ID: 1083721596

View in Genome Browser
Species Human (GRCh38)
Location 11:64606355-64606377
Sequence CCGCGCCCAGCGGGTGCCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083721587_1083721596 0 Left 1083721587 11:64606332-64606354 CCTTGCTCCCTCTTCCCTGCTGC 0: 1
1: 1
2: 11
3: 154
4: 1224
Right 1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1083721588_1083721596 -7 Left 1083721588 11:64606339-64606361 CCCTCTTCCCTGCTGCCCGCGCC 0: 1
1: 0
2: 5
3: 42
4: 494
Right 1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1083721584_1083721596 22 Left 1083721584 11:64606310-64606332 CCCCAGCAGTCTGTGGACAATGC 0: 1
1: 0
2: 1
3: 8
4: 178
Right 1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1083721586_1083721596 20 Left 1083721586 11:64606312-64606334 CCAGCAGTCTGTGGACAATGCCT 0: 1
1: 0
2: 1
3: 21
4: 185
Right 1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1083721589_1083721596 -8 Left 1083721589 11:64606340-64606362 CCTCTTCCCTGCTGCCCGCGCCC 0: 1
1: 0
2: 8
3: 77
4: 663
Right 1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1083721585_1083721596 21 Left 1083721585 11:64606311-64606333 CCCAGCAGTCTGTGGACAATGCC 0: 1
1: 0
2: 1
3: 9
4: 148
Right 1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG 0: 1
1: 0
2: 0
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083721596 Original CRISPR CCGCGCCCAGCGGGTGCCAC AGG Exonic
900408793 1:2503757-2503779 CCGCGCCCGGGGGATGCCTCGGG + Intronic
901271288 1:7953982-7954004 CTGGGCCCAGCAGGTGCCAAGGG + Intergenic
901628908 1:10638832-10638854 CCGCGCCCCGCCGGTGCTTCCGG - Exonic
904586535 1:31584007-31584029 CCTCTCCCAGAGGGTCCCACTGG - Intronic
907884033 1:58576976-58576998 CCGAGCCCAGCGCGCGGCACTGG + Exonic
912499522 1:110112801-110112823 CCAGTCCCAGCTGGTGCCACAGG - Exonic
915191661 1:154155937-154155959 CCGCACCCAGCTGGAGCAACAGG - Intronic
915345427 1:155194745-155194767 CCCCGCCCAGCGCCTGCCCCAGG - Intergenic
922792737 1:228319050-228319072 CCGCTCGCAGCGCCTGCCACAGG + Exonic
924874657 1:248089284-248089306 CCTTGCCCAGAGGGTGGCACAGG - Intronic
1066080968 10:31929453-31929475 GCGAGCCCTGCGGGGGCCACAGG + Intergenic
1067053423 10:43038139-43038161 CCGAGCCCAGCCCGAGCCACAGG + Intergenic
1072611654 10:97021143-97021165 CCCCGCCCAGCGGTCACCACAGG + Intronic
1073365205 10:102934569-102934591 CCGCGCCCAGCCTGAGCCACCGG + Intronic
1074121675 10:110498066-110498088 GCGCGCCCCGCGGGTGCCCACGG - Exonic
1074586013 10:114768257-114768279 CCGCGCCCGGCGGGTCCCTGCGG - Intergenic
1076413338 10:130267113-130267135 CAGTGCCCAGCGGGAGCCTCAGG - Intergenic
1076879932 10:133235324-133235346 CCGGGCCCAGCGCGTGCTGCCGG - Intergenic
1077091102 11:778627-778649 CCGCGCCCGGCGGAGGCCAGTGG - Intronic
1077327163 11:1968896-1968918 CCGAGCCCAGCGGGTGGGGCAGG - Intronic
1083472890 11:62896088-62896110 CCGCGCCCAGCTGGAGCACCTGG + Intergenic
1083614147 11:64018209-64018231 CCACGCACAGTGGGTGCCCCGGG + Intronic
1083677625 11:64335370-64335392 GCGCGCCCAGCAGCTCCCACGGG - Intergenic
1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG + Exonic
1083853956 11:65382999-65383021 CTGTGCACAGCGGGTGGCACAGG + Intronic
1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG + Intergenic
1089442791 11:118530900-118530922 CGGCGCTCAGCGGCTGTCACGGG - Exonic
1202810145 11_KI270721v1_random:24076-24098 CCGAGCCCAGCGGGTGGGGCAGG - Intergenic
