ID: 1083731029

View in Genome Browser
Species Human (GRCh38)
Location 11:64652778-64652800
Sequence CAGGATGGCCAGAGAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 794
Summary {0: 1, 1: 0, 2: 5, 3: 67, 4: 721}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083731021_1083731029 1 Left 1083731021 11:64652754-64652776 CCACACGTACTGCCCATAAATAT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1083731029 11:64652778-64652800 CAGGATGGCCAGAGAGGGGAAGG 0: 1
1: 0
2: 5
3: 67
4: 721
1083731019_1083731029 14 Left 1083731019 11:64652741-64652763 CCAAGTCACGCCACCACACGTAC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1083731029 11:64652778-64652800 CAGGATGGCCAGAGAGGGGAAGG 0: 1
1: 0
2: 5
3: 67
4: 721
1083731020_1083731029 4 Left 1083731020 11:64652751-64652773 CCACCACACGTACTGCCCATAAA 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1083731029 11:64652778-64652800 CAGGATGGCCAGAGAGGGGAAGG 0: 1
1: 0
2: 5
3: 67
4: 721

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083731029 Original CRISPR CAGGATGGCCAGAGAGGGGA AGG Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900121920 1:1051886-1051908 CAGGAGGGCCCAGGAGGGGACGG + Intronic
900322572 1:2092369-2092391 CAGGGTGCCCAGAGAGGGCGGGG + Intronic
900743117 1:4342539-4342561 CTGCATGGTCCGAGAGGGGAGGG + Intergenic
901001958 1:6153317-6153339 CAGGCTGGGCAGACAGGGGCGGG + Intronic
901018303 1:6243882-6243904 CAGGATGGGCATGGAGGGGGTGG + Intergenic
901056144 1:6449368-6449390 GAGGAGGCCCAGAGAGGGGAGGG - Intronic
901142601 1:7044678-7044700 AAGGTCGCCCAGAGAGGGGAGGG - Intronic
901264309 1:7898403-7898425 CAAGATGGACAGAGAGAGAAGGG + Intergenic
901476730 1:9495106-9495128 CCGGAGGGGCAGAGCGGGGAGGG + Intergenic
901480353 1:9520739-9520761 CAGGAAGCACAGGGAGGGGAAGG - Intergenic
901487619 1:9575947-9575969 CAGCATGACCAGGAAGGGGAAGG - Intronic
901557898 1:10046089-10046111 CATTCTGGCCAGAGAGGGGAGGG + Intronic
901658875 1:10786378-10786400 CAGGCAGGCCAGAGAGGTAAAGG + Intronic
901664833 1:10820222-10820244 CATGATGGCAAGAGAGGGAAAGG - Intergenic
901781890 1:11599587-11599609 AATGAGGTCCAGAGAGGGGAAGG - Intergenic
902233482 1:15043085-15043107 CAGGAGGGCCAGCCTGGGGAGGG + Intronic
902707968 1:18219472-18219494 CAGGTGGGCCAGTGAGGAGATGG + Intronic
903233494 1:21935877-21935899 GAGGCTGCCCAGAGTGGGGATGG + Intronic
903237829 1:21961866-21961888 CTGGATGCCCTGAGAGGTGAGGG + Intergenic
903275607 1:22219410-22219432 CAGCCTGGCTAGAGAGGGGATGG - Intergenic
903371368 1:22838165-22838187 ATGGATGTCCAGAGAGGGCATGG - Intronic
903669122 1:25025177-25025199 AAGGATGGCAAGAGAGAGGCTGG + Intergenic
903907010 1:26695114-26695136 CAGAATTGAAAGAGAGGGGAGGG - Intergenic
903972737 1:27129640-27129662 GATGAAGCCCAGAGAGGGGACGG + Intronic
904008789 1:27378307-27378329 CAGGAGAGCCTGAGAGAGGAAGG + Intergenic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904082275 1:27879753-27879775 CAGGATTGTCACAGAGGGCAGGG + Exonic
904466896 1:30713657-30713679 CAGGTTGGCCAGAGCAGGGCAGG + Intronic
904615676 1:31748287-31748309 GAGCTGGGCCAGAGAGGGGAAGG + Intronic
904688010 1:32274562-32274584 AAAGAGGCCCAGAGAGGGGAAGG + Intronic
904784141 1:32973060-32973082 CTGGAAGGCCAGGGAGGGAAAGG - Intergenic
904953794 1:34266336-34266358 CAGGATGCACAGAGAGTGAATGG - Intergenic
904983360 1:34524867-34524889 GAGGATGGCCAGACAGTGGATGG - Intergenic
905170398 1:36106537-36106559 CAGGAAGCCGAGGGAGGGGAGGG + Intronic
905203780 1:36331182-36331204 CTGGGTGGTTAGAGAGGGGAGGG - Intergenic
905662133 1:39735779-39735801 CAGCATGCCTAGAGAGGGCATGG - Intronic
906310849 1:44753178-44753200 GAGGATGGTCAGCGAGGAGATGG + Exonic
906575571 1:46886410-46886432 CAGGTTGCCCAGAAAAGGGAGGG + Intergenic
906596405 1:47081486-47081508 CAGGTTGCCCAGAAAAGGGAGGG - Intronic
906607332 1:47181421-47181443 CAGCCTGGCCAGATCGGGGAGGG - Intergenic
907200134 1:52719313-52719335 CTGGATGGCCAGAGACAGGTAGG - Intergenic
908837836 1:68245783-68245805 GCAGATGGCCAGAGAGGGAATGG - Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
912091496 1:106081730-106081752 CAGGGTGGGTAGAGAGGGTAGGG - Intergenic
912699824 1:111869068-111869090 CAGGATGGGCAGCGTGTGGAAGG - Intronic
914921341 1:151849735-151849757 CAGGCTGGCCAGTGAGGACAAGG - Intronic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
915117402 1:153609357-153609379 CAGGCTGGCTGGAGAGGGCAGGG - Intronic
915287428 1:154861867-154861889 AACGAGGCCCAGAGAGGGGAAGG + Intronic
915739875 1:158111005-158111027 AAGGATGGATAGAGAGGTGAGGG - Intergenic
916059442 1:161088735-161088757 CCTGATGCCCAGAGAGTGGATGG - Intronic
916192148 1:162190173-162190195 GAACATGGCCAGAGAGGGGCAGG - Intronic
916597547 1:166258536-166258558 CAGGATGGCCACATAGCGAAGGG - Intergenic
916611571 1:166396866-166396888 AAGCAGGGCCAGAGAAGGGAGGG + Intergenic
916889530 1:169102930-169102952 GGGGAGGGGCAGAGAGGGGAAGG + Intergenic
916918811 1:169439864-169439886 GGGGATGGTCAGAGAGGAGATGG - Intronic
917329601 1:173868225-173868247 GAGGAAGAGCAGAGAGGGGAGGG + Intronic
917454145 1:175171207-175171229 CAGGATGGTGAGATAGGGGTTGG - Intronic
917513767 1:175689742-175689764 CAGGGTGGCCAGACAGGGAGGGG + Intronic
917591527 1:176481055-176481077 CAGGATTGTGAAAGAGGGGAGGG + Intronic
917667298 1:177237630-177237652 CAGGATGGCCAAGGGGGGAAGGG + Intronic
918514460 1:185347145-185347167 GAAGATGGCCAGTGAGGGGCTGG + Intergenic
918655952 1:187027053-187027075 CAGGATGGCCACATAGAGAAGGG + Intergenic
919384837 1:196908158-196908180 CAGGATGGGGAGCTAGGGGAGGG + Intronic
919458296 1:197846187-197846209 AAGGAAGGCAAGGGAGGGGAAGG - Intergenic
919922917 1:202177090-202177112 CAGGATGCCCAGAGCTGGGTGGG - Intergenic
919946643 1:202324039-202324061 CAGTAGGGACAGAGATGGGAGGG - Intergenic
920309266 1:205039052-205039074 CTGGATGGACAGAGAGGAGGTGG - Intergenic
920347725 1:205317450-205317472 CAGGCTGGGCAGAGTGGGGGTGG + Intronic
921254277 1:213325406-213325428 CAGTATGGGCAGAAAGGGAAAGG - Intergenic
921572952 1:216800371-216800393 CAGGCTGGACAGAAAAGGGAGGG + Intronic
921765778 1:218971494-218971516 CAGGAGTGCCAGTGAGGGGTGGG + Intergenic
921988236 1:221335700-221335722 CACTATGGCCAGAAAGGGGAGGG - Intergenic
922085738 1:222345121-222345143 CAGGATGGCCACAGAGGGTCAGG - Intergenic
922133879 1:222806176-222806198 CAGGATGGGAAGGGAGGGGAGGG - Intergenic
922323079 1:224504537-224504559 CAGGAGGGGAGGAGAGGGGAGGG - Intronic
922891052 1:229062242-229062264 CAGGATGGGCAGTGAGAGGTGGG + Intergenic
922905740 1:229172337-229172359 CAGGTAGGGCAGAGAGGGGAGGG + Intergenic
922908997 1:229199696-229199718 CAGGCAGGCCAGAGAAGGGAAGG - Intergenic
924044389 1:240012337-240012359 CAGATTGGCCAGAAAAGGGAGGG - Intergenic
924903761 1:248430293-248430315 CAGGATGGCTAGAGCAGTGAGGG - Intergenic
1062984549 10:1755477-1755499 CAGGATGGCCTTAGAGTCGAGGG - Intergenic
1063197815 10:3759551-3759573 AAGGAAGGAAAGAGAGGGGAAGG + Intergenic
1063302928 10:4868282-4868304 CAGGATGGCCATATAGAGAAAGG - Intergenic
1063315265 10:4998302-4998324 AAAGATGACCAGAGAGTGGACGG - Intronic
