ID: 1083731299

View in Genome Browser
Species Human (GRCh38)
Location 11:64653957-64653979
Sequence GATGATGGGAAGAGGGCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 486}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083731282_1083731299 25 Left 1083731282 11:64653909-64653931 CCCCAAGAGGGCTCCAACCCTCC 0: 1
1: 0
2: 5
3: 26
4: 177
Right 1083731299 11:64653957-64653979 GATGATGGGAAGAGGGCTTGTGG 0: 1
1: 0
2: 2
3: 48
4: 486
1083731288_1083731299 8 Left 1083731288 11:64653926-64653948 CCCTCCCCAGAGCTGGAAGGCAG 0: 1
1: 0
2: 8
3: 57
4: 471
Right 1083731299 11:64653957-64653979 GATGATGGGAAGAGGGCTTGTGG 0: 1
1: 0
2: 2
3: 48
4: 486
1083731294_1083731299 2 Left 1083731294 11:64653932-64653954 CCAGAGCTGGAAGGCAGGGCAGT 0: 1
1: 1
2: 0
3: 54
4: 434
Right 1083731299 11:64653957-64653979 GATGATGGGAAGAGGGCTTGTGG 0: 1
1: 0
2: 2
3: 48
4: 486
1083731292_1083731299 4 Left 1083731292 11:64653930-64653952 CCCCAGAGCTGGAAGGCAGGGCA 0: 1
1: 0
2: 4
3: 79
4: 467
Right 1083731299 11:64653957-64653979 GATGATGGGAAGAGGGCTTGTGG 0: 1
1: 0
2: 2
3: 48
4: 486
1083731293_1083731299 3 Left 1083731293 11:64653931-64653953 CCCAGAGCTGGAAGGCAGGGCAG 0: 1
1: 0
2: 8
3: 56
4: 483
Right 1083731299 11:64653957-64653979 GATGATGGGAAGAGGGCTTGTGG 0: 1
1: 0
2: 2
3: 48
4: 486
1083731284_1083731299 23 Left 1083731284 11:64653911-64653933 CCAAGAGGGCTCCAACCCTCCCC 0: 1
1: 0
2: 2
3: 18
4: 281
Right 1083731299 11:64653957-64653979 GATGATGGGAAGAGGGCTTGTGG 0: 1
1: 0
2: 2
3: 48
4: 486
1083731283_1083731299 24 Left 1083731283 11:64653910-64653932 CCCAAGAGGGCTCCAACCCTCCC 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1083731299 11:64653957-64653979 GATGATGGGAAGAGGGCTTGTGG 0: 1
1: 0
2: 2
3: 48
4: 486
1083731289_1083731299 7 Left 1083731289 11:64653927-64653949 CCTCCCCAGAGCTGGAAGGCAGG 0: 1
1: 0
2: 6
3: 56
4: 347
Right 1083731299 11:64653957-64653979 GATGATGGGAAGAGGGCTTGTGG 0: 1
1: 0
2: 2
3: 48
4: 486
1083731280_1083731299 30 Left 1083731280 11:64653904-64653926 CCTGCCCCCAAGAGGGCTCCAAC 0: 1
1: 0
2: 3
3: 17
4: 246
Right 1083731299 11:64653957-64653979 GATGATGGGAAGAGGGCTTGTGG 0: 1
1: 0
2: 2
3: 48
4: 486
1083731286_1083731299 12 Left 1083731286 11:64653922-64653944 CCAACCCTCCCCAGAGCTGGAAG 0: 1
1: 0
2: 3
3: 55
4: 411
Right 1083731299 11:64653957-64653979 GATGATGGGAAGAGGGCTTGTGG 0: 1
1: 0
2: 2
3: 48
4: 486
1083731281_1083731299 26 Left 1083731281 11:64653908-64653930 CCCCCAAGAGGGCTCCAACCCTC 0: 1
1: 0
2: 3
3: 20
4: 149
Right 1083731299 11:64653957-64653979 GATGATGGGAAGAGGGCTTGTGG 0: 1
1: 0
2: 2
3: 48
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083731299 Original CRISPR GATGATGGGAAGAGGGCTTG TGG Intronic
901386591 1:8913526-8913548 GCTGATGGGAGGATTGCTTGAGG - Intergenic
901874245 1:12157871-12157893 GAGGATGAGAACAGGGATTGAGG + Intergenic
902051028 1:13563718-13563740 GAAGATGTGAAGAAGGCTTTGGG - Intergenic
902360798 1:15941635-15941657 CAAGATGGGATGAGGGCATGGGG + Intergenic
902372854 1:16016613-16016635 GTGGGAGGGAAGAGGGCTTGAGG + Intronic
902781926 1:18710506-18710528 GAAGATGGGGAGGGGGATTGTGG + Intronic
902855976 1:19205402-19205424 GATGAGGGGAAAGGAGCTTGTGG - Intronic
902956461 1:19927403-19927425 CATGTTGGGAAAAGGGCTTGTGG - Intergenic
902957052 1:19932690-19932712 ATTGTTGGGAAAAGGGCTTGTGG - Intergenic
903686326 1:25134961-25134983 GGGGATGGGGAGGGGGCTTGGGG - Intergenic
903919544 1:26789456-26789478 TATGATGGGAAGAATACTTGGGG + Intronic
904137671 1:28326435-28326457 CAAGATGGGAGGATGGCTTGAGG + Intergenic
904311579 1:29632774-29632796 GCTGAGGGGAAGAGGGGCTGGGG - Intergenic
904562762 1:31409846-31409868 GAGGATGGTAAGAGGGGATGGGG + Exonic
904866990 1:33587134-33587156 GATGGTGGGAGGAGGGCATTTGG + Exonic
905774653 1:40660780-40660802 AAAGGTGGGAAGAGGGGTTGGGG + Intronic
905831582 1:41073371-41073393 GATGATGTGAAGACATCTTGAGG - Intronic
905899782 1:41573907-41573929 GAGGAAGAGAAGAGGACTTGTGG + Intronic
905899867 1:41574420-41574442 AATGATGGGAAGGGGGCCAGGGG - Intronic
905973256 1:42156438-42156460 CATGATGGGAGGATTGCTTGAGG + Intergenic
906127004 1:43432832-43432854 GCTGATGGGAGGTGGGCTTAGGG + Intronic
906244707 1:44264785-44264807 AATGATGGCAGGAGGGCATGTGG - Intronic
907989798 1:59568661-59568683 GAGGAAGGGAAGAGGGCCTTAGG - Intronic
907996803 1:59641098-59641120 GAAGCTGGGAAGGGGGTTTGAGG + Intronic
908217040 1:61964554-61964576 TATGATGGGAGGATTGCTTGAGG + Intronic
908481359 1:64543321-64543343 CAAGGTGGGAAGATGGCTTGAGG + Intronic
909359729 1:74746252-74746274 GAAAAAGAGAAGAGGGCTTGAGG + Intronic
909436671 1:75650197-75650219 GAGGCTGGGAAGAGGGCTGAGGG - Intergenic
909957443 1:81797457-81797479 GTTGAAGGGAAGAGGTATTGAGG - Intronic
910657442 1:89633088-89633110 GCGGAGGGGAGGAGGGCTTGCGG + Exonic
911306456 1:96238391-96238413 GCTGATGTCAAAAGGGCTTGTGG - Intergenic
911326673 1:96476395-96476417 GATTCTTGGAAGAGTGCTTGGGG + Intergenic
912514392 1:110209156-110209178 GATGATGTAAAGAGATCTTGAGG - Intergenic
912893002 1:113555664-113555686 GATGGTGGGAGGATTGCTTGAGG + Intronic
