGATGGATGG - Intergenic
1191888864 X:65920170-65920192 CTGTGCTCTGGGCTGGTACAGGG + Intergenic
1192221927 X:69203295-69203317 CTGGGCTCTGGCCTGGAGGAAGG + Intergenic
1196105993 X:111896064-111896086 CTGAGTTCTGGGCTGGTGTCTGG - Intronic
1197692960 X:129522881-129522903 CCGAGTTCCGGGAAGGTGGAGGG + Intronic
1198254617 X:134914530-134914552 CAGAGGTCTGGGGAGGGGGAAGG + Intronic
1198423512 X:136492424-136492446 CTAAGCTGTGTGCAGGTGTATGG + Exonic
1200090912 X:153635538-153635560 CTGGGCTCTGGGGAGGCGGGTGG + Intergenic
1200102367 X:153694458-153694480 CTGAGGGCTGGGCTGGGGGATGG + Intronic
1200162290 X:154015788-154015810 CTGGGCTGGGGGCAGGGGGAAGG - Intronic
1200252257 X:154559876-154559898 CAGAGCTCTGGGCAGCAGCAGGG + Intronic
1200265511 X:154644540-154644562 CAGAGCTCTGGGCAGCAGCAGGG - Intergenic