1063954602 10:11254884-11254906 CAGGAAGGGGAGAGATGGGATGG - Intronic
1064437570 10:15324557-15324579 CAGGATGGCCAGCTAGCGCACGG - Intronic
1064553929 10:16529386-16529408 CAGGGTGGAGAGATAGGGGAAGG - Intergenic
1065895374 10:30158669-30158691 CAAGGTGGCCAGAGAGATGAAGG - Intergenic
1066494081 10:35924780-35924802 GGGGTTGGCCAGAGAAGGGAAGG - Intergenic
1067287939 10:44921126-44921148 CAGGAGGGACAGAGACTGGAGGG + Intronic
1067717948 10:48704150-48704172 CAGGAAGGGCAGAGAGGGACTGG + Intronic
1068116641 10:52743644-52743666 CAGGATGCCCTGAGAGAGCAAGG + Intergenic
1068579560 10:58723647-58723669 CAGGAAGGCTAGAGAGGGCAGGG + Intronic
1069743488 10:70700264-70700286 CAGGAAGGACAGTGTGGGGAGGG - Intronic
1069912073 10:71765840-71765862 CAAGAGGGCCAGACAGGAGAGGG + Intronic
1070274067 10:74987551-74987573 AAGGATAGCCAGAGAAGGGCTGG + Intronic
1070379586 10:75868773-75868795 CAGGATGGAGAGAGAGAGGAGGG - Intronic
1070425866 10:76286505-76286527 CTGAGTGACCAGAGAGGGGATGG + Intronic
1070521813 10:77260306-77260328 CAGGAAGGACAGAGAGAGGAAGG + Intronic
1070630726 10:78082598-78082620 AAGGCTGGACAGAGAGGAGAGGG - Intergenic
1070717345 10:78732357-78732379 CAGGGTGGCGAGTGAAGGGAGGG + Intergenic
1070776443 10:79112599-79112621 GACGAGGCCCAGAGAGGGGAAGG + Intronic
1071526089 10:86359384-86359406 CAGTGTGGCCAGTGAGGGGCAGG + Intronic
1071564083 10:86662626-86662648 CACTAGGGCCAGAGCGGGGATGG + Intronic
1071618237 10:87095140-87095162 CGGGAGGGGCAGGGAGGGGAAGG + Intronic
1072044140 10:91637819-91637841 CAGGATGGCCAAAGAGGACCAGG + Intergenic
1072415185 10:95241407-95241429 AAGCATGGCAAGAGAGGGGCGGG - Intronic
1072738862 10:97897378-97897400 CAGGATGGTCCAAGAGGGCATGG - Intronic
1072924578 10:99605658-99605680 CAGCTTAGCCATAGAGGGGATGG - Intergenic
1073186924 10:101620562-101620584 CAGGCTGGCCAGAGCGGGCAGGG + Intronic
1073473346 10:103737513-103737535 CAGTAAGGGCAGGGAGGGGAAGG + Intronic
1073616763 10:105004205-105004227 CAGGATGGACAGAGAAGGGATGG + Intronic
1074108566 10:110406756-110406778 CAGGAGCTCCAGAGAGGTGAAGG + Intergenic
1075169730 10:120102065-120102087 GAGGAGGGCGAGGGAGGGGAGGG + Intergenic
1076120483 10:127933028-127933050 CAGGAGAGCCAGAGAGATGAGGG - Intronic
1076481000 10:130785275-130785297 CAGGAAGGCCAGAGCTGGAAGGG - Intergenic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1077349456 11:2085749-2085771 CAGGATGGCCAGAGGGGATCGGG + Intergenic
1077350938 11:2092924-2092946 CAGGGTGGCTGCAGAGGGGATGG - Intergenic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1077516726 11:3006711-3006733 CAGGCTGGCCAGCGTGGGAATGG + Intronic
1078758350 11:14232541-14232563 CAGAGTTGCCAGAGTGGGGAGGG - Intronic
1080397413 11:31902882-31902904 CAGGATGGGCAGAGATGCCAAGG - Intronic
1080921576 11:36714510-36714532 CAGGAAAGCCAGAGAGGAGTGGG - Intergenic
1081735058 11:45397000-45397022 CAGTGTGCCCAGAGAGGGCATGG - Intergenic
1082869968 11:57935240-57935262 AAAGAGGCCCAGAGAGGGGAAGG + Intergenic
1083179065 11:60972601-60972623 CAAGCTGGCCAGAGCGGGGCAGG + Intronic
1083479415 11:62934056-62934078 CAGAGTGGCCAGAGTGGGGTGGG - Intergenic
1083479461 11:62934247-62934269 CAGGAAGGGCAGGGAGGGGTTGG + Intergenic
1083660594 11:64250292-64250314 CTTGAGGCCCAGAGAGGGGAAGG - Intergenic
1083699687 11:64467736-64467758 TGGTATGGCCAGAGAGGGCATGG + Intergenic
1083702157 11:64486645-64486667 CAGGATGGGGAGGGAAGGGAGGG + Intergenic
1083731029 11:64652778-64652800 CAGGATGGCCAGAGAGGGGAAGG + Intronic
1083749698 11:64754301-64754323 GGGGATGGCCAGGGAGGGGTGGG + Exonic
1083894801 11:65614405-65614427 CAGGAGAGGCAGAGAGGGAAAGG + Intronic
1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG + Intronic
1084123302 11:67082186-67082208 GAGGATTGCCAGAGAAGGGGTGG + Intergenic
1084269647 11:68022136-68022158 CAGGATAGCCAGTGGTGGGATGG - Intronic
1084394295 11:68898677-68898699 CAGCATGGCCAGTGAGGGTCGGG + Intronic
1084435121 11:69135031-69135053 CAGGCTGGACAGAGAGGAGGAGG - Intergenic
1084472283 11:69370007-69370029 CAGAATAGGCAGAGAGGAGAAGG + Intergenic
1084785609 11:71440186-71440208 TAGGAGGGCCTGAGAGGGTAAGG + Intronic
1085295150 11:75427331-75427353 CAGGGTGGCCAGACATGGGAAGG - Intronic
1085699122 11:78730505-78730527 CCAGATGGACAGAGTGGGGAAGG + Intronic
1085810716 11:79678478-79678500 GAGGGTGGCTACAGAGGGGAAGG + Intergenic
1086897303 11:92328165-92328187 CAGGAGGGCAAGAGTGGGTAAGG - Intergenic
1087542691 11:99541482-99541504 CTGGAGGGCCAAAGAGGAGATGG + Intronic
1087926266 11:103922424-103922446 CAGGATGGAGGGTGAGGGGAAGG - Intronic
1087980833 11:104612222-104612244 CAAGTTGGCCAGAAAGGTGATGG + Intergenic
1088042537 11:105405074-105405096 CAACATTTCCAGAGAGGGGAAGG + Intergenic
1088359132 11:108973027-108973049 AAGGATTGCTACAGAGGGGAAGG - Intergenic
1088902680 11:114130060-114130082 CAGGATGCCCAGGGAGGAGCAGG + Intronic
1089031289 11:115332187-115332209 CAGTATGGGAAGATAGGGGAGGG - Intronic
1089100452 11:115958443-115958465 CATGCTGCCCAGGGAGGGGAGGG - Intergenic
1089255211 11:117190452-117190474 CAGGCTGGCAAGGGAGGGCAGGG - Intronic
1089583670 11:119496841-119496863 AAGGATGGTCAGGGAGGGGCAGG + Intergenic
1089848860 11:121479988-121480010 CAGGACTCCCAGAGAGGGGTGGG + Intronic
1089897991 11:121951236-121951258 GAGGAAGGACACAGAGGGGAGGG - Intergenic
1090550775 11:127817476-127817498 CAAGAGGGCAAGAGAGGGAAAGG - Intergenic
1090657620 11:128858087-128858109 CACGATGGCGAGAGATGGGGAGG + Intronic
1090773022 11:129938511-129938533 CAGGGTGGCAAAAGCGGGGATGG - Intronic
1090965743 11:131596544-131596566 AAGGAAGGCTAGAGAGGGGATGG - Intronic
1091193138 11:133710959-133710981 CAGGGAGGTCACAGAGGGGAGGG - Intergenic
1091274540 11:134341780-134341802 CCAGATGGCCAGAGACGGGGAGG - Intronic
1091419024 12:318868-318890 GAGAATGACCAGAGTGGGGAAGG + Intronic
1091700153 12:2653836-2653858 CAGGAGGGCCACATAGGGCAGGG - Exonic
1091727248 12:2854780-2854802 TCAGATGGCCAGAGCGGGGAAGG + Intronic
1091755918 12:3051474-3051496 GAGGAGGGGAAGAGAGGGGAAGG - Intergenic
1091933776 12:4418139-4418161 CAGCAAGGCCAGAGAGGCGTGGG + Intergenic
1092276776 12:7067489-7067511 GAGGATGGCCACAGAGAGGCTGG + Intronic
1093216174 12:16363866-16363888 CAGGATGGCTGTAGAGGGGTCGG - Exonic
1094191111 12:27699556-27699578 GACAATGGCCTGAGAGGGGAAGG - Intergenic
1094219029 12:27973919-27973941 CAGGAGGCCCAGAGAGGAGGCGG + Intergenic
1095465853 12:42487511-42487533 AAGGAGGGTCAGGGAGGGGATGG - Intronic
1096845690 12:54405229-54405251 CATCATGGCCAGTGAGGGTAAGG + Exonic
1096873586 12:54610346-54610368 AAGGATGGCGAGAGAGGTGGCGG + Intergenic
1097188450 12:57208301-57208323 CAGGCTGGCCTGGGAGGGAAGGG - Intronic
1098460801 12:70731065-70731087 GAGGAAGGCAAGAGAGAGGAAGG + Intronic
1098612948 12:72484939-72484961 CAGGATGGCTACATAGGGAAGGG + Intronic
1099033141 12:77554002-77554024 CAAGATGGCCAGAGAGAGCAGGG - Intergenic
1099775457 12:87122183-87122205 CAGGAAGGCCAGTTTGGGGAAGG + Intergenic
1100436089 12:94572806-94572828 GAGGAAGGCGAGAGAAGGGAGGG + Intronic
1101865398 12:108516249-108516271 ATGGAAGGCCAGAGAGGGGAAGG + Intronic
