ID: 1083730671

View in Genome Browser
Species Human (GRCh38)
Location 11:64650819-64650841
Sequence CGGGGAGAATGTAAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2798
Summary {0: 1, 1: 0, 2: 1, 3: 91, 4: 2705}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083730663_1083730671 13 Left 1083730663 11:64650783-64650805 CCAATGGCAAGAGGGCTATGGTG 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1083730671 11:64650819-64650841 CGGGGAGAATGTAAGGAAGGAGG 0: 1
1: 0
2: 1
3: 91
4: 2705
1083730661_1083730671 19 Left 1083730661 11:64650777-64650799 CCAAAACCAATGGCAAGAGGGCT 0: 1
1: 0
2: 0
3: 19
4: 275
Right 1083730671 11:64650819-64650841 CGGGGAGAATGTAAGGAAGGAGG 0: 1
1: 0
2: 1
3: 91
4: 2705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083730671 Original CRISPR CGGGGAGAATGTAAGGAAGG AGG Intronic
Too many off-targets to display for this crispr