914679042 1:149926249-149926271 GTTGATGGGAAGAGGACTGAGGG - Intronic
915091230 1:153427886-153427908 TAAGATGGGAAGAGGGATAGTGG - Intergenic
915093879 1:153445403-153445425 TAAGATGGGAAGAGGGATAGTGG + Intergenic
915366273 1:155318422-155318444 GGTGTTGGGAAGTGGGGTTGTGG + Intronic
916849992 1:168693992-168694014 GATGAGGGGAAGGGGGCTTGGGG + Intergenic
917686700 1:177423922-177423944 CATTATGGGAATTGGGCTTGGGG - Intergenic
917730949 1:177874329-177874351 GTGGATGGGAGGAGAGCTTGGGG - Intergenic
918065976 1:181101988-181102010 GGTGTGGGGAGGAGGGCTTGAGG + Intergenic
920075386 1:203332635-203332657 CAAGATGGGAGGAAGGCTTGAGG + Intergenic
920093932 1:203473602-203473624 GATGATGGGTAGAGTGTCTGTGG - Intergenic
920225770 1:204437897-204437919 GAGGAAGGGAAGAGGGCTAGAGG + Intronic
920329860 1:205199138-205199160 GATGATGGGAGTAGGACTTGAGG - Intronic
920585748 1:207158209-207158231 CATTCTGGGAAGAGGGCCTGGGG + Intergenic
920664085 1:207947366-207947388 GATTATGGGAGAAGGGCTCGAGG - Intergenic
920914953 1:210251955-210251977 GCGGAAGGGAAGAGGGCTGGCGG - Intergenic
921228618 1:213046140-213046162 GGTGTTGGGAAAAGGGCTTGTGG - Intergenic
921908306 1:220519275-220519297 GATGGTTGGGAGAGAGCTTGTGG - Intergenic
921958219 1:221006117-221006139 GAAGATGGGAAGACAGCTTGAGG - Intergenic
923384841 1:233455568-233455590 GAAGATGGGAAGATTGCTGGAGG + Intergenic
923401502 1:233619507-233619529 GAAGATGGGAAGAGGCAGTGGGG + Intronic
924369377 1:243332070-243332092 GAAGAGGGGAAGAGGGTTTCAGG + Intronic
924527713 1:244867160-244867182 CGAGATGGGAAGATGGCTTGAGG + Intergenic
924601671 1:245495289-245495311 GAAGAGGGGAAGAGGGAATGAGG + Intronic
1063011655 10:2027428-2027450 GATGATGGTGGGAGGGCTTGGGG + Intergenic
1064657682 10:17572195-17572217 GATGAAGTGAAGATTGCTTGAGG - Intergenic
1066371735 10:34823350-34823372 CATGGTGGGATGATGGCTTGAGG - Intergenic
1067521739 10:47012921-47012943 CATGATGGGAAGTGGGATTGTGG + Intergenic
1067582382 10:47453876-47453898 GGTGATGGGAAGATGGTGTGGGG - Intergenic
1070640505 10:78165471-78165493 GATGGTGAGAAGAGGTATTGGGG - Intergenic
1071487236 10:86110402-86110424 GAAGAGGGGAAGATGGCTTGGGG + Intronic
1072093674 10:92154974-92154996 GGAGATGGGCAGATGGCTTGAGG + Intronic
1072124630 10:92434552-92434574 CAGGATGGGAGGATGGCTTGAGG + Intergenic
1072366198 10:94712355-94712377 GCTGATTGCCAGAGGGCTTGGGG - Intronic
1072450054 10:95532487-95532509 CATGATGAGAAGAGAGCTGGTGG + Intronic
1072874811 10:99160981-99161003 CAGGGTGGGAAGATGGCTTGAGG + Intronic
1073300585 10:102468959-102468981 GAGGATGGGAAGACCGCCTGTGG + Exonic
1073389974 10:103166883-103166905 CGAGATGGGAAGATGGCTTGAGG - Intronic
1073798234 10:107012242-107012264 AAAGATGGGAAGAGGGTGTGAGG - Intronic
1073851165 10:107619835-107619857 GATGCTGGGAAGTTGTCTTGGGG + Intergenic
1075023437 10:118967475-118967497 GGTGGTGGGGAGGGGGCTTGAGG - Intergenic
1075349798 10:121713568-121713590 GATGATGGAAAGAGGACAGGAGG - Intergenic
1075959231 10:126552980-126553002 TATGATGGGAAGCAGGGTTGAGG - Intronic
1077036559 11:498288-498310 TTTGATGGGAACAGTGCTTGGGG - Intronic
1077175059 11:1185497-1185519 GGTCGTGGGAACAGGGCTTGGGG - Intronic
1077175356 11:1187345-1187367 GGTGGTGGGAACAGGGCTTGGGG - Intronic
1078991719 11:16654520-16654542 TGAGATGGGAAGAGTGCTTGAGG - Intronic
1079799298 11:24849275-24849297 GTTGATAGGTAGAGGGCTAGGGG - Intronic
1080040533 11:27754957-27754979 GATGTTGGCCAGAGGACTTGTGG - Intergenic
1080517960 11:33040671-33040693 GATGATGGAAAGATGCGTTGGGG - Intronic
1080649331 11:34209822-34209844 GAGGATGGGGTGAGGGGTTGGGG + Intronic
1081709480 11:45207760-45207782 GAAGATGGGAAGAAGGCTGGGGG - Intronic
1082188510 11:49213043-49213065 GGGGATGTGATGAGGGCTTGTGG - Intergenic
1083299383 11:61732363-61732385 AAAGATGGGAAGGGGGCATGAGG - Intronic
1083426478 11:62590258-62590280 CAAGATGGGAAGATCGCTTGAGG + Intronic
1083656630 11:64232886-64232908 GGTGATGGGCAGAGGGCAGGAGG + Intronic
1083661637 11:64254190-64254212 GAGGCTGGGAAGAGGCTTTGAGG + Intronic
1083667109 11:64281608-64281630 GATGATGGGAAGAGAGTTCCAGG - Intronic
1083731299 11:64653957-64653979 GATGATGGGAAGAGGGCTTGTGG + Intronic
1084267295 11:68011670-68011692 CATGGTGGGTAGAGGGCCTGGGG - Intronic
1084767013 11:71318551-71318573 CAAGATGGGAGGATGGCTTGAGG - Intergenic
1085309727 11:75509073-75509095 GCTGGTGGGCATAGGGCTTGAGG - Intronic
1085331450 11:75655320-75655342 GAAGATGGGAGGAGGGCAGGGGG + Intronic
1085810168 11:79672779-79672801 TATGATGTGATGAGGGCCTGAGG + Intergenic
1086472540 11:87130732-87130754 CAAGATAGGAAGAGCGCTTGAGG - Intronic
1086678010 11:89633653-89633675 GGGGATGTGATGAGGGCTTGTGG + Intergenic
1087398384 11:97632707-97632729 GAAGATGGGAGGATTGCTTGAGG - Intergenic
1088161964 11:106882912-106882934 AATGATGGGATGAGGAATTGGGG - Intronic
1088345944 11:108825230-108825252 GGTGTTGGAATGAGGGCTTGAGG + Intronic
1089061862 11:115632269-115632291 GAGGAATGGGAGAGGGCTTGGGG + Intergenic
1089227333 11:116936521-116936543 GATGATGGTAATAGGGATTCAGG - Intronic
1089403035 11:118175822-118175844 GTAGGTGGGAAGCGGGCTTGGGG - Intronic
1089519738 11:119055997-119056019 CATGATGGGAATTGAGCTTGGGG - Intronic