1101926193 12:108973243-108973265 ACTGAGGGCCAGAGAGGGGAGGG + Intronic
1101937482 12:109069962-109069984 CAGGGAGGCCAGGGCGGGGAGGG + Intronic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1102095808 12:110240332-110240354 CAGGATGGCCAGTGTGGCCATGG + Intergenic
1102517526 12:113459876-113459898 CAGGTTGGGGAGAGAGGGGAGGG - Intergenic
1102572207 12:113833694-113833716 CAGGACCACCAGAGAGGGGAAGG - Intronic
1102955282 12:117054801-117054823 GAGGATGGCCAGAAAGAGGAAGG - Intronic
1103274653 12:119701302-119701324 AAGGATGGAAAGGGAGGGGAAGG + Intronic
1103721549 12:122978169-122978191 CCTGAGGCCCAGAGAGGGGAAGG - Intronic
1104042990 12:125142626-125142648 CAGGAGAGCCTGAGATGGGAAGG - Exonic
1104846865 12:131851314-131851336 CAGCCTGGCCACAGAGGGCAAGG + Exonic
1105515406 13:21085269-21085291 GAGGATGGCTTGAGTGGGGAAGG + Intergenic
1105574405 13:21636813-21636835 CAGCTTGGCTACAGAGGGGATGG - Intergenic
1105597580 13:21853765-21853787 CAGGAAGGAGAGAGATGGGAAGG - Intergenic
1105859363 13:24395367-24395389 CAGGATGGCCAGAGGAGGCTGGG - Intergenic
1105947973 13:25205862-25205884 TAGCATGGCCAGGGAGGAGAAGG - Intergenic
1106543681 13:30712941-30712963 CAGCATGGCCAGAGAGAAGTTGG - Intergenic
1108212751 13:48154872-48154894 CTGGTTGTGCAGAGAGGGGAGGG + Intergenic
1108709151 13:53016103-53016125 CAGGATGCCCTGTGAGAGGAGGG - Intergenic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1109868612 13:68301550-68301572 GAGGAGGGCCAGAGAAGTGACGG - Intergenic
1110248545 13:73355640-73355662 CAGGATGGCTAGAAAGGGTCAGG - Intergenic
1110381747 13:74859434-74859456 GGGGATGGGCAGTGAGGGGAGGG + Intergenic
1112030787 13:95454527-95454549 CAGGGTGGGGAGAGAGGGGAGGG - Intronic
1112179400 13:97062616-97062638 AAGTATTGCCAGAGTGGGGATGG + Intergenic
1112900525 13:104352417-104352439 TGGGATGGGAAGAGAGGGGAGGG - Intergenic
1113398485 13:109970604-109970626 CAAGATGGCCAAAGATGAGAGGG - Intergenic
1113973325 13:114207291-114207313 CGGCATGGACAGCGAGGGGAGGG + Intergenic
1114530067 14:23389901-23389923 GAGGAGAGCCAGAGAGGGGCAGG + Intronic
1114535476 14:23419601-23419623 CAGGTTAGCCTGAGAAGGGAAGG + Exonic
1115215010 14:31005336-31005358 GGGGATGGCAAGGGAGGGGAGGG + Intronic
1115303888 14:31914351-31914373 CAGGATGGCCACATAGAGAAGGG - Intergenic
1115782676 14:36786922-36786944 CATAATTGCCAGAGAGGTGAGGG - Intronic
1115855160 14:37622655-37622677 CTGCATGGCCAAAGAGAGGAAGG + Intronic
1118149575 14:63175201-63175223 CACCATGGCTGGAGAGGGGATGG - Intergenic
1118613973 14:67562696-67562718 CAGGAAGGCCAGAGGGGTGGAGG - Exonic
1118970960 14:70637336-70637358 CAGAATGGGGAGAGTGGGGAGGG - Intergenic
1119669869 14:76510169-76510191 CAGGAGGCCAACAGAGGGGAGGG + Intergenic
1119850705 14:77864556-77864578 CAGGTTGGCCAGAGCTGGGCTGG + Intronic
1120036402 14:79703595-79703617 CATGATGGCCGGAGAGAGAAAGG + Intronic
1120758415 14:88265333-88265355 CAGGAGGGCCAGAGAGAGAAGGG + Intronic
1121418249 14:93794094-93794116 TAGGATGGCCAAAGAGGGGCTGG - Intergenic
1121508342 14:94493411-94493433 CAGGAGGGCCATAGAAAGGAAGG - Intronic
1121720749 14:96107077-96107099 CAGGATACCAAGAGAGGTGACGG + Intergenic
1121740837 14:96251346-96251368 CAGGATGGCCAGCGAGAAGGTGG + Intronic
1121837477 14:97105157-97105179 CATCAAGGCCAGAGAGGGGATGG - Intergenic
1122136866 14:99638463-99638485 CAGTCTGGCCAGAGAGGCGCTGG + Intergenic
1122414362 14:101541832-101541854 CAGGATGGGCAGGGGAGGGAAGG - Intergenic
1122689440 14:103524833-103524855 CAGGAGGGTGAGAGAGGGGAGGG - Intergenic
1122854356 14:104552997-104553019 CTGGAAGGACAGAGAGGGAAAGG + Intronic
1122863593 14:104593602-104593624 CAGGAAGGCCAGCGTGGTGATGG + Exonic
1122897759 14:104768914-104768936 CAGGAAGGACAGATAGGGCAGGG - Intergenic
1123112880 14:105881279-105881301 CAGGATGGCCTCAATGGGGAGGG + Intergenic
1123184806 14:106506486-106506508 CAGGATGGTGACAGTGGGGAAGG + Intergenic
1202904297 14_GL000194v1_random:59616-59638 CAGGCTGGGCACAGTGGGGAGGG + Intergenic
1123399705 15:19972278-19972300 CAGGATGGTGACAGTGGGGAAGG + Intergenic
1123434907 15:20247808-20247830 AAGGATGGGAAGGGAGGGGAGGG + Intergenic
1124170460 15:27368053-27368075 CAGAATGGCCAGGAATGGGACGG + Intronic
1124404985 15:29384461-29384483 CAGGATGGCTTCAGTGGGGAGGG - Intronic
1124490253 15:30151028-30151050 TGGGAGGGCCAGGGAGGGGAGGG + Intergenic
1124685340 15:31777510-31777532 CAGGATGGACAGAAAATGGAGGG + Intronic
1124720879 15:32109965-32109987 AATGATGGCCAGAGAGGGAGGGG - Intronic
1124753280 15:32387301-32387323 TGGGAGGGCCAGGGAGGGGAGGG - Intergenic
1124975020 15:34523001-34523023 TGGGAGGGCCAGGGAGGGGAGGG - Intergenic
1125334532 15:38614459-38614481 CTGGAAGCCCATAGAGGGGAAGG - Intergenic
1125599150 15:40906260-40906282 CTGGAGGGCCAGAGGGGGGTGGG + Intergenic
1126105528 15:45144625-45144647 CAGGAAGGCCAGAGGATGGAGGG - Intronic
1126638663 15:50803473-50803495 CAGTATACCCAGAGAGGGTATGG + Intergenic
1127381887 15:58437864-58437886 AAGGATGGCCATGGATGGGAGGG - Intronic
1127417632 15:58772189-58772211 GAGGATGGCCAGCAAGGGGCAGG - Exonic
1127622290 15:60745554-60745576 CGGCATGGCCAGAGAGGCCAGGG + Intronic
1127674366 15:61226832-61226854 CAGGAGGGACAGACAGGGGCTGG + Intronic
1128358275 15:66943457-66943479 TAGGATGGTCAGAGAGGAGAGGG + Intergenic
1128379972 15:67105318-67105340 CAGGATGGGTAGGGAGGGGTAGG + Intronic
1128392420 15:67191128-67191150 CAGTATGTTCTGAGAGGGGAGGG - Exonic
1128602297 15:69007437-69007459 CAGGATGGCTATAAAGAGGAGGG + Intronic
1128935363 15:71741869-71741891 TAGGATTGCCAGAGAAGGGAGGG - Intronic
1129166857 15:73783392-73783414 CAGGAAGGCCACAGTGGAGATGG - Intergenic
1129239771 15:74244467-74244489 CATGATGGTCAGATTGGGGAAGG + Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129678081 15:77643198-77643220 CAGCCTGGTCAGATAGGGGATGG + Intronic
1129707748 15:77804407-77804429 GTAGATGGCCAGAGAGGGGAGGG + Intronic
1129867687 15:78921988-78922010 CAGGCTGGGCACAGAGGTGAGGG + Exonic
1130338491 15:82978454-82978476 CAGGTAGACCAGAGTGGGGAGGG + Intronic
1130339746 15:82989253-82989275 CTGGAAGGCCAGTGAGGGCAGGG + Intronic
1130543349 15:84837989-84838011 CACTATGGCCAGAGAGGTAAGGG + Intronic
1131166556 15:90145850-90145872 CAGAGAGGCAAGAGAGGGGATGG + Intergenic
1131266017 15:90915891-90915913 CATGAGGTCCAGAAAGGGGAAGG - Intronic
1132083576 15:98887817-98887839 CATGATGATCAGAGAGGGTAGGG - Intronic
1132149893 15:99451903-99451925 AAGGATGGACAGAGGGGAGATGG - Intergenic
1132607235 16:798687-798709 CAGGATGGTGTGAGAGGGGCCGG + Exonic
1132670122 16:1099080-1099102 CACCATGGCCAGGGAGGGGGAGG - Intergenic
1132832987 16:1938576-1938598 CAGGCCAGCCAGAGTGGGGATGG - Exonic
1132851998 16:2028988-2029010 CTGGATCTGCAGAGAGGGGAAGG - Intronic
1133000853 16:2850700-2850722 AAGGAGGGCTGGAGAGGGGAGGG + Intergenic
1133210937 16:4263190-4263212 GAGGAAAGCCAGGGAGGGGATGG - Intronic
1133232013 16:4371472-4371494 CAGGATGGCGGGAGTGGGGCTGG - Intronic
1133392110 16:5418996-5419018 CAGGTAGGCCAGAGAGAGCAAGG + Intergenic
1135046917 16:19163495-19163517 CAGGGAGGCCAGTGAGGAGATGG - Intronic
1135959900 16:26986853-26986875 CAGGCTGGCCAGGGAGGTGGGGG - Intergenic