1091407743 12:219910-219932 GGGTGCCCAGAGGGTGCCACAGG - Intergenic
1092131183 12:6114364-6114386 CAGAGCTGAGCGGGTGCCACAGG + Intronic
1096297023 12:50392567-50392589 CCGCGCCCAGCCGGTTTCACAGG + Intronic
1105819143 13:24063979-24064001 CCGCCTCCAGTGGGTGCCTCTGG + Intronic
1118621429 14:67618007-67618029 CCGCGCCCAGCGGAAGCAAGAGG + Intergenic
1128944226 15:71810531-71810553 CTGCGTCCAGCGGCTGCCCCGGG + Intronic
1132994744 16:2817196-2817218 CCGCCCCCAGGGGGCGCCCCGGG + Intronic
1136365146 16:29806320-29806342 GCGCGCCCAGCCGGCGCCTCGGG - Intronic
1136481893 16:30547257-30547279 CCGGGCCCAGTGTGTGGCACTGG + Intronic
1136590925 16:31217158-31217180 CCCCTCCCAGCAGGAGCCACAGG - Exonic
1137703517 16:50517665-50517687 CAGCACCCAGCTGGTGCCAGTGG - Intergenic
1140479325 16:75253881-75253903 CTGCGCCCAGCCAGTGCCAGGGG + Intronic
1141811439 16:86378852-86378874 CCGCCCCCAGAGGGTGGGACGGG - Intergenic
1141982032 16:87556769-87556791 CCTCGCGCAGCCTGTGCCACCGG - Intergenic
1142173273 16:88633886-88633908 CCCCTCCCAGGGGGTGCCCCAGG + Intergenic
1142429600 16:90019150-90019172 CCGCGCCCGGGAGGTGCCCCTGG + Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1147134824 17:38428645-38428667 CCGCGCCCACCGTGCGCCCCAGG - Intronic
1149759987 17:59220490-59220512 TCGCCCCCAGCCGGTGCCACTGG - Exonic
1154133012 18:11752023-11752045 CCCCGCCCAGCGGGTCCCCGAGG - Intronic
1157584170 18:48790753-48790775 CCCCGCCCGGCTGGAGCCACGGG + Intronic
1158653558 18:59308624-59308646 CCGCCTCCCGCGGGTGCCAGTGG + Intronic
1158937267 18:62376110-62376132 CCTGGCCCAGAGGGTTCCACAGG + Intronic
1159005348 18:63005519-63005541 CCGGGCCCAGCAGGTGCTTCTGG + Intergenic
1160923925 19:1533949-1533971 CCGGGTCCAGCAGGTGGCACAGG - Exonic
1160947981 19:1652290-1652312 CCGCGCCCAGCAGGTGAGCCCGG - Exonic
1162903474 19:13809159-13809181 CCGCGCCCTGCTGCCGCCACAGG - Exonic
1163366426 19:16878378-16878400 CCGGGCCAAGCAGGTGCCAGGGG + Exonic
1163473611 19:17512172-17512194 CCGCGCCCACCGGTTGCCCTCGG + Intronic
1163593697 19:18208518-18208540 CCGCCACCAGGGGGTGCCGCTGG + Exonic
1165130572 19:33629426-33629448 CCCCTCCCAGAGGGTGCAACAGG - Intronic
1166802700 19:45468208-45468230 ACGCGTCCGGCGGGTCCCACGGG - Exonic
925813381 2:7723597-7723619 CCGCTCCCAGCAGGTGCAGCAGG - Intergenic
927215695 2:20666951-20666973 CCTCGCCAAGCGACTGCCACTGG - Exonic
927490191 2:23516239-23516261 CCGGGCCCAGCAGGTGCCCATGG - Intronic
928964980 2:36966809-36966831 CCGCGCCCAGCCGGCCCCAGAGG - Intergenic
929218224 2:39437501-39437523 CCGCGCCCGGCCGCTGCCGCCGG + Intergenic
929429073 2:41871442-41871464 CCTCCCCCAGCTGGAGCCACAGG - Intergenic
935413497 2:102789848-102789870 CTGCTCCCTGCGGCTGCCACCGG - Intronic
944451814 2:199851166-199851188 CCGCGCGCAGCGTCTGCCGCCGG + Intronic
947586447 2:231359787-231359809 CAGAACCCAGCGGGTGGCACTGG - Intronic
947592253 2:231392613-231392635 CGGAGCCCAGCAGGGGCCACGGG - Intergenic
947863989 2:233383329-233383351 CCGCGCCCAGCCCGTTCCATGGG + Intronic
948461278 2:238131071-238131093 CCCCGCCCAGCGAGGGCCCCCGG + Exonic
949079820 2:242088250-242088272 CCGCGCCGCGCGGGTCCCACAGG - Intergenic
1172098695 20:32473228-32473250 CAGAGCCCAGCTGGGGCCACAGG - Intronic
1173690881 20:44960213-44960235 CCGCGCGCTGCGGGTGCTGCAGG - Exonic
1176042373 20:63072333-63072355 CCGCGCCCCGCTGCTGCCCCCGG - Intergenic
1179192450 21:39135164-39135186 CCAGGCCCAGGGGGTGGCACCGG + Intergenic
1180157234 21:45983584-45983606 CCGTGCCCAGCAGGAGCCATTGG + Intronic