1089685058 11:120141514-120141536 GGTGGTGGGACGAGGGCTTGGGG - Intronic
1090785216 11:130042577-130042599 GATGCTGGGGATAGGGGTTGGGG + Intergenic
1091047380 11:132336739-132336761 GATGAGGGAAAGGGGGATTGGGG + Intronic
1091178758 11:133584222-133584244 GAGGATGTGAACAGTGCTTGTGG - Intergenic
1091726194 12:2848312-2848334 GGTGATGGGAAGGTGGCTGGAGG - Intronic
1091786214 12:3244725-3244747 GGTAATGGGGAGAGGGTTTGTGG + Intronic
1092172459 12:6382709-6382731 GGTGATGGGAAGTGTGCATGGGG - Intronic
1092860483 12:12716037-12716059 GATGATGGGTACCGGGCATGGGG + Intronic
1092871622 12:12810825-12810847 TATGTTGGGAAAAGGGCTTGTGG - Intronic
1093055550 12:14552666-14552688 AAAGATGGGAGGATGGCTTGAGG + Intronic
1095592322 12:43917158-43917180 CATGGTGGGAAGATTGCTTGAGG + Intronic
1095792744 12:46185386-46185408 GGTGATGGTGATAGGGCTTGTGG - Intronic
1096682905 12:53268684-53268706 GAGGAAGGGAAGAGGGCTGAAGG - Intronic
1097968306 12:65604731-65604753 CATAATTGAAAGAGGGCTTGTGG - Intergenic
1098364413 12:69687398-69687420 TATGGTGGGAAGATTGCTTGAGG + Intronic
1099586522 12:84523931-84523953 GATGATGTGAAGGGGGTTTCTGG - Intergenic
1099822533 12:87730861-87730883 GATTATGGGAAGATTTCTTGGGG - Intergenic
1099855475 12:88159426-88159448 CATGGTGGGAGGATGGCTTGAGG + Intronic
1100283239 12:93138652-93138674 CATGATGAAAAGAGGGCTTTTGG - Intergenic
1100552183 12:95655430-95655452 GATGATGGGATGATGGGATGTGG + Intergenic
1102012147 12:109625449-109625471 GATCCTGAGAAGAGGACTTGCGG + Intergenic
1102034380 12:109762496-109762518 GATGGTGGGGAGGGGGCCTGCGG - Intronic
1102699659 12:114827783-114827805 GATGTTGGGAAGAGTGTTGGTGG + Intergenic
1103039553 12:117684091-117684113 GGTGATGGGAAGTGGGATTCAGG - Intronic
1103051213 12:117781446-117781468 GATGATGGGGAGAGGGAAGGGGG + Intronic
1103279226 12:119741348-119741370 GATGATGGGAAGGGGACATGAGG + Intronic
1103478024 12:121232807-121232829 GAAGGTGGGAGGAGGGCTGGGGG - Intronic
1103993765 12:124816076-124816098 CATGGTGGGAAGAGGCCCTGGGG - Intronic
1104626408 12:130359435-130359457 GGTTATGGGAACAGGGCATGGGG - Intronic
1105408290 13:20149740-20149762 GAAGGTGGGAACAGGGGTTGTGG + Intronic
1105638905 13:22242371-22242393 GCTGAGGGGAAAAGGGCTTCAGG - Intergenic
1105741652 13:23330999-23331021 GATGTTTGGAAGAAGTCTTGTGG + Exonic
1107878646 13:44813772-44813794 TATTATGGGAAGAGGACTGGGGG + Intergenic
1107991224 13:45820627-45820649 GGTGGTGGGAGGAGGGCTGGAGG - Intronic
1108227752 13:48306170-48306192 CAAGATGGGAAGATTGCTTGAGG + Intronic
1108255369 13:48604581-48604603 GAGGCTGGGAAGAGTACTTGGGG - Intergenic
1108926343 13:55751171-55751193 CAAGATGGGAGGAGTGCTTGAGG - Intergenic
1111691094 13:91564177-91564199 GATGATGGTAAGGGGGCAGGTGG - Intronic
1113660875 13:112105608-112105630 GGTGAGGGGAGGAGGGCCTGTGG + Intergenic
1114327011 14:21599729-21599751 GAGGCTGGGAGGAGAGCTTGAGG - Intergenic
1114614031 14:24059007-24059029 AATGATGGGATGAGGGTCTGTGG - Intronic
1116325638 14:43531106-43531128 GAAGATGGGAGGATTGCTTGAGG + Intergenic
1118477729 14:66133849-66133871 GCTTATTGGAAGAGGGGTTGAGG - Intergenic
1118890585 14:69905145-69905167 GATGATGGGAAGAGGTGCTATGG + Intronic
1119054908 14:71409265-71409287 GATGATGGGATGTGGGTGTGGGG + Intronic
1119125989 14:72126892-72126914 GATGATGGGATGTGGAGTTGGGG - Intronic
1119369556 14:74127807-74127829 CAAGATGGGAAGAGTGCTTGAGG - Intronic
1121222913 14:92299802-92299824 GATGATGGGAGGATCGCTTAAGG + Intergenic
1121222971 14:92300232-92300254 GCTGATTGGAAGAGGGCTTAGGG - Intergenic
1121485716 14:94312840-94312862 GAGGAGGGGAAGGGGGCATGAGG + Intronic
1121537270 14:94699528-94699550 CAGGATGGGAAGGGGGCTCGCGG - Intergenic
1121917222 14:97846340-97846362 GATGATGGGAGTAGTGGTTGTGG + Intergenic
1122180931 14:99954074-99954096 GATGAGAGGAAGAGGGTTGGGGG - Intergenic
1122544439 14:102514440-102514462 GATGGTGGGGAGGGGGCTGGAGG + Intergenic
1126301904 15:47206798-47206820 GATGGTGGGGAGAGGGCTGCAGG - Intronic
1126337431 15:47602488-47602510 AATGCTGGGAGGGGGGCTTGTGG + Intronic
1126371400 15:47950911-47950933 GAAGATGGGAAGTGGGGATGGGG - Intergenic
1127326672 15:57902429-57902451 CAAGATGGGAAGATTGCTTGAGG + Intergenic
1127733177 15:61818710-61818732 ATTGATTGGAAGAGGGCATGAGG - Intergenic
1127995830 15:64152571-64152593 GCTGGGGCGAAGAGGGCTTGAGG + Intronic
1128326314 15:66726215-66726237 GATGTTGGGAATGAGGCTTGGGG + Intronic
1129069616 15:72939748-72939770 CAGGGTGGGGAGAGGGCTTGGGG + Intergenic
1129137273 15:73565696-73565718 GATGAGAGGAAGAGGACTGGGGG + Intronic
1129331474 15:74830100-74830122 GAAGAGGGGAAGAGGGGGTGGGG - Intronic
1130096736 15:80861628-80861650 GGTGATGGGAAGAGGGCAGGGGG + Intronic
1130136215 15:81184030-81184052 GATGAAGAAAAGAGTGCTTGAGG + Intronic
1132303527 15:100791097-100791119 GCTGAGGGGAAGAGGGAATGTGG + Intergenic
1132955947 16:2593608-2593630 GAGGATGGGGAGAGGCCGTGGGG + Intronic
1133639825 16:7705993-7706015 AATGATGGGAAGAGGTCTTACGG - Intronic
1134435995 16:14257582-14257604 GATGAGGGGATGAGGGGATGAGG + Intronic
1135564302 16:23499922-23499944 CACGATGGGAACAGGGCATGTGG + Intronic