1135990490 16:27216030-27216052 CAGGAGGGGAGGAGAGGGGAAGG - Intronic
1136299582 16:29324949-29324971 GGGGAGGGGCAGAGAGGGGAAGG - Intergenic
1136406936 16:30053513-30053535 GAGGGGGCCCAGAGAGGGGAAGG - Intronic
1136634435 16:31510647-31510669 CAGCATGTCCTGAGTGGGGAGGG + Intergenic
1136690953 16:32028641-32028663 CTGGATGTCCAGAGAGAAGATGG - Intergenic
1136778646 16:32884391-32884413 TAGGAGGCCCAGAGAGGAGAAGG - Intergenic
1136849713 16:33603180-33603202 AAGGATGGGAAGGGAGGGGAGGG - Intergenic
1136891974 16:33977123-33977145 TAGGAGGCCCAGAGAGGAGAAGG + Intergenic
1137249091 16:46729917-46729939 CAGGATGGCCTCAGTGGTGAGGG - Intronic
1138533058 16:57645574-57645596 AGAGATGGTCAGAGAGGGGAGGG - Intronic
1138590993 16:57999935-57999957 CAGGAGGGCCAGGGTGGGCAGGG - Intronic
1139211651 16:65083569-65083591 CAGGATGGCTAGAATGGGAAAGG - Intronic
1139579677 16:67865013-67865035 CAGGAAGGCCAGTGAGGGGTGGG + Intronic
1141080544 16:81047898-81047920 CAGGACGGCCAGAGAGAGAAGGG + Intergenic
1141641622 16:85344802-85344824 CAGGCTGGAGAGAGAAGGGAGGG + Intergenic
1141868357 16:86766719-86766741 CAGGACTGCTAGAGAGAGGAGGG - Intergenic
1142153807 16:88524203-88524225 CAGGAAGGCCAGGGTGGGGAGGG + Intronic
1142239201 16:88937488-88937510 CGGGAGGGCCAGCGTGGGGACGG - Intronic
1203081062 16_KI270728v1_random:1146485-1146507 TAGGAGGCCCAGAGAGGAGAAGG - Intergenic
1142642339 17:1291519-1291541 CAGCATGGCCAGAGAGGCTCAGG - Intronic
1142685526 17:1575132-1575154 CAGGCTGGCCGGGGAGGGGGTGG + Exonic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1142847958 17:2691144-2691166 CAGGATGGGAAGCGTGGGGAGGG + Intronic
1143033705 17:3982476-3982498 CACTAAGGCCAGAGAGGGCAAGG - Intergenic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143327661 17:6110026-6110048 GAGGATGAACAGAGAGGGGCAGG + Intronic
1143382962 17:6507907-6507929 CAGGATGTCCAGAGGTGGGGAGG + Intronic
1143503688 17:7352585-7352607 GAGGGCAGCCAGAGAGGGGAAGG - Exonic
1143571310 17:7760377-7760399 CAGGGGGGCCAGACTGGGGAAGG + Intronic
1143580955 17:7825627-7825649 GGGGAGGGCCAAAGAGGGGAGGG + Intronic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143723256 17:8828465-8828487 CAGGGTGGCAAGAGAGGGTCAGG - Intronic
1143739874 17:8944792-8944814 CAGGATGGCTAGATATAGGAGGG - Intronic
1143971279 17:10797762-10797784 AATGATGGCCACGGAGGGGAGGG - Intergenic
1144020447 17:11236442-11236464 CTGGAAGACCAGAGATGGGAAGG + Intergenic
1144167305 17:12625195-12625217 CTGGATGGTCAGTGAGGGCATGG - Intergenic
1144304701 17:13957732-13957754 CAACAGGCCCAGAGAGGGGATGG - Intergenic
1144560249 17:16315412-16315434 CAGAAAGGCCAGAGTGAGGAGGG - Intronic
1144809441 17:17989335-17989357 CAGGATGGCCAGAGAAGCAGTGG + Intronic
1144860923 17:18301396-18301418 CCGGAGGGACAGTGAGGGGAGGG - Intronic
1145233255 17:21190459-21190481 CAGGATGGCCAGACAGAGGTGGG - Intronic
1145242699 17:21249014-21249036 CAGGAGGGGCAGAGAGAGCATGG - Intronic
1145414285 17:22702661-22702683 AAGTATGGGGAGAGAGGGGATGG + Intergenic
1145764581 17:27449559-27449581 CGTGATGGACAGAGAGGGGCAGG + Intergenic
1146122996 17:30211215-30211237 TGGGATGGCCAGGGATGGGAGGG + Intronic
1146653653 17:34622595-34622617 CTGGGTGGCCACTGAGGGGAGGG - Intronic
1146928010 17:36758286-36758308 GAGGAGGTCCAGAGAAGGGAGGG + Intergenic
1147215738 17:38897974-38897996 CAGGATGGGCAGGGAGTGAAGGG + Intronic
1147582522 17:41635340-41635362 CAGGAAGGCCACAGAGGAGCAGG + Intergenic
1148092905 17:45033298-45033320 CAAGATGGCCAGGGTGGGTAGGG - Intronic
1148213391 17:45821293-45821315 CAGGATGGTCAGGCAGGGGCCGG + Intronic
1148287839 17:46411576-46411598 CAGGTTGGCCAGAAGTGGGATGG + Intergenic
1148310008 17:46629156-46629178 CAGGTTGGCCAGAAGTGGGATGG + Intronic
1148972758 17:51498634-51498656 CAGAAAGGCCATAGAGGGTAGGG + Intergenic
1149500213 17:57146759-57146781 CAGGATGGGCAGAGACAGGGAGG - Intergenic
1150444333 17:65216963-65216985 CTTGAGGGCCAGAGAGTGGATGG + Intronic
1150699738 17:67436500-67436522 TAGGGAGGCCAGGGAGGGGAAGG + Intronic
1150925558 17:69528305-69528327 CTGGATGACTAGAGAGGGGCTGG + Intronic
1151291186 17:73151207-73151229 GAGGAAGGGAAGAGAGGGGAGGG + Intergenic
1151370911 17:73645489-73645511 AAGGCTGGGCAGAGAGCGGAGGG - Intergenic
1151478078 17:74354944-74354966 CAGTATGGGCAAGGAGGGGATGG + Intronic
1151596750 17:75082614-75082636 GGGGATGGCACGAGAGGGGAAGG - Intergenic
1151625759 17:75274545-75274567 CAGTTTGGCCAGAGGTGGGAAGG - Intronic
1152233314 17:79125659-79125681 CTGGAGGGCCTGAGAGGAGAGGG - Intronic
1152771427 17:82172039-82172061 CACTCTGGCCAGTGAGGGGAGGG - Intronic
1152885183 17:82845347-82845369 CAGGATGGACAGAGAGGAAGGGG - Intronic
1153798985 18:8651866-8651888 CAGGGTGGCGAGCTAGGGGAGGG + Intergenic
1155386359 18:25282290-25282312 GAGGAGGGCCAGAGAGGAGTAGG + Intronic
1155500554 18:26482889-26482911 GAGGATGGCGAGAAAAGGGAAGG + Intronic
1155514868 18:26614489-26614511 TGGGATGGGCAGAGAGGAGAGGG + Intronic
1155638681 18:27986020-27986042 CAGGAGGGGCAGGGAGGGTACGG - Intronic
1155860950 18:30898718-30898740 TGGGATGGGCAGAGAGGGGAGGG + Intergenic
1156504157 18:37578249-37578271 TAGGATGGACAGGGAGAGGAGGG + Intergenic
1156508241 18:37612780-37612802 CAGGATGGCCTGAGCTGAGAAGG + Intergenic
1156578862 18:38351790-38351812 CTGGCTGCCCAGAGTGGGGATGG + Intergenic
1157503953 18:48212895-48212917 CAGGCTGGCCAGGCAGAGGAGGG - Intronic
1158445603 18:57518003-57518025 CAGGAAGGCCAGGGAGCCGATGG + Intergenic
1159300048 18:66552045-66552067 CAGGACTACTAGAGAGGGGAAGG + Intronic
1160117554 18:76095588-76095610 GAGGACTACCAGAGAGGGGAGGG + Intergenic
1160144449 18:76352151-76352173 CAGGATGTCCAGAGAGCTGGGGG + Intergenic
1160266635 18:77344262-77344284 GGGGATGGCTAGAGACGGGATGG - Intergenic
1160455652 18:78997165-78997187 CATGCTGCCCAGAGGGGGGAGGG - Exonic
1160705108 19:525910-525932 GGGGATGGGAAGAGAGGGGAGGG + Intergenic
1160750960 19:734234-734256 TCTGGTGGCCAGAGAGGGGATGG + Intronic
1160770447 19:828589-828611 GAGGAGGCCCAGAGAAGGGAAGG + Intronic
1160770575 19:829021-829043 GAGGAGGGGCAGAGAAGGGAAGG + Intronic
1160857634 19:1224511-1224533 CAGGAGGGCCAGTTAGGGCAGGG + Intronic
1160859363 19:1231118-1231140 CGGGCTGGCCAGAAAGGGGCGGG + Exonic
1161284106 19:3459961-3459983 CAGGGTGGACTGTGAGGGGAGGG - Intronic
1161288124 19:3479141-3479163 CTGGGGGCCCAGAGAGGGGAGGG + Intronic
1161527455 19:4765582-4765604 ATAGATGGCTAGAGAGGGGAAGG - Intergenic
1161608601 19:5228816-5228838 CAGCGGGGCCAGAGTGGGGAAGG - Intronic
1162366193 19:10251172-10251194 CTGGAAGGTCTGAGAGGGGACGG + Intergenic
1162528632 19:11222564-11222586 GAGAATGGCAAGAGAGGTGAAGG + Intronic
1162571895 19:11479221-11479243 CACGAGGCCCAGAGAGGGAAAGG + Intronic
1162743138 19:12784202-12784224 CAGGGTGACCAGACAGGGGGCGG + Intronic
1163050210 19:14677510-14677532 GAGAATGGCCAGAGAGATGAGGG + Intronic
1163167445 19:15508026-15508048 CAGGATCCAGAGAGAGGGGAAGG + Intergenic
1163502594 19:17685940-17685962 GATGGTGCCCAGAGAGGGGAGGG - Intronic