1180160571 21:45997186-45997208 GGGCGCCCAGCTGGTGCCTCAGG - Intronic
1181083660 22:20429474-20429496 CCGCACCCTCTGGGTGCCACCGG - Intronic
1183411817 22:37659319-37659341 CGTCGCTCAGCGGGTGCCATGGG - Exonic
1183935132 22:41257684-41257706 CAGCCCCCAGCGGCTGCCGCTGG - Intronic
1185055541 22:48576765-48576787 CCGCGCCCATCGGGGCTCACCGG + Intronic
1185394075 22:50578038-50578060 CCGCGACTAGCGGCTGCCCCCGG + Intronic
949928030 3:9057548-9057570 CCCCTCCCAGCAGGTGCCACGGG + Intronic
953226704 3:41028104-41028126 CAACGTCCAGCAGGTGCCACAGG + Intergenic
955449315 3:59050067-59050089 CCGCGCCCATTGGTTCCCACTGG + Exonic
960048319 3:113218158-113218180 CCACGGCCAGCCGGTTCCACAGG - Intronic
960939067 3:122921943-122921965 CGGCGTCCTGCGGGTCCCACTGG - Exonic
961305670 3:125958206-125958228 CCGCGCCCAGCGTGCCCCGCCGG + Intergenic
961589995 3:127971709-127971731 CTGCCCACAGCGGGTCCCACTGG - Intronic
968434608 4:577866-577888 CCGGGCCCACCGGGCACCACGGG - Intergenic
968583638 4:1406108-1406130 GCGCACGCAGCGGGAGCCACTGG + Exonic
968664850 4:1815387-1815409 CCGCCCCCAGCTGGTGGCACTGG - Intronic
968915043 4:3493644-3493666 GCGCGCCCTGTGGCTGCCACCGG + Exonic
969611133 4:8228355-8228377 CCGCGCCCTGCGGGTGGCTCGGG + Exonic
969778926 4:9381128-9381150 CCGGGCCCAGCGGGGGCACCCGG + Intergenic
986316484 5:6592084-6592106 CAGGCCCCAGCGGGTCCCACGGG - Intergenic
990699468 5:58459984-58460006 CCGCGCCTAGGGGGTGGCAGCGG - Exonic
992105565 5:73447354-73447376 CGGCGCCGAGCGGGTGCGGCCGG + Exonic
995678895 5:114695552-114695574 GAGCGGCCAGCCGGTGCCACTGG + Intergenic
997827079 5:137116091-137116113 CCCAGCCCAGCTGGTGCCAAGGG + Intronic
1002401703 5:178994788-178994810 CCGCGCCCCGCGCGTGCACCGGG + Exonic
1003632260 6:7798313-7798335 TCGAGCCCAGCGGGGACCACAGG + Intronic
1011610546 6:89146405-89146427 CCGCGCCGAGTGGGAGCCGCCGG + Exonic
1016328180 6:142926828-142926850 CCGCGCCCGGCGGCCGCCGCAGG - Intronic
1018906194 6:168077595-168077617 CCAGGCCCAGCAGGGGCCACAGG + Intronic
1019999952 7:4749957-4749979 CCGGGCCTAGAAGGTGCCACTGG - Intronic
1020107125 7:5427353-5427375 CCGCGGCCAGCCTGGGCCACCGG + Intergenic
1025988291 7:66474672-66474694 CCGCTCAGAGCGGGTGCCTCCGG - Intergenic
1033673893 7:143519149-143519171 CCGCGACTGGAGGGTGCCACAGG + Intergenic
1035537872 8:406535-406557 CCGCGCCGCGCGGGTCCCACAGG - Intronic
1035687745 8:1538066-1538088 CCGAGCCCTGCAGGTGCCCCAGG - Intronic
1036344972 8:7955257-7955279 CCGGGCCCAGCGGGGGCATCCGG - Intergenic
1036695535 8:10972149-10972171 CCGGGCCCAGCTGGGGCCTCGGG + Intronic
1036840309 8:12116024-12116046 CCGGGCCCAGCGGGGGCATCTGG - Intergenic
1040521404 8:48179193-48179215 CAGAGCCCAGGGGGAGCCACAGG - Intergenic
1057730675 9:97605507-97605529 CCGCTCACAGCGGATGCCCCCGG + Exonic
1060246445 9:121950549-121950571 CTGAGGCCAGCAGGTGCCACAGG + Intronic
1061478147 9:130882970-130882992 CAGCCCCCAGCTTGTGCCACGGG - Intronic
1062360504 9:136185834-136185856 CCGCTGCCCGAGGGTGCCACAGG + Intergenic
1062722547 9:138051929-138051951 CCTTGCCCTGCAGGTGCCACAGG - Intronic
1186638114 X:11427678-11427700 TCGCGCCCAGGGGCTGCCCCAGG - Intronic
1189664929 X:43343796-43343818 CCACGCCCAGCTGGGTCCACTGG + Intergenic
1200303957 X:155006554-155006576 CCGCGCCCAACAGGAACCACAGG + Intronic
1200317429 X:155148352-155148374 CCGCGCCCAACAGGAACCACAGG - Intergenic
1201159257 Y:11155806-11155828 CCGCGCCCAGCGCGAGCGCCTGG - Intergenic