1135591053 16:23705544-23705566 AATGATGGAATCAGGGCTTGAGG + Intronic
1136450287 16:30350938-30350960 GAAGATGGCAAGAAGGCCTGGGG - Exonic
1136591225 16:31218968-31218990 GGGGATGGGAAGATGGCTGGAGG + Intronic
1138310971 16:56023706-56023728 GGAGGTGGCAAGAGGGCTTGGGG - Intergenic
1139136576 16:64212020-64212042 GATGAGAGAAAGAGGGCTTGTGG + Intergenic
1140183100 16:72740222-72740244 CAAGATGGGAAGATGGCTTGAGG + Intergenic
1140228237 16:73096091-73096113 GGTGCTGGGAGGAGGGCTAGTGG - Intergenic
1140285836 16:73601928-73601950 GAGGAAGGGGAGTGGGCTTGGGG + Intergenic
1140724052 16:77796273-77796295 GATGATGGGCAAAGGGAATGGGG + Intronic
1140966335 16:79969724-79969746 TATTATGGGAACAGGCCTTGGGG - Intergenic
1142784965 17:2214035-2214057 GATGATGGGGAGAGGACCGGGGG + Intronic
1143621384 17:8082290-8082312 GGTATTGGGAAAAGGGCTTGTGG + Intronic
1143622559 17:8089054-8089076 GAAGCTAGGAAGAGGGCTGGAGG + Intergenic
1143881711 17:10035077-10035099 GCTCTTGGGAAGAGGGCGTGTGG - Intronic
1144452741 17:15394731-15394753 GGAGATGGAAAGAAGGCTTGTGG - Intergenic
1144748489 17:17632062-17632084 GAAGAGGAGAAGAGGGCTGGAGG + Intergenic
1145081674 17:19899347-19899369 TGAGATGGGAAGAGTGCTTGAGG + Intergenic
1145783313 17:27577967-27577989 GAAGACGGGGAGAGGGCTGGGGG - Intronic
1145785445 17:27590894-27590916 GGTGATGGGAAGAGGAGTGGGGG + Exonic
1146725080 17:35149838-35149860 CAAGGTGGGAAGAGAGCTTGGGG - Intronic
1146974532 17:37099476-37099498 GCTGATGGGAGGAGGGCTGATGG + Intronic
1146974545 17:37099521-37099543 GCTGATGGGAGGAGGGCTGATGG + Intronic
1146974582 17:37099641-37099663 GCTGATGGGAGGAGGGCTGATGG + Intronic
1146974590 17:37099671-37099693 GCTGATGGCAAGAGGGCTGATGG + Intronic
1146974596 17:37099686-37099708 GCTGATGGGAGGAGGGCTGAGGG + Intronic
1147236432 17:39061142-39061164 CAAGATGGGAGGATGGCTTGAGG - Intergenic
1147766819 17:42842424-42842446 GATGAGAAGCAGAGGGCTTGGGG + Exonic
1147817609 17:43221364-43221386 GATGAGAGGAAGAGGGCAGGAGG - Intergenic
1148244192 17:46019777-46019799 GAAGGTGGGCAGATGGCTTGAGG + Intronic
1148334089 17:46830130-46830152 GATGAGGGGAGGAAGGCTTTTGG - Intronic
1148386950 17:47240997-47241019 GCTGAGGGGAAGTGGGGTTGGGG + Intergenic
1149346285 17:55739542-55739564 CAAGATGGGAGGATGGCTTGAGG + Intergenic
1149657602 17:58318460-58318482 GAAGATGGCACGTGGGCTTGGGG + Intronic
1151302538 17:73237993-73238015 GATGAGGCGAGAAGGGCTTGGGG + Intronic
1151509626 17:74550270-74550292 AATGATCAGAAGAGGGTTTGTGG - Intergenic
1151555901 17:74846625-74846647 GGTGGAGGGAAGAGGTCTTGGGG - Intronic
1151951945 17:77359559-77359581 GAGGGTGGGAAGATTGCTTGGGG + Intronic
1152072992 17:78143380-78143402 GATGATGGGGAGTGGACCTGGGG + Intergenic
1153129358 18:1836826-1836848 GATGATGGGAAGTGGGGATGGGG + Intergenic
1153979308 18:10295700-10295722 GATGCTGGGAAGAGGGGAGGCGG + Intergenic
1154981263 18:21504301-21504323 CAAGGTGGGAAGATGGCTTGAGG + Intronic
1155194097 18:23456623-23456645 CATGGTGGGAAGACTGCTTGAGG - Intronic
1156782240 18:40864513-40864535 GATGATGGGAATAAGGCTGGAGG - Intergenic
1158436256 18:57436972-57436994 GCTGCTGGGAAGAGGGCTCCGGG + Intronic
1161346671 19:3771774-3771796 GATGGTGGGGAGACGGCTGGGGG + Exonic
1161898604 19:7100954-7100976 TCTGTTGGGAAAAGGGCTTGTGG - Intergenic
1162224686 19:9210842-9210864 GATGTTGGGCTGAGAGCTTGTGG + Intergenic
1162305952 19:9873881-9873903 CAAGATGGGAAGATCGCTTGAGG - Intronic
1162310932 19:9906875-9906897 GATGATTGCAAGAGTGATTGGGG - Intronic
1162583203 19:11543006-11543028 GATGCTGGGAAGAAGGGGTGTGG + Intronic
1162967631 19:14163586-14163608 GGTGATGGGAAGGGGGTTTCCGG + Intronic
1162999234 19:14355792-14355814 AATGAGGGGAAGAGAGCTGGAGG + Intergenic
1163064899 19:14785560-14785582 AATGAGGGGAAGAGAGCTGGAGG - Intergenic
1164441261 19:28282359-28282381 GATGGTGGGAAGAGAGAATGGGG - Intergenic
1164611347 19:29634576-29634598 GATGCTGGGGAGAGTGCCTGAGG + Intergenic
1164760323 19:30723639-30723661 GAGCATGGGAATAGTGCTTGTGG + Intergenic
1165258671 19:34595698-34595720 GGTGCTGGGAAAAGGGCTTGTGG - Exonic
1165556493 19:36637070-36637092 ACTGTTGGGAAAAGGGCTTGTGG - Intergenic
1166061381 19:40327823-40327845 CATGATGGGAAGGAGGCTGGAGG + Intronic
1166215402 19:41331323-41331345 GGAGATGGGAAGAGGGGATGCGG - Intronic
1166281277 19:41795847-41795869 TATGGTGGGAGGATGGCTTGAGG - Intergenic
1166619522 19:44283746-44283768 AGTGCTGGGAAAAGGGCTTGTGG - Intronic
1167080088 19:47272216-47272238 GCTGAGGGGCAGAGGGCTTGGGG + Intergenic
1167663059 19:50807702-50807724 GATGAAGCTAAAAGGGCTTGGGG + Intergenic
1167676326 19:50888196-50888218 GATGAAGGACAGAGTGCTTGTGG + Intergenic
1167874011 19:52396685-52396707 GCAGATGGGAAGACTGCTTGAGG + Intergenic
926172934 2:10564635-10564657 GATCATAGGGAGAGGGCTGGCGG - Intergenic
926684559 2:15689141-15689163 GATGCTGAGAAGAGGACCTGGGG - Intergenic
927246678 2:20962250-20962272 GAAGATGGGAAGAGTGAATGGGG - Intergenic
927357761 2:22192954-22192976 GTTGATGAGTAGAAGGCTTGAGG - Intergenic
927630186 2:24766553-24766575 GATGAGGAGAAGAGGACTAGGGG + Intronic
927787968 2:25987139-25987161 CAAGGTGGGAAGATGGCTTGAGG + Intergenic