1163561455 19:18021748-18021770 AAGAATGATCAGAGAGGGGATGG + Intergenic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163737014 19:18987835-18987857 CAGGCTGGCCAGGGAGGGGTGGG + Intergenic
1163898204 19:20078151-20078173 CAGCATTCCGAGAGAGGGGAGGG + Intronic
1163933979 19:20424748-20424770 CAACATCCCCAGAGAGGGGAGGG - Intergenic
1164158220 19:22609557-22609579 CAGAATGCCCAGGGAGCGGAGGG - Intergenic
1164676457 19:30104774-30104796 CTGCATGGACACAGAGGGGATGG - Intergenic
1164716257 19:30392415-30392437 CAGGGTAGCCAGAGAAGGGTTGG + Intronic
1164748176 19:30631168-30631190 GCAGATGGCCAGGGAGGGGAGGG - Intronic
1164839954 19:31385697-31385719 TTTGAGGGCCAGAGAGGGGAAGG + Intergenic
1165739102 19:38195186-38195208 CAGGATGCCCTGAGCAGGGAGGG - Intronic
1166390795 19:42407777-42407799 CATGTTGGCCAGAGACTGGAGGG + Exonic
1166859246 19:45800346-45800368 CAGGGTGGGCAGAGATGGGGAGG - Intronic
1166976597 19:46608516-46608538 CATGATGGCCAGAAAGATGAAGG + Exonic
1167148302 19:47695212-47695234 CAGGAAGGCCAGAGGTGGCAGGG + Intronic
1167233202 19:48297964-48297986 CAGGAGGGACGCAGAGGGGACGG - Intronic
1167419282 19:49393884-49393906 CAGGGTGGGCAGTGAGGGAATGG - Intronic
1167497423 19:49827800-49827822 CAGACAGCCCAGAGAGGGGAGGG + Intronic
1168591955 19:57643751-57643773 CTTGAGGGCCAGAGAGGGGAGGG - Intergenic
1168641115 19:58032416-58032438 CAGGAGTGGCAGGGAGGGGAGGG - Intergenic
926113321 2:10196236-10196258 AAAGGTGGCCAGAGAGGGGTGGG + Intronic
926124953 2:10266251-10266273 AAGGATGGCCCGGGAGGGGGCGG + Intergenic
926171428 2:10555243-10555265 CAGGATGTGCAGAGCGGGGTGGG + Intergenic
926212390 2:10880504-10880526 CAGGACGGCCTGGGAAGGGAGGG - Intergenic
927086165 2:19675687-19675709 ATGGAAGGCCAGAGAAGGGAAGG - Intergenic
927515786 2:23670874-23670896 CAGAGTGGGCAGAGAAGGGAGGG + Intronic
927685859 2:25169854-25169876 CTGGATGGCTGGAGAGAGGAAGG - Intergenic
928205644 2:29281333-29281355 CAGGCTGCCCACAGAGAGGAAGG - Intronic
929444519 2:41991992-41992014 GAGGAAGGCAGGAGAGGGGAGGG + Intergenic
929593841 2:43163335-43163357 CAGGAGAGGCAGAGAAGGGAGGG - Intergenic
931589942 2:63871780-63871802 CAGGATGGCCAGAGAAAAGAGGG - Intronic
932313928 2:70767494-70767516 CGGGAAGGAAAGAGAGGGGAGGG + Intronic
932400260 2:71475602-71475624 CAGAGTGGGCACAGAGGGGAGGG + Intronic
932448383 2:71794466-71794488 CTGCAGGGCCAGAGTGGGGAGGG + Intergenic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
932598162 2:73107029-73107051 AATGGTGGCCAGAGAGGAGAGGG - Intronic
932780052 2:74554129-74554151 CGGGAGGGCCAGGGAGGGGGAGG - Exonic
934502344 2:94870781-94870803 CAGGCTGGGCACAGCGGGGAGGG - Intergenic
934928621 2:98400731-98400753 CAGGAAGATCAGAGAGAGGAAGG + Intergenic
934985222 2:98880529-98880551 CAGGATGCCCAGAGAAGGGGGGG - Intronic
935818520 2:106870042-106870064 CAAGATGGCCAGTGAGAGGAGGG + Intronic
937509805 2:122582951-122582973 AAGGAGGACCAGGGAGGGGAGGG + Intergenic
937643914 2:124244478-124244500 CTGGATGGGCAGAGAAGGAAAGG + Intronic
937954815 2:127416238-127416260 CAGGCTGCCCAGAGGGCGGAAGG - Intergenic
940005574 2:149006812-149006834 CAGGGAGGCTAGAGAGGGGAGGG + Intronic
941830780 2:169956431-169956453 CAGAAAGGGAAGAGAGGGGATGG + Intronic
941883218 2:170502542-170502564 CTGAAGAGCCAGAGAGGGGACGG - Intronic
942321340 2:174739170-174739192 CTGGCTGGCCAGGGAGAGGATGG - Intergenic
944685258 2:202112320-202112342 CAGCAGGCCCAGAGAGGGCACGG + Intronic
945067862 2:205962191-205962213 CAGGGTGGCCAGTCAGTGGATGG - Intergenic
946158992 2:217824733-217824755 TAGGGTGGCAAGAGACGGGAGGG - Intronic
946385615 2:219382660-219382682 CATGATGGCCAGAGCTGGAACGG + Intronic
946678373 2:222186897-222186919 CTGCATGGCCAGAGAAGAGATGG - Intergenic
947870678 2:233436178-233436200 CCTGATGGCCAGTGAGGGAAGGG - Intronic
948260361 2:236599989-236600011 CAGGGTGGGGAGTGAGGGGAGGG - Intergenic
948805820 2:240453188-240453210 CAGGAGGGGCGGAAAGGGGATGG - Intronic
948855227 2:240727245-240727267 CAAGAAGGGCAGAGAGGGAAGGG + Intronic
949034986 2:241812176-241812198 CAGGATGGGCTGTGAGGGGTTGG + Intronic
1168849885 20:969224-969246 GAGGATCGCCTGAGCGGGGAAGG + Intronic
1168919682 20:1520876-1520898 GAGGCTGGCAAGAGAGGGGCAGG - Intergenic
1168978115 20:1983066-1983088 CAGGATGGCCTGGCAGGGGCTGG - Exonic
1169011011 20:2250385-2250407 CAGGATGGCCAGAGAACTTAAGG - Intergenic
1169084985 20:2820970-2820992 CAGGGTCGTCAGGGAGGGGAAGG + Intergenic
1169737892 20:8856717-8856739 CAGGATGGCTAGTGATTGGAAGG + Intronic
1169829973 20:9814126-9814148 CAGGATGGCCAGGCAGAGAATGG + Intronic
1170032767 20:11959698-11959720 GAGGAAGGCAAGACAGGGGAGGG + Intergenic
1170061695 20:12265817-12265839 CAGGGTGCCCAGTGAGGGCAGGG + Intergenic
1170073435 20:12393255-12393277 GAGGATGGACAGAGAGGGAAAGG + Intergenic
1170312841 20:15011671-15011693 CTGGATGGAGAGAGAGGGGAAGG - Intronic
1170860036 20:20094276-20094298 CAGGCTAGCCATAGAAGGGAGGG + Intronic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1171170190 20:23008951-23008973 CAGGGTGGGTAGAGATGGGAAGG + Intergenic
1172311078 20:33918887-33918909 CAGGGAGGCCAGGGAGGGGCTGG - Intergenic
1172443292 20:34980133-34980155 CAGGACGGCCACAGAGGGTGTGG + Intronic
1172448239 20:35004105-35004127 CAGGAGGCTCAGAGAAGGGAAGG + Intronic
1172526414 20:35602569-35602591 CCGGGTGGCCATAAAGGGGAGGG + Intergenic
1172702119 20:36860153-36860175 CGCTAAGGCCAGAGAGGGGAAGG - Intronic
1172809734 20:37638697-37638719 AAAGAGGCCCAGAGAGGGGAAGG - Intergenic
1172870491 20:38132567-38132589 CAAGAGGCACAGAGAGGGGAAGG + Intronic
1173125612 20:40333360-40333382 CAGGGAGGCCAGAGAGGGACTGG - Intergenic
1173491246 20:43484205-43484227 CAGGATGGCTAAAGAGGGCAGGG + Intergenic
1173675990 20:44836097-44836119 AGAGATGGCGAGAGAGGGGAGGG + Intergenic
1173869451 20:46332386-46332408 CAGTTGGGCCAGTGAGGGGAAGG - Intergenic
1174028798 20:47603718-47603740 GAGGACGGTCAGAGAGGAGATGG - Intronic
1174139748 20:48404418-48404440 TAGGATGGAAAGAGAAGGGATGG - Intergenic
1174175156 20:48639912-48639934 CATGAGGGCCAGGGAAGGGACGG + Intronic
1174304103 20:49603004-49603026 CAGGATGCCCAGAGGTGGGCTGG - Intergenic
1174339280 20:49886061-49886083 GAGGATGGCCGGGGAGGGGAGGG - Intronic
1174400818 20:50274950-50274972 CAGTTGGGCCAGGGAGGGGAAGG + Intergenic
1175158975 20:56994085-56994107 CAGGGAGGTCAGAGAGGGGCAGG - Intergenic
1175534441 20:59698291-59698313 CTGGATGGAGAGAGAGGGGCAGG + Intronic
1175570242 20:60012615-60012637 CAAGCTGGCCAGAGAGCTGAGGG - Exonic
1175837811 20:62007495-62007517 CAGTAGGGCCAGGGAGGGGTGGG - Intronic
1176623670 21:9074383-9074405 CAGGCTGGGCACAGCGGGGAGGG + Intergenic
1176954946 21:15091406-15091428 CAGGATGGCCAGAAATAGAAAGG + Intergenic
1177797427 21:25793593-25793615 AAGGAAGGAGAGAGAGGGGAAGG - Intergenic
1178360946 21:31948253-31948275 CAGGTTAGCCAGAGAATGGATGG - Intronic
1178660005 21:34499351-34499373 CAGGATGGGCAGACAGGGAAGGG - Intergenic
1178924231 21:36761772-36761794 TGGGAAGGCGAGAGAGGGGAAGG - Intronic
1179210759 21:39322651-39322673 CAGGCTGGCCACGGAGGGCACGG - Intergenic
1179979180 21:44887634-44887656 CAGGATGGCAGGAGGGGGCACGG - Intronic
1180618262 22:17143035-17143057 CCTGAGGGCCAGAGAGGAGACGG + Intronic
1180696501 22:17754410-17754432 CAGGGTGCCCAGGGAGGGCAGGG + Intronic
1180757992 22:18176398-18176420 CTGGATGGGGAGGGAGGGGAGGG + Intronic
1180768280 22:18360190-18360212 CTGGATGGGGAGGGAGGGGAGGG + Intergenic
1180778029 22:18502201-18502223 CTGGATGGGGAGGGAGGGGAGGG - Intergenic
1180810753 22:18759512-18759534 CTGGATGGGGAGGGAGGGGAGGG - Intergenic
1180826158 22:18863414-18863436 CTGGATGGGGAGGGAGGGGAGGG + Intergenic
1181196901 22:21193767-21193789 CTGGATGGGGAGGGAGGGGAGGG - Intergenic
1181212627 22:21299357-21299379 CTGGATGGGGAGGGAGGGGAGGG + Intergenic
1181990587 22:26833820-26833842 CAGGGTGGCAAGAGGTGGGAAGG + Intergenic
1182097884 22:27638263-27638285 CAGGAAGGCCAGGGCGGGGCTGG - Intergenic
1182441735 22:30368629-30368651 CACCTTGGCCAGAGAGGGGCGGG + Intronic
1182542976 22:31055259-31055281 AAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1182977730 22:34639039-34639061 GAGGATGCAGAGAGAGGGGATGG - Intergenic
1183248546 22:36712032-36712054 CAGGATGGGGAGAGGGCGGAGGG + Intergenic
1183434117 22:37783446-37783468 CAGGATGGCCAGAGCTAGGGAGG - Intergenic
1183458643 22:37936381-37936403 CAGGAGGGACAGAGTGGGGCAGG - Intronic
1183500278 22:38174758-38174780 CTGGACGGCTCGAGAGGGGAAGG + Intronic
1183618392 22:38958917-38958939 CAGGATGCATAGAGAGGGGCTGG + Intronic
1183623588 22:38988819-38988841 CAGGATGTCTACAGAGGGGCCGG + Intronic
1183680616 22:39326909-39326931 CAGGAGGGCAAGAGAGGAGTTGG + Intergenic
1183709161 22:39492318-39492340 CTGGATGGCCAGTGGGGAGAGGG + Intergenic
1183928994 22:41225452-41225474 CAGGAGGGCCAAGGAGGGGTGGG - Intronic
1184037705 22:41926412-41926434 GAGGCTGGCCGGGGAGGGGAGGG + Intronic
1184093296 22:42303621-42303643 CATGATGGCCAGCCAGGTGAAGG + Intronic
1184172124 22:42765924-42765946 CACAATGGGCAGAGAGGGGCGGG - Intergenic
1184779491 22:46639867-46639889 CAGCTTGGGCAGAGAGGGGCTGG + Intronic
1185131705 22:49043171-49043193 AATGATGTCCAGAGAGGGGCTGG + Intergenic
1185181210 22:49364475-49364497 CAGGAAGGGCAGGGAGGAGAGGG - Intergenic
1185206416 22:49541546-49541568 CTGGCTGCCCAGCGAGGGGAGGG + Intronic
1203229899 22_KI270731v1_random:101078-101100 CTGGATGGGGAGGGAGGGGAGGG + Intergenic
949148142 3:729605-729627 AAGGATAGACAGAGAGGGAAAGG - Intergenic
949335453 3:2969851-2969873 CATGATGGTCAGAGAGCGGCTGG + Intronic
949698711 3:6730337-6730359 CAGGAGGAAGAGAGAGGGGAGGG + Intergenic
950422204 3:12905802-12905824 CAGCTTGGCCAGGGAGGGGCAGG + Intronic
951638369 3:24805577-24805599 GAGGATGGCCAGTGAGGACAGGG - Intergenic
952512222 3:34069157-34069179 GAGGAGGGCCAAAGAGAGGATGG + Intergenic
952820890 3:37484606-37484628 CATGAGGTCCAGAGAGGTGATGG + Intronic
953348576 3:42197130-42197152 CTGGATTGCCAGAGGGGAGAGGG + Intronic
953650594 3:44799631-44799653 CAGGATGTCAAGAGTGGGGCAGG - Intronic
953983434 3:47424270-47424292 CTGGATGGCTAGAGACAGGATGG - Intronic
954069151 3:48130341-48130363 CAGAATGTGCAGAGAAGGGAAGG - Intergenic
954285667 3:49617381-49617403 CAGGAAGGGCAGAGAGATGAAGG - Intronic
954390772 3:50267057-50267079 CATGACAGCCAGATAGGGGAGGG - Intergenic
954538772 3:51380307-51380329 CAGGCTGGGGAGAGAGGTGAAGG - Intronic
956204076 3:66738127-66738149 TAGGATGGCCAGAAAGGGGATGG + Intergenic
959100824 3:102008025-102008047 CAGAATGTCCAGACAGGGCACGG - Intergenic
959254978 3:103998178-103998200 GAGGAGGGCAAGAGAGGTGAAGG + Intergenic
959891964 3:111567039-111567061 CAGGATGTCCACAGTGGGGGAGG + Intronic
960036137 3:113104877-113104899 CCAGAGGGCCAGAGCGGGGAGGG - Intergenic
960071479 3:113435920-113435942 AAGGATGGAGAGAGAGAGGAAGG - Intronic
960619015 3:119621466-119621488 CATGATGGCCTGAGAGTGGCTGG - Intronic
961064646 3:123864980-123865002 CAGGAAAGCCAGCAAGGGGAGGG - Intronic
961491013 3:127257020-127257042 CAGGGTGGCCAGGGAGGAGGCGG - Intergenic
961831072 3:129623323-129623345 CAGGACGGCCACAGGAGGGAAGG + Intergenic
961986152 3:131137324-131137346 CAGGGTGGACAGGGAAGGGATGG + Intronic
962279164 3:134037368-134037390 CAGGTTGGCCAGGGTGGTGAAGG - Intronic
964081829 3:152768252-152768274 CAGCCTGTCCACAGAGGGGAGGG + Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
968065606 3:195757407-195757429 GAGGGTGGCCTGAGAGGGGTGGG - Intronic
968067129 3:195764886-195764908 GTGGAGGCCCAGAGAGGGGAAGG + Intronic
968073374 3:195801997-195802019 CAGGGTGGCCAGAGAGGGAGGGG - Intronic
968663124 4:1806979-1807001 CAGGATGGCCGGGGACGGCAGGG - Intronic
968805458 4:2768910-2768932 CAGGATGGCTAGAAACGGGCAGG + Intergenic
969098434 4:4751535-4751557 CAGCAGGGCCAGACAGGCGAAGG - Intergenic
969105862 4:4806679-4806701 CAGGAGGTAGAGAGAGGGGATGG + Intergenic
969393773 4:6907925-6907947 CAGGATGGCGAGTGAGGAAAAGG + Intergenic
969520363 4:7674656-7674678 CAGGCAGGGCAGTGAGGGGAAGG + Intronic
969934305 4:10666035-10666057 AAATATGGCCAGAGAGGAGAAGG + Intronic
971359154 4:25921137-25921159 CAGGAAGGCCAGGTACGGGAAGG + Intronic
972377864 4:38489764-38489786 CAGGAGGGCCAGGGAGGTGGAGG - Intergenic
972904226 4:43724726-43724748 TGGGATGGGGAGAGAGGGGAGGG + Intergenic
973585193 4:52383626-52383648 GAGGATGGGGAGTGAGGGGAGGG + Intergenic
975756985 4:77580768-77580790 GAGGAGGGCAGGAGAGGGGAAGG - Intronic
976197584 4:82548171-82548193 GAGGACTACCAGAGAGGGGAGGG + Intronic
976478323 4:85510532-85510554 AAGGAAGGCAAGAGAGGGAAAGG - Intronic
977744999 4:100535952-100535974 CAGCATGGCCACAGAGGGGTAGG + Intronic
978725345 4:111962875-111962897 AGGTATTGCCAGAGAGGGGAGGG - Intergenic
978964535 4:114725405-114725427 GAGGATGGCCAGAGAAGAAAAGG - Intergenic
979071851 4:116217822-116217844 AAGAATCACCAGAGAGGGGATGG + Intergenic
979190936 4:117857700-117857722 CAAGATGTACAGAGAAGGGATGG - Intergenic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
981658290 4:147137192-147137214 CAGGATGGCCACAGTGGGGATGG - Intergenic
981704880 4:147648417-147648439 GAGGGTGCCCAGAGAGGGCATGG + Intronic
983555470 4:169055573-169055595 CATGATGGCTAGTGAGGTGAAGG - Intergenic
983748316 4:171229901-171229923 CAGGATGGGGAGCAAGGGGAGGG + Intergenic
983904872 4:173171633-173171655 CAAGAGGCCCAGAGATGGGAAGG - Intronic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985525588 5:399814-399836 CCGGATGGCCACAGAGTGGGAGG - Intronic
985706304 5:1403313-1403335 CAGGATGGGATGGGAGGGGAGGG - Intronic
985706327 5:1403378-1403400 CAGGATGGGAGGGGAGGGGAGGG - Intronic
985706344 5:1403418-1403440 CAGGATGGGATGGGAGGGGAAGG - Intronic
985839572 5:2296075-2296097 TATGATGGGCAGAGAGGGGAAGG + Intergenic
986024492 5:3837898-3837920 CAGGCTGCCCAGACTGGGGAAGG + Intergenic
986099599 5:4595031-4595053 CTGGCTGACCAGAGAGGGCAGGG - Intergenic
986788545 5:11138533-11138555 CAGGTTGGGCAGGGAGAGGATGG - Intronic
987454427 5:18125332-18125354 CAGGATGGGGAGTGAGAGGAGGG + Intergenic
988616419 5:32779469-32779491 CGGGGTGGCCAGAGAACGGAGGG - Intronic
989116851 5:37963597-37963619 AAGGATGGACACAGAGGGAAAGG - Intergenic
989536736 5:42572854-42572876 CAGGATTGGCAGAGAGGTGGGGG + Intronic
989828968 5:45890954-45890976 GAGGATGGCCAGGCAGGGGCTGG - Intergenic
990013047 5:51023415-51023437 CAGGAAGGCCAGAAGGGAGAAGG - Intergenic