927948995 2:27154904-27154926 GATGAAGGGAAATTGGCTTGGGG + Exonic
931223912 2:60312924-60312946 GGTGGTGGGGAGAGGACTTGTGG - Intergenic
931676608 2:64702658-64702680 GATTCTGGGTGGAGGGCTTGCGG + Intronic
932423736 2:71616038-71616060 GATGCTGGTAAGAAGGCTTTGGG - Intronic
932634781 2:73378600-73378622 GAAGAGGGGAAGGGTGCTTGGGG + Intergenic
932663828 2:73680310-73680332 GATGGTGGGGAGTGGGCATGGGG + Intergenic
932759260 2:74428790-74428812 GATGGTGAGAAGAGGGGCTGTGG - Intronic
932848078 2:75155290-75155312 GATGATGCTAAGTGAGCTTGAGG - Intronic
933408381 2:81892636-81892658 GAAGATGGGAACAGTGCTGGAGG - Intergenic
933763373 2:85690705-85690727 CAAGGTGGGAAGATGGCTTGAGG - Intronic
933835897 2:86245198-86245220 ACTGTTGGGAAAAGGGCTTGTGG + Intronic
934069486 2:88370880-88370902 GATGATGGGAAGGGAGTTTGGGG - Intergenic
934653063 2:96103368-96103390 CATGAAAGGCAGAGGGCTTGGGG + Intergenic
937915322 2:127096102-127096124 GATGAGGGGCACAGGGCTGGGGG - Intronic
939171862 2:138705194-138705216 CATGATGGGAAGATTGCTTGAGG - Intronic
939632932 2:144547200-144547222 GAGAATGGGAAGTGGGCTAGGGG - Intergenic
940637931 2:156320607-156320629 TATGCTGGGAGGAGGGGTTGGGG + Intergenic
940642199 2:156356986-156357008 CAAGGTGGGAAGATGGCTTGAGG + Intergenic
942097196 2:172544711-172544733 GTTGAGGGGTGGAGGGCTTGGGG + Intergenic
942227922 2:173832758-173832780 GATCATAGGGAGAGGGCTTAAGG - Intergenic
942955677 2:181770272-181770294 GTTGATGGCAAGAGGCCTTTAGG + Intergenic
943334243 2:186594521-186594543 AATGATGGGCAGAGGGATGGGGG - Intronic
944215361 2:197249036-197249058 TGAGATGGGAAGATGGCTTGAGG + Intronic
944580568 2:201129119-201129141 GATGTTGTGAAAAGGGCTTGGGG + Intronic
944761705 2:202822394-202822416 TAAGGTGGGAAGATGGCTTGAGG - Intronic
945067440 2:205959011-205959033 CATGAGGGGAAGAGGGACTGGGG + Intergenic
946254522 2:218433028-218433050 GGTGGTGGGAGCAGGGCTTGAGG + Intronic
947239538 2:227979088-227979110 GATTATGGCAAGCGGGGTTGGGG - Intergenic
947746623 2:232511378-232511400 GATGTTGGCAAGAGGGGTGGGGG - Intergenic
948032809 2:234833394-234833416 TAAGGTGGGAAGATGGCTTGAGG - Intergenic
948822306 2:240556179-240556201 ATTGTTGGGAAAAGGGCTTGTGG + Intronic
948822310 2:240556194-240556216 GCTTGTGGGAAAAGGGCTTGTGG + Intronic
948856265 2:240732002-240732024 GATGACGGGAGGAGGGAATGAGG + Intronic
948856317 2:240732130-240732152 GAGGAGGGGATGAGGGATTGGGG + Intronic
1168843927 20:929171-929193 CATGATGGGAAGAGGGACTGGGG - Intergenic
1169412657 20:5385336-5385358 CAAGATGGGAAGATAGCTTGAGG + Intergenic
1169813804 20:9635459-9635481 CATGATGGGGAGAGGGGTGGGGG - Intronic
1169865692 20:10197520-10197542 TATGTTGGGAAGATTGCTTGAGG - Intergenic
1169906731 20:10612090-10612112 GATGTTGGGAAAAGGACTTTGGG + Intronic
1169966405 20:11222776-11222798 GAGGATGGGAGGATGGATTGAGG - Intergenic
1170333991 20:15248257-15248279 GATGCAGGGAGGACGGCTTGAGG - Intronic
1171982036 20:31635054-31635076 GATGAATGGGAGAGGGCTGGGGG - Intergenic
1172022622 20:31925110-31925132 GATGGGGGGAAGAGGCCTGGGGG + Intronic
1172773327 20:37393826-37393848 GATGGTGGGCACCGGGCTTGTGG + Intronic
1172923446 20:38507793-38507815 GAAGATGGGAGGATTGCTTGAGG - Intronic
1175067921 20:56305821-56305843 GATAATGGGAAATGGGCTTGAGG + Intergenic
1175384570 20:58586027-58586049 GCTGAACAGAAGAGGGCTTGTGG + Intergenic
1175468474 20:59208894-59208916 GGTGCTGGGAAGAGAGCTGGTGG - Intronic
1175537171 20:59722716-59722738 CATGATGGGGAGTGGGCTTGAGG + Intronic
1176186838 20:63784868-63784890 GATGATGCACAGAGGGGTTGGGG + Intronic
1176201610 20:63863311-63863333 GATGATGGGAACGGGGCTGTGGG + Intergenic
1176298000 21:5084655-5084677 GAGGCTGGGAGGAGGGGTTGAGG - Intergenic
1176382315 21:6119590-6119612 CCTGGTGGGAAGAGGGCTCGAGG - Intronic
1177194750 21:17892053-17892075 GATTTTTGTAAGAGGGCTTGTGG + Intergenic
1177385850 21:20408504-20408526 CATGATGGGAAGGGGGGTTGAGG + Intergenic
1177741395 21:25158472-25158494 GAGGAGGGGAAGAGGGGTGGAGG + Intergenic
1177842534 21:26250508-26250530 AATGATGGTAAGAAGGCTTCAGG + Intergenic
1179458902 21:41520451-41520473 AATGATGATTAGAGGGCTTGAGG - Intronic
1179741157 21:43418649-43418671 CCTGGTGGGAAGAGGGCTCGAGG + Intronic
1179780646 21:43698518-43698540 AGTGTTGGGAAAAGGGCTTGTGG + Intergenic
1179787587 21:43738446-43738468 ATTGTTGGGAAAAGGGCTTGTGG + Intronic
1179859029 21:44177294-44177316 GAGGCTGGGAGGAGGGGTTGAGG + Intergenic
1179946760 21:44683431-44683453 CAAGATGGGAAGATTGCTTGAGG + Intronic
1180952792 22:19728326-19728348 GATGGCAGGAAGAGGGTTTGGGG - Intergenic
1181069510 22:20323800-20323822 CAAGATGGGCAGATGGCTTGAGG + Intergenic
1181380379 22:22497569-22497591 AATGATGTAAAGAGGGGTTGTGG + Intronic
1181956804 22:26593172-26593194 GATGCTGGGAAGATAGGTTGGGG - Intronic
1182861958 22:33568068-33568090 GAGGAGGGGAAGAGTACTTGGGG + Intronic
1182995125 22:34805058-34805080 GTTTGTGGTAAGAGGGCTTGAGG + Intergenic
1183036107 22:35142142-35142164 CATGGTGGGGAGAGGGTTTGAGG + Intergenic
1183306927 22:37087596-37087618 GAAGAAGGGACGAGGGCCTGGGG - Intronic
1183487466 22:38097288-38097310 GGTGATGGGGGGTGGGCTTGGGG - Intronic