990566763 5:57037506-57037528 CTGCAAGGCCAGAGAAGGGAGGG + Intergenic
990914718 5:60891950-60891972 CAGCATTGCCAGAGAGGTGGAGG + Intronic
991502965 5:67295417-67295439 CAGGATGGCTGGCGAGGGGCGGG + Intergenic
991674040 5:69074935-69074957 GAGGATGGCCACAGATGGGCAGG - Intergenic
993065613 5:83094366-83094388 GAGGAGGGGAAGAGAGGGGAGGG - Intronic
993495091 5:88599960-88599982 CATGATGGCCAGGGCAGGGAAGG + Intergenic
997381771 5:133443637-133443659 CAGGCTGGCCTGAGAGGAGCTGG - Intronic
997415442 5:133724361-133724383 CAGGATGGTCATATAGGGAAAGG - Intergenic
997459895 5:134044899-134044921 CAGGATGGCCAGAGTTGAGGGGG - Intergenic
997781784 5:136667053-136667075 CAGGATGGGCTGAGAGCCGAGGG + Intergenic
998094788 5:139391058-139391080 AACAATGGCCAGAGAGGGGCTGG - Exonic
998169563 5:139864563-139864585 CAGGATGGTGGGAGAGGGGGCGG - Intronic
998261864 5:140637918-140637940 GAGGAAGGGAAGAGAGGGGAGGG - Intergenic
998380049 5:141717852-141717874 CAGTATGGCCAGGGTGGTGATGG + Intergenic
998671051 5:144354458-144354480 TAGGCTGGCCAGAGGGTGGAAGG - Intronic
999153530 5:149442245-149442267 CAGGCTGGGCAGCGAGGGGCTGG - Intergenic
999193080 5:149763148-149763170 CTGCAGGGCCAGAGTGGGGAGGG - Intronic
999200036 5:149809829-149809851 TAGGTAGGCCAGAGACGGGATGG + Intronic
999264095 5:150255335-150255357 CAGGACAGTCAGAGAGGGGCAGG + Intronic
999319350 5:150603795-150603817 GAGGTGGGCCAGAGAGGGCAAGG - Intronic
999481341 5:151950870-151950892 CAGGCTGGCCAAGGAGCGGAGGG - Intergenic
999713219 5:154337414-154337436 GAGGATAGCCAGAGAAGTGACGG - Intronic
1000222481 5:159227303-159227325 GTGGATGCCCAGAGAGGGCATGG - Intergenic
1001380667 5:171304488-171304510 GAGGATGGGCAGAGAGGTGAGGG + Intergenic
1002278211 5:178116400-178116422 CAGGAGGGGCACAGTGGGGACGG + Intronic
1002571191 5:180140215-180140237 AGGGATGCCCAGAGAGGGGCTGG + Intronic
1002907848 6:1465380-1465402 CAAGATGGCCAGATAGTGCAGGG + Intergenic
1002931199 6:1636552-1636574 CAGGACGGCCAGAGAGGTGTTGG - Intronic
1002956582 6:1871152-1871174 GGGGCTGGCCAGAAAGGGGAGGG + Intronic
1002959165 6:1897977-1897999 CAGGATGGCAAGGGAGGCCAGGG - Intronic
1002959175 6:1898008-1898030 CAGGATGGCAAGGGAGGCCAGGG - Intronic
1002959185 6:1898039-1898061 CAGGATGGCAAGGGAGGCCAGGG - Intronic
1002959195 6:1898070-1898092 CAGGATGGCAAGGGAGGCCAGGG - Intronic
1002959214 6:1898132-1898154 CAGGATGGCAAGGGAGGCCAGGG - Intronic
1003232458 6:4266955-4266977 AAGGAAGGACAAAGAGGGGAAGG + Intergenic
1004094784 6:12542325-12542347 CAGGATGGGAGGTGAGGGGAAGG - Intergenic
1005012444 6:21348672-21348694 CAAGACGGCCGGAGAGAGGAAGG - Intergenic
1005024219 6:21447457-21447479 GAGGATGGCAAAAGAGGAGAGGG - Intergenic
1005310428 6:24553832-24553854 TAGCATGCCCAGAGAGGGCATGG + Intronic
1005505957 6:26468964-26468986 CAGGACCACCAGAGAGGAGAGGG + Exonic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1007250168 6:40489955-40489977 CAGAAAGGCCAGAGAGGTCAAGG - Intronic
1007519266 6:42438910-42438932 CAGGATGGGAGGGGAGGGGAAGG + Intronic
1007627275 6:43253668-43253690 CAGGAAGCCCACAGAGTGGATGG - Exonic
1007662751 6:43496579-43496601 CAGGCTGTCCAGACAGAGGAGGG + Intronic
1007696414 6:43736872-43736894 CTGGAAGGCCACAGTGGGGAAGG - Intergenic
1007957882 6:45933746-45933768 CTGGGTGGACAGAGAGGGGCAGG + Intronic
1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG + Intronic
1008598744 6:53068087-53068109 CAGGGCGGCCAGGGGGGGGAGGG - Intronic
1008885822 6:56430967-56430989 CAGGATGGCCAGTGCGAGGCAGG + Intergenic
1009291262 6:61885855-61885877 AAGGAAGGCCATAGTGGGGAGGG - Intronic
1010041341 6:71388536-71388558 CAGGATCCCTAGAGAGTGGAAGG + Intergenic
1010552653 6:77242104-77242126 TAGGGTGGCTAGAGAGGGGGAGG + Intergenic
1010613919 6:77990493-77990515 CAGGAGAGCCGGAAAGGGGAGGG - Intergenic
1010974428 6:82296604-82296626 CAAGATGGCTAGAGAGGTTAGGG - Intergenic
1012239176 6:96852629-96852651 CAGTATTGCCAGAGAGAGAATGG - Intergenic
1013714143 6:112937549-112937571 CAAGAGGGAGAGAGAGGGGAAGG - Intergenic
1014097869 6:117480109-117480131 CTGGATGGCAAGTGGGGGGATGG + Intronic
1014758363 6:125327052-125327074 CAGAAGGACCAGAGGGGGGAAGG - Intergenic
1015159709 6:130138949-130138971 GAAGATGTCCAGAGAGAGGAAGG + Intronic
1015424258 6:133047430-133047452 TAGGAAGGCCAGAGACTGGAAGG + Intergenic
1015720397 6:136235487-136235509 CAGCATGGACAGAGAAGAGAGGG + Intronic
1015920793 6:138264654-138264676 CAGGGAGTCTAGAGAGGGGAGGG - Intronic
1015983409 6:138861978-138862000 CAGGATGGGGAAAGAGGGCATGG - Intronic
1017981189 6:159402170-159402192 CAGGAGAGCCAGAAAGGGGAGGG - Intergenic
1018076196 6:160215799-160215821 CACACTGGCCAGAGATGGGAAGG - Intronic
1018194001 6:161338849-161338871 GAGGAAGGCGAGAGAGTGGAGGG + Intergenic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1019268323 7:131558-131580 CAGGAGGGAAAGGGAGGGGAGGG + Intergenic
1019419582 7:944835-944857 CAGGGTGGGTAGAGTGGGGATGG - Intronic
1019594384 7:1851666-1851688 CAGGAGGTCCACACAGGGGAAGG + Intronic
1019603287 7:1895903-1895925 GAGGATGGGCAGTGAGGGGGCGG + Intronic
1019625244 7:2012599-2012621 GAGGATGGACAGAGGGGGCAGGG + Intronic
1019984857 7:4648226-4648248 CATGGTGTCCAGAGAGGGAAAGG - Intergenic
1020106132 7:5423198-5423220 CAGGAGGGCCGGAGCGGGGCTGG + Intronic
1023113499 7:36838013-36838035 CAGGGTGGGCAGAGATGGGGTGG - Intergenic
1023935095 7:44734192-44734214 AAGGATGGGAAGGGAGGGGAGGG - Intergenic
1025697880 7:63789610-63789632 CAGGCGGGCCAGCGCGGGGAGGG - Intergenic
1026815132 7:73505047-73505069 CAGGCTGGCAAGAGAGAAGAGGG - Intronic
1026906026 7:74063239-74063261 CAGGAGGGGCAGGGTGGGGAGGG + Intronic
1027443447 7:78245577-78245599 TAGGATGGCCCCAGAGAGGATGG + Intronic
1027782077 7:82532163-82532185 TAGAATCTCCAGAGAGGGGACGG - Intergenic
1028642087 7:93053808-93053830 GAGGAAGGAAAGAGAGGGGAGGG + Intergenic
1029792924 7:102864199-102864221 GAGCATGGCCAGAGAAGAGAGGG - Intronic
1030175812 7:106651883-106651905 CAGGATGGCAACTGTGGGGAAGG + Intergenic
1030338548 7:108351192-108351214 CAGAAGGGCAAGAGAGAGGAGGG - Intronic
1030945843 7:115718872-115718894 CAGGCTTTCCAGAGAAGGGATGG - Intergenic
1030998778 7:116390242-116390264 TAGGATGGCTTGTGAGGGGAGGG + Intronic
1032420948 7:131778635-131778657 CAGGATGGCCAGAGGGCCTAGGG - Intergenic
1033270637 7:139930034-139930056 GAGGCAGGCCAGAGAGGGCATGG - Intronic
1033825738 7:145187067-145187089 AAGGAGGGCAAGGGAGGGGAGGG - Intergenic
1034276718 7:149827069-149827091 CAGTGTGGACAGACAGGGGAGGG - Intergenic
1034296161 7:149974006-149974028 GATGATGGCCAGAGGGGGAAGGG + Intergenic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1034457950 7:151181561-151181583 CAGGATGACCAGTGATGGGCAGG - Intronic
1034717502 7:153256863-153256885 CAGGATGGCGAGGAAGGGGTAGG + Intergenic
1034809870 7:154122803-154122825 GATGATGGCCAGAGGGGGAAGGG - Intronic
1034943923 7:155249862-155249884 CAGCAAGGACAGGGAGGGGAAGG + Intergenic
1035235802 7:157497070-157497092 CAGGGTGGGCAGGGAGGGGCAGG - Intergenic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1036219289 8:6907786-6907808 GAGGAGGCCCAGAGAGGGGGAGG + Intergenic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1037289333 8:17334896-17334918 AAGGATGGAGAGAGAGGGGAGGG + Intronic
1037735638 8:21563782-21563804 GAGGCTGGCCATAGAGGAGATGG - Intergenic
1037951285 8:23019903-23019925 CAGGCAGGAGAGAGAGGGGAAGG + Intronic
1038660097 8:29489898-29489920 CAAGGGGGCCAGAGTGGGGAAGG - Intergenic
1039365586 8:36924933-36924955 CAGGATGGACAGGGAAGGGCTGG + Intronic
1039424847 8:37477354-37477376 AAGGATGGCTGGAGAGGGGAAGG - Intergenic
1039477067 8:37844668-37844690 CAGGGTGGCAAGAGAAGGGCAGG + Exonic
1039536932 8:38324908-38324930 TGGCATGGCCAGAGAGGGCATGG + Intronic
1039890746 8:41683781-41683803 CCCGCTGGCCAGAGAGGGGGCGG + Intronic
1040034786 8:42859535-42859557 CAGGATGGCCTGAGCTTGGAAGG + Intronic
1040986129 8:53296208-53296230 GAGGGTGGCCAGAGAGGGCATGG - Intergenic
1041104198 8:54425496-54425518 CAGGATGGACAGAGAAGGCTGGG - Intergenic
1042039589 8:64577961-64577983 TTGGATGGCCAGGGAGAGGAGGG + Intergenic
1042845873 8:73169190-73169212 GACGGTGGCCAGGGAGGGGATGG - Intergenic
1043011845 8:74890731-74890753 CAGGAGGGGAGGAGAGGGGAGGG - Intergenic
1044869094 8:96601051-96601073 TAGAATAGCCAGAGAGGTGAGGG + Intronic
1047024896 8:120813633-120813655 AAAGATGGCCAGAGCAGGGATGG + Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1049214020 8:141399457-141399479 CAGGGAGGCCACCGAGGGGAGGG - Intronic
1049362638 8:142219638-142219660 CAGGAAGGCAGGTGAGGGGAGGG - Intronic
1049424644 8:142532709-142532731 CAAGATGGCCATGGTGGGGAGGG - Intronic
1049514388 8:143045693-143045715 CAGGCTTGCCAGAGAGAGGAAGG + Intronic
1049623073 8:143607304-143607326 CAGGATGGCCTGTGAGGAGTAGG - Intronic
1050048939 9:1577514-1577536 CAGGGAGGCAAGAAAGGGGAGGG + Intergenic
1050371601 9:4927352-4927374 CAGGATTTGCAGAGACGGGAAGG - Intergenic
1051018349 9:12508983-12509005 CAGGAAGGAGAGAGAGAGGACGG - Intergenic
1051682633 9:19623286-19623308 CCAGAAGGCCAGACAGGGGAAGG - Intronic
1052087554 9:24286504-24286526 AAGGAGGGGAAGAGAGGGGAAGG - Intergenic
1052977367 9:34421179-34421201 CAAGCAGGTCAGAGAGGGGAAGG + Intronic
1053055446 9:34990870-34990892 CAGGAAGGCAATGGAGGGGATGG - Intronic
1053274112 9:36770557-36770579 CAGGCTGGGCAGAGGGGGAAGGG + Intergenic
1053469673 9:38337315-38337337 CAGGATAGCAAGAAAGGGGGTGG + Intergenic
1053481934 9:38422590-38422612 TGATATGGCCAGAGAGGGGAAGG + Intronic
1053567593 9:39269424-39269446 AAGGATGGAAGGAGAGGGGAAGG + Intronic
1053833605 9:42110373-42110395 AAGGATGGAAGGAGAGGGGAAGG + Intronic
1054129550 9:61349574-61349596 AAGGATGGAAGGAGAGGGGAAGG - Intergenic
1055914524 9:81387313-81387335 AGGGATGGACAGAGAGAGGAAGG + Intergenic
1056369619 9:85941171-85941193 CGGGCTGGGCTGAGAGGGGAGGG + Exonic
1056727793 9:89137018-89137040 CAGGATGGAGAGAGAGTGAAGGG + Intronic
1056792358 9:89634018-89634040 CAGACGGGCCAGAGATGGGAGGG + Intergenic
1056965912 9:91162814-91162836 CAGTATGGCAAGTGAGGAGAAGG - Intergenic
1057545769 9:96019846-96019868 CAGGGTGGTGAGAGAGAGGAAGG + Intergenic
1057802596 9:98199238-98199260 ACTGAGGGCCAGAGAGGGGAAGG + Exonic
1058999584 9:110334724-110334746 CAGGTTGGCCAGGGAGGGATGGG + Intronic
1059285691 9:113169680-113169702 CAGGATGGACACAGAAGGAAAGG - Exonic
1059406376 9:114100165-114100187 CAGGATGGCCAGGGTGGGGTGGG + Intergenic
1059447213 9:114345910-114345932 CGGGATGGAAAGAGAGGGGTGGG - Exonic
1059542404 9:115144034-115144056 CAGGAAGGGAAGAGAAGGGAAGG - Intronic
1059658553 9:116378707-116378729 AACGAGGGCCAGAGAGGGGATGG + Intronic
1059941737 9:119366703-119366725 CAGGTTGGCAAGATAGGGGTGGG + Intronic
1060038474 9:120279571-120279593 CAGGATGTTCAGAGAAGTGATGG + Intergenic
1060044006 9:120325752-120325774 AGGGATGGCCAGGGAAGGGAAGG + Intergenic
1060229190 9:121814454-121814476 AGGGAAGCCCAGAGAGGGGAGGG - Intergenic
1060413891 9:123417469-123417491 CAGGAGGCCCAGAGAGGTTAAGG + Intronic
1060495297 9:124113744-124113766 CAGGGCAGGCAGAGAGGGGAGGG + Intergenic
1060495405 9:124114884-124114906 CATGACGGCTAGAGAGGGGCAGG + Intergenic
1060793469 9:126500438-126500460 ATGGATGGGCAGAGAGGGAAGGG - Intronic
1060961792 9:127685988-127686010 AAGGATGGAAAGAGAGAGGAGGG - Intronic
1061043403 9:128152153-128152175 CAAGATGGCCAGTGAGTGGCTGG - Intronic
1061499451 9:130993642-130993664 CCTGAGGCCCAGAGAGGGGAAGG + Intergenic
1061680500 9:132240617-132240639 CTAGTTGCCCAGAGAGGGGAAGG + Intronic
1061702585 9:132427310-132427332 CTGGATGGCCAAGGAGGGAATGG - Intronic
1061995329 9:134180263-134180285 CAGGACGGCCAGAGGGGCGCGGG - Intergenic
1062203412 9:135321271-135321293 CAGGCAGGCCAGAGAGTGCAGGG + Intergenic
1062228237 9:135465871-135465893 CAGGAGGCCCAGTGAGGGAAGGG - Intergenic
1062261853 9:135666815-135666837 GGGGAGGGGCAGAGAGGGGAGGG - Intergenic
1062695524 9:137873930-137873952 CAGGTTGGCGAGGGAGGAGAGGG - Intergenic
1203782056 EBV:106121-106143 CAGGATGTCCCTAAAGGGGACGG + Intergenic
1203746854 Un_GL000218v1:44811-44833 CAGGCTGGGCACAGCGGGGAGGG + Intergenic
1203563254 Un_KI270744v1:74669-74691 CAGGCTGGGCACAGTGGGGAGGG - Intergenic
1185469722 X:375128-375150 GAGGATGGCTGGAGAAGGGAAGG - Intronic
1185488303 X:499654-499676 CAGAATGGCCAAAGAGGAGGCGG - Intergenic
1185581254 X:1212999-1213021 AAGGAAGGAAAGAGAGGGGAGGG - Intergenic
1190054779 X:47175211-47175233 CAGGAAGGGGAGAGAGGGGGCGG - Intronic
1190290217 X:48987618-48987640 ATGGATGGCCAGAGAGAAGAGGG + Intronic
1190714190 X:53090368-53090390 GAGGAGGCCCAGAGAGGGAAGGG - Intergenic
1190944249 X:55075317-55075339 AAGGTGGGCCACAGAGGGGAGGG + Intronic
1192177613 X:68895598-68895620 CAGGATGGCCAGAGAAGGAGGGG + Intergenic
1192509314 X:71712589-71712611 CAGGATGCCCACAGAGAGGGTGG - Intergenic
1192517383 X:71768964-71768986 CAGGATGCCCACAGAGAGGGTGG + Intergenic
1192586130 X:72319459-72319481 AAGGATGGCCACAGTGTGGAGGG + Intergenic
1193483805 X:82060553-82060575 CAGCATGGCAAGAGAGGGTGGGG - Intergenic
1195478401 X:105314781-105314803 CAGGATGGAGTGAGATGGGAGGG + Intronic
1195614797 X:106903610-106903632 TAGCAAGGCCTGAGAGGGGAAGG + Intronic
1195659110 X:107360999-107361021 CTGGATGGCAAGGGTGGGGAGGG - Intergenic
1196247396 X:113415758-113415780 CAGCTTGGCCACAGAGGGGTAGG + Intergenic
1196740838 X:119024437-119024459 CAGGAGGGCCTGAGGTGGGATGG + Intergenic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1199227693 X:145396643-145396665 CAGGGAAGCCATAGAGGGGATGG - Intergenic
1199701241 X:150377271-150377293 CGTGAGGCCCAGAGAGGGGAAGG - Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200044291 X:153392870-153392892 GGGCATGGCCAGAGAGGGGCGGG - Intergenic
1200058501 X:153473777-153473799 CAGGACGGGGAGGGAGGGGAGGG - Intronic
1200088591 X:153623957-153623979 CAGGAGAGACAGAGAGGAGAAGG + Intergenic
1200101178 X:153689658-153689680 TAGGAGGCCCAGAGAGGAGAAGG + Intronic
1200418405 Y:2936116-2936138 AAGGATGGGCTGTGAGGGGAAGG - Intronic
1200817456 Y:7548361-7548383 TGGGATGGCCAGAGAGAGGGAGG + Intergenic
1201160178 Y:11159825-11159847 CAGGCTGGGCACAGTGGGGAGGG + Intergenic
1201392600 Y:13514567-13514589 TGGGGTGGGCAGAGAGGGGAAGG - Intergenic