1183659182 22:39208332-39208354 GATGAGGGGATGAGGGCACGTGG + Intergenic
1184300483 22:43555907-43555929 TGTGCTGGCAAGAGGGCTTGTGG + Intronic
1184514109 22:44950694-44950716 TATTATGCAAAGAGGGCTTGGGG + Intronic
1184548269 22:45188739-45188761 ACTGTTGGGAAAAGGGCTTGTGG + Intergenic
949895009 3:8762191-8762213 GAGGAGGGGAAGAGGGGTTGTGG - Intronic
949923522 3:9022796-9022818 AACGATGGGAAGAGGGAGTGAGG + Intronic
949992096 3:9588051-9588073 CATGATGGGAGGATTGCTTGAGG - Intergenic
950676300 3:14556232-14556254 TTTGGTGGGAAGAGGACTTGAGG - Intergenic
950891555 3:16409004-16409026 TAGGAAGGGAAGGGGGCTTGCGG + Intronic
951380446 3:21977584-21977606 CATAGTGGGAAGAGTGCTTGAGG + Intronic
952541562 3:34372878-34372900 GAAGATGGAAAGGGGGCTAGAGG + Intergenic
952726504 3:36591991-36592013 GATGTTAGGAAGTGGGCTTTTGG - Intergenic
952815844 3:37447096-37447118 CAAGATGGGAAGATTGCTTGAGG - Intergenic
952839221 3:37630288-37630310 GATGATGGGAAAGAGGCTTTGGG - Intronic
953316962 3:41937138-41937160 GATGAAGGGAAGAGGTATTTGGG + Intronic
954654597 3:52186273-52186295 GCTGGTGGGAAGGGGGCATGGGG - Intergenic
954861743 3:53696198-53696220 GATGGTGGGAGGATTGCTTGAGG - Intronic
955298619 3:57756636-57756658 GAGGTTGGGGAGAGGCCTTGAGG - Exonic
955355653 3:58229990-58230012 AATGACTGGAAGGGGGCTTGAGG - Intergenic
955419729 3:58724278-58724300 AGTGTTGGGAAAAGGGCTTGTGG + Intronic
955508240 3:59653455-59653477 CAAGGTGGGAAGACGGCTTGAGG - Intergenic
957144484 3:76405771-76405793 GCTGATGGGAATGGGGGTTGGGG + Intronic
957192798 3:77031319-77031341 GATGATGGGAAGATGGTTCTTGG + Intronic
957628276 3:82683385-82683407 GATGTGGGGAGGAGAGCTTGGGG - Intergenic
959012058 3:101089112-101089134 ACTGTTGGGAAAAGGGCTTGTGG + Intergenic
959335958 3:105065878-105065900 TATGATGGAAAGAGGCATTGGGG + Intergenic
959606607 3:108248530-108248552 GATTGAGGGAAGAGGGCTGGGGG - Intergenic
960964416 3:123094867-123094889 TAGGATGGGGACAGGGCTTGGGG + Intronic
961348920 3:126286785-126286807 CATGATGGGAAGAGGGGTGGTGG - Intergenic
962719042 3:138155478-138155500 CAAGATGGGAAGATTGCTTGAGG + Intergenic
965424689 3:168507395-168507417 AAAGATGGGAAGTGTGCTTGTGG + Intergenic
965577817 3:170236016-170236038 CATGATGGGAAGATCACTTGAGG - Intronic
966907156 3:184534822-184534844 CAAGGTGGGAAGATGGCTTGAGG + Intronic
967286192 3:187872873-187872895 TTTGATGGGAAGAGAGCTTATGG - Intergenic
968286895 3:197514090-197514112 GATGGTGGGCAGAGGGGCTGTGG - Intronic
968851877 4:3086436-3086458 CAAGATGGGAAGATCGCTTGAGG + Intronic
969205434 4:5640401-5640423 GATGATGGGTAGACGGATGGAGG + Intronic
971065531 4:23027651-23027673 GAAGATGGAGAGAGGGCTGGAGG + Intergenic
972330784 4:38062877-38062899 GCTGAGGGGAAGAGGGCTGAGGG + Intronic
972491152 4:39588307-39588329 CAAGAAGGGAAGAGTGCTTGAGG + Intronic
973031168 4:45342162-45342184 CAAGGTGGGAGGAGGGCTTGAGG - Intergenic
974651406 4:64758740-64758762 GAAGGTGGGAGGATGGCTTGAGG + Intergenic
974997592 4:69180391-69180413 AATGATGGGAAGTGGGGTGGTGG - Intronic
975002461 4:69241359-69241381 AATGATGGGAAGTGGGGTGGTGG - Intergenic
975007436 4:69308414-69308436 AATGATGGGAAGTGGGGTGGTGG + Intronic
975010566 4:69345341-69345363 AATGATGGGAAGTGGGGTGGTGG - Intronic
976117119 4:81739623-81739645 GAAGGTGGGAAGAGGGAATGAGG + Intronic
978559128 4:110013007-110013029 GGTGATGGGAGGATGACTTGAGG + Intergenic
978777686 4:112519356-112519378 GGTGGGGGGAAGAGGGCTGGGGG + Intergenic
979402500 4:120265883-120265905 GATGGTGGGTAGGGGGCTGGGGG - Intergenic
979466858 4:121049418-121049440 GATGATGCAAAGAGGGCCAGCGG - Intronic
979861054 4:125694376-125694398 GAGGATGGGTAGTGGGCTTGTGG + Intergenic
980027806 4:127786697-127786719 CAAGATGGGAAGATGGCTTGAGG - Intronic
980279418 4:130700174-130700196 CATGATGGGAAGTGGGAATGGGG - Intergenic
981977366 4:150747009-150747031 GATCATGGGAAGATGGCTGACGG - Intronic
982081541 4:151794971-151794993 GCTGAGGGGAAGATTGCTTGAGG + Intergenic
982997194 4:162364449-162364471 GATGATGGTGTGAGGGATTGAGG + Intergenic
984111539 4:175622797-175622819 GATGTTGAGAAGAGAGATTGAGG + Intergenic
985352970 4:189086011-189086033 CATCATGGGAGGAGGGATTGGGG - Intergenic
985651817 5:1111194-1111216 GATGGAGGGAACAGGGCTGGGGG + Intronic
986293122 5:6416289-6416311 GATCCTGGGAAGAGAGCGTGAGG + Intergenic
986593809 5:9399739-9399761 GATGACGGAAAGGGGCCTTGAGG + Intronic
987225130 5:15831926-15831948 CATCCTTGGAAGAGGGCTTGAGG - Intronic
987374954 5:17225398-17225420 GTTGAGGGGAAGATGGCCTGTGG - Intronic
987776484 5:22373199-22373221 GACTCTGGGAGGAGGGCTTGGGG - Intronic
988015657 5:25555105-25555127 GGTGATGGGCAGAAGGCCTGTGG + Intergenic
988223177 5:28375780-28375802 GATGATTATAAAAGGGCTTGAGG - Intergenic
988298253 5:29392380-29392402 GATGAGGGGACAACGGCTTGGGG - Intergenic
990321969 5:54638862-54638884 GATGATGTTATGAGGTCTTGAGG - Intergenic
991985329 5:72279522-72279544 GAAGATGGGAGGATTGCTTGAGG + Intronic
992178266 5:74172210-74172232 GATCAGGGGAAAGGGGCTTGTGG - Intergenic
992586513 5:78245555-78245577 CATGTTGGGAAAAGGGCTTGTGG - Intronic
994355754 5:98792499-98792521 GATGGTGGGAGGATCGCTTGAGG + Intronic
995804814 5:116039246-116039268 GATGATAGGAGGAGGGCCTGGGG - Intronic
997355629 5:133260955-133260977 GATGTTGGGAGGAGGGCTGGCGG + Intronic
997503717 5:134398925-134398947 TGAGATGGGAAGATGGCTTGAGG + Intergenic
998136258 5:139676193-139676215 GAGGTGGGGAGGAGGGCTTGGGG - Intronic
998136299 5:139676305-139676327 GAGGTGGGGAGGAGGGCTTGGGG - Intronic
998153233 5:139769180-139769202 CATGGTGGGAAGAGGGCTCCAGG + Intergenic
998879067 5:146628794-146628816 GATCATGGGATGTGGGCTTATGG - Intronic
1000536124 5:162480163-162480185 TAAGGTGGGAAGATGGCTTGAGG - Intergenic
1000834647 5:166138818-166138840 CAAGGTGGGAAGATGGCTTGAGG - Intergenic
1001499740 5:172221269-172221291 TATGGTGGGAGGATGGCTTGAGG + Intronic
1002014571 5:176309701-176309723 CAAGATGGGAGGAGTGCTTGAGG + Intronic
1002176331 5:177403439-177403461 GGGGACGGGAAGAGAGCTTGGGG - Intronic
1002421510 5:179151677-179151699 GAGGGTGGGAAGTGGGCCTGGGG + Intronic
1002606324 5:180385070-180385092 GAGGGTGGGAAGAGGGAGTGGGG + Intergenic
1002755849 6:158844-158866 GATGATGCGAGGTGGGCTGGTGG + Intergenic
1003594384 6:7461391-7461413 CATGATCTGAAGAGGGCTTGTGG + Intergenic
1004123088 6:12844801-12844823 AATGATGGGAAAGTGGCTTGGGG + Intronic
1004138276 6:12990111-12990133 ACTGTTGGGAAAAGGGCTTGTGG - Intronic
1004757485 6:18628545-18628567 GTGGGTGGGAAGAGGGATTGGGG + Intergenic
1005721618 6:28607905-28607927 GTTTTTGGGAAAAGGGCTTGTGG + Intronic
1005911995 6:30318689-30318711 CAAGGTGGGAAGAGTGCTTGAGG + Intergenic
1006099703 6:31679007-31679029 GATTATGGGAACAAGACTTGGGG + Intronic
1006150615 6:31985221-31985243 CATGTTGGGAAAAGGACTTGTGG - Intronic
1006156916 6:32017959-32017981 CATGTTGGGAAAAGGACTTGTGG - Intronic
1006223185 6:32512828-32512850 GGTGTTGGGAAAAGGACTTGTGG + Intergenic
1006264063 6:32901901-32901923 ACTGGAGGGAAGAGGGCTTGAGG + Intergenic
1006315531 6:33289240-33289262 GATGAAGGACAGAGGGCTTCCGG - Exonic
1006403085 6:33829189-33829211 GTTCCAGGGAAGAGGGCTTGGGG - Intergenic
1006735404 6:36269603-36269625 GAAGATAGCATGAGGGCTTGGGG + Intronic
1006756308 6:36418735-36418757 GATAAAGGGAAGAGTGCCTGAGG + Intronic
1007375775 6:41455707-41455729 GATGATGGGAGCAGAGATTGGGG + Intergenic
1007630773 6:43272099-43272121 GTGGATGGGAAGAGGGCAAGAGG - Intronic
1010489592 6:76459498-76459520 GATGATGAGAAGGAGGCCTGAGG - Intergenic
1010640058 6:78314238-78314260 ATTGATGAGAACAGGGCTTGAGG + Intergenic
1011125126 6:83999051-83999073 TCTGATGAGCAGAGGGCTTGAGG + Intergenic
1011629700 6:89311755-89311777 GATGATGTGAAGATGGGGTGAGG - Intronic
1011695111 6:89905452-89905474 GCTGATGGGAGGATTGCTTGAGG - Intergenic
1012755683 6:103227451-103227473 TATGATGGGGAGAGGGCTGGTGG + Intergenic
1013453926 6:110312687-110312709 GATGCTGGGAAGGGTGTTTGAGG + Intronic
1013458831 6:110357014-110357036 GGTGATGGGAAGCGGGGTGGAGG + Intronic
1014122631 6:117743282-117743304 CAAGATGGGAAGATTGCTTGAGG + Intergenic
1014526265 6:122505375-122505397 CATGTTGGGAAAAGGGCTTGTGG - Intronic
1014601528 6:123418962-123418984 GCTGATGGGAAGAGAGATTCTGG + Intronic
1016110740 6:140219926-140219948 GATTATGGTAAGAGAGCTTTGGG - Intergenic
1017240000 6:152157414-152157436 GAGGCTGGGAAGAGTGTTTGGGG + Intronic
1017425252 6:154313978-154314000 CAAGATGGGAAGATTGCTTGAGG - Intronic
1017594414 6:156013542-156013564 GATGAAGGGATGTGGGGTTGCGG - Intergenic
1019299705 7:296901-296923 GATGATGGGACGTGGGGCTGCGG + Intergenic
1019299741 7:297023-297045 GATGATGGGACGTGGGGCTGCGG + Intergenic
1019299777 7:297145-297167 GATGATGGGACGTGGGGCTGCGG + Intergenic
1019662335 7:2231909-2231931 GATGATGGGAATACGGCTGCAGG + Intronic
1020161495 7:5775949-5775971 CATGCTGGGAAGAGGTATTGTGG - Intronic
1020187322 7:5969225-5969247 GAAGGTGGGAAGATTGCTTGAGG - Intronic
1020295594 7:6755545-6755567 GAAGGTGGGAAGATTGCTTGAGG + Intronic
1021320221 7:19200247-19200269 GAAGATGGGAAGAGTGGATGTGG + Intergenic
1021657956 7:22890475-22890497 GGTGAAGGGGAGAGGGATTGGGG + Intergenic
1022894453 7:34735419-34735441 GAGGAGGGGAAGAGGGCTCCAGG - Intronic
1023111264 7:36813345-36813367 GGTAATGGGAATAGGGGTTGTGG - Intergenic
1023302949 7:38793078-38793100 GATAATAGGAAAAGGGATTGGGG - Intronic
1023875266 7:44283211-44283233 GATGATGGGCAGAGGCCTCCCGG - Intronic
1023965452 7:44961385-44961407 GCTGAGGGGATGAGGGGTTGAGG + Intergenic
1024491963 7:49995858-49995880 GAAGGTGGGAAGAGGGTTTGGGG + Intronic
1025057567 7:55777339-55777361 GAGGATGGGAAGAGGGTGAGGGG - Intergenic
1028234818 7:88347793-88347815 CAAGATGGGGAGAGGGCTAGAGG - Intergenic
1029326822 7:99816939-99816961 AATGATGGGAAGAGGGCTTCAGG - Intergenic
1029465322 7:100721219-100721241 GTTGAGGGGAAGAAGGTTTGGGG + Intronic
1031560564 7:123232920-123232942 GATGCTGGGAAGAGAGGTTCTGG - Intergenic
1031843978 7:126781946-126781968 CAAGATGGGAAGATTGCTTGAGG - Intronic
1032112391 7:129087250-129087272 CAAGATGGGAAGATGGCTTGAGG + Intergenic
1033149288 7:138899292-138899314 GTTGATGGGAAGAGGGACAGTGG + Intronic
1034252472 7:149703397-149703419 GATGAGGGGGAGGGGGCTGGAGG + Intergenic
1034850778 7:154491507-154491529 GATGATGGGAAGAGAACAAGGGG - Intronic
1034992538 7:155557286-155557308 GCTGATGGGGAGAGAGCTGGAGG + Intergenic
1035216857 7:157374147-157374169 GATGAGAGGAAGAGCGCGTGGGG - Intronic
1035415060 7:158676359-158676381 GATTATGGCAAGAGAGCTCGTGG + Intronic
1035449940 7:158970641-158970663 GCTGAGGGGCAGTGGGCTTGGGG - Intergenic
1035913618 8:3595924-3595946 GAAGATGGGAGAGGGGCTTGCGG - Intronic
1036636654 8:10555218-10555240 CATGATGGGAAGAGGGGATCAGG + Intergenic
1036985847 8:13530009-13530031 GAGGATGCGAAGAGGGTTGGAGG + Intergenic
1037584705 8:20268513-20268535 GATGAGGGGGAAAGGGGTTGGGG + Intronic
1037805789 8:22057317-22057339 GATCTGGGGAAGAGGGCCTGGGG + Intronic
1037945229 8:22985624-22985646 CCTGTTGGGAAAAGGGCTTGTGG - Intronic
1037989220 8:23308680-23308702 GAGGATGAGCAGATGGCTTGTGG + Intronic
1039263711 8:35802027-35802049 CAAGGTGGGAAGATGGCTTGAGG - Intergenic
1039565959 8:38552918-38552940 GATGATGGGAAGAGGTTAAGGGG - Intergenic
1039685304 8:39795289-39795311 CATGATGGGAAGAGGGGTGGGGG + Intronic
1039704145 8:39989889-39989911 GCTTAGGGGAAGAGGGCCTGGGG + Intronic
1040625586 8:49145969-49145991 CAAGAAGAGAAGAGGGCTTGAGG - Intergenic
1042216755 8:66435839-66435861 CAAGATGGGAAGACTGCTTGGGG - Intronic
1042541821 8:69915168-69915190 GATGATTTAAAAAGGGCTTGAGG - Intergenic
1043403853 8:79910900-79910922 CATGATTGGATGAGGCCTTGGGG - Intergenic
1043622036 8:82206224-82206246 CTTGTTGGGAAAAGGGCTTGTGG + Intergenic
1044631466 8:94283354-94283376 GATGATGGCTAGATGGCATGGGG - Intergenic
1044701677 8:94970912-94970934 CATGGTGGGAGGATGGCTTGAGG - Intronic
1046912370 8:119642846-119642868 GATGAAGATAAGAAGGCTTGAGG + Intronic
1047251929 8:123187179-123187201 GGTGATGGGACCAGAGCTTGGGG + Intronic
1047776601 8:128076541-128076563 GATGATGGGAAAAAAGGTTGTGG + Intergenic
1048445467 8:134489657-134489679 GATGATGGAAGGAGGGGATGTGG - Intronic
1048753644 8:137708880-137708902 GACGTTTGGAAGATGGCTTGAGG + Intergenic
1049095852 8:140547699-140547721 GATGGGGGCAAGAGGGCTGGTGG - Intronic
1049200224 8:141336458-141336480 GGTGCTGGGAAGTGGGGTTGGGG + Intergenic
1052028435 9:23601118-23601140 GAAGCTGGGAAGGAGGCTTGAGG - Intergenic
1053441575 9:38120639-38120661 TGTGATGGGAAGATCGCTTGAGG + Intergenic
1053827064 9:42036136-42036158 CAAAATGGGAAGAGTGCTTGAGG - Intronic
1054603499 9:67151296-67151318 CAAAATGGGAAGAGTGCTTGAGG + Intergenic
1055539776 9:77291280-77291302 GAGGGTGGGGAGATGGCTTGGGG - Intronic
1055806480 9:80100157-80100179 CAAGATGGGAGGATGGCTTGAGG - Intergenic
1056483774 9:87033618-87033640 GAAGAAGGGAAGAGGGGGTGGGG + Intergenic
1056593478 9:87984701-87984723 GCTGTTGGGAAAAGGGCTTGTGG - Intergenic
1058576770 9:106412242-106412264 GATGATGGGAGATGGGTTTGTGG + Intergenic
1058856984 9:109072070-109072092 AGTGTTGGGAAAAGGGCTTGTGG + Intronic
1059472579 9:114517484-114517506 GATGATGGCTAGAGGGTATGGGG - Intergenic
1059703353 9:116797051-116797073 CAAGATGGGAAGATTGCTTGAGG - Intronic
1059930090 9:119251744-119251766 GTTGATGGGATGTGGGCATGGGG + Intronic
1060244361 9:121931692-121931714 CATGCTGAGAACAGGGCTTGTGG + Intronic
1060252248 9:121995711-121995733 GATGAACAGTAGAGGGCTTGCGG - Intronic
1060616664 9:125022648-125022670 TAAGATGGGAAGATTGCTTGCGG - Intronic
1061194695 9:129101279-129101301 AATGTTGGGAAAAGGACTTGTGG + Intronic
1061561110 9:131404011-131404033 CAAGATGGGAAGACAGCTTGAGG - Intronic
1061686960 9:132289025-132289047 CATGTTGGGGAAAGGGCTTGTGG + Intronic
1061828947 9:133278350-133278372 GCTGATGGGACGAGGGGTCGGGG - Intergenic
1062192215 9:135253841-135253863 TAGGATAGGAAGAGGGCGTGAGG + Intergenic
1203400020 Un_KI270519v1:78724-78746 GATGTGGGGAAGGGGGATTGGGG + Intergenic
1185519807 X:729847-729869 GAAGATGGGAACAGGGGATGTGG + Intergenic
1187917791 X:24171441-24171463 GATGATGGGAAGGTAGTTTGGGG + Intronic
1187926720 X:24257582-24257604 GATCATGGGAAGAGCCCTTGAGG + Intergenic
1189176209 X:38959935-38959957 CATGATGGGAAGCGGGGTGGTGG - Intergenic
1189300297 X:39947565-39947587 CAAGATGGGAGGAGAGCTTGAGG + Intergenic
1190109201 X:47578935-47578957 GATGTTGGGACGGGGGTTTGGGG + Intronic
1190162962 X:48047210-48047232 GACATTGGGAAAAGGGCTTGTGG - Intronic
1190650290 X:52562920-52562942 GAAGATGGGGAGAGTGCTGGGGG - Intergenic
1193109054 X:77708972-77708994 CATGGTGGGAAGATCGCTTGAGG + Intronic
1194162155 X:90467348-90467370 GCTGATGATAAAAGGGCTTGAGG - Intergenic
1195422499 X:104691253-104691275 GATGAGGGGAAGAAGGCTTCAGG - Intronic
1196148300 X:112344224-112344246 GGTGAGGGGAGGTGGGCTTGAGG - Intergenic
1196926985 X:120643306-120643328 CATGGTGGGAGGATGGCTTGAGG - Intergenic
1197046665 X:122005552-122005574 GAGGATGGGAGGAAGGCTTGGGG + Intergenic
1198055069 X:132985724-132985746 GAAGATGGGAGGAGGGCACGAGG + Intergenic
1198107343 X:133474262-133474284 AATGATGGGAAGAGGGAATGAGG + Intergenic
1198222114 X:134612248-134612270 AGTGATGGGAAGAGAGGTTGAGG - Intronic
1200314875 X:155121892-155121914 CAAGATGGGAGGAGTGCTTGAGG + Exonic
1200508432 Y:4045085-4045107 GCTGATGATAAAAGGGCTTGAGG - Intergenic
1200804687 Y:7421143-7421165 GAGGATGGGAAGCGGGGTCGGGG + Intergenic