ID: 1083736381

View in Genome Browser
Species Human (GRCh38)
Location 11:64683836-64683858
Sequence GACCCTCGGCTGCTTCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083736381_1083736385 27 Left 1083736381 11:64683836-64683858 CCAGGAAGAAGCAGCCGAGGGTC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1083736385 11:64683886-64683908 CGAGTGTCTCCTCCTCTGTGTGG 0: 1
1: 0
2: 1
3: 19
4: 209
1083736381_1083736383 3 Left 1083736381 11:64683836-64683858 CCAGGAAGAAGCAGCCGAGGGTC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1083736383 11:64683862-64683884 GTCTACACTCAGCACTGCTGAGG 0: 1
1: 0
2: 2
3: 19
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083736381 Original CRISPR GACCCTCGGCTGCTTCTTCC TGG (reversed) Intronic
900175728 1:1290615-1290637 GACACCCGGCTGTCTCTTCCAGG + Exonic
900322229 1:2090500-2090522 CACCCTCAGCTGCTCCTTCCAGG + Intronic
900361950 1:2293358-2293380 AACCCTCGGCTGGACCTTCCAGG - Intronic
900438051 1:2640806-2640828 GACCTGGGGCTGCTTCTTCAAGG + Intronic
901462369 1:9399455-9399477 GGTCCTCAGCTGCCTCTTCCAGG - Intergenic
902566441 1:17314676-17314698 GACCTTGGGCTGCTTCTGACAGG - Intronic
903701545 1:25252436-25252458 GAGCCTAGGCTGTTGCTTCCCGG - Intronic
903830323 1:26170571-26170593 GACGCTCAGCTGCTTCAGCCTGG - Exonic
903886888 1:26545959-26545981 GATCCTGGGCCGCTGCTTCCTGG - Exonic
904131998 1:28282055-28282077 GGTCCTTGGCTGCTTCTGCCTGG - Exonic
913584375 1:120259159-120259181 GATTCCTGGCTGCTTCTTCCAGG - Intergenic
913623806 1:120639179-120639201 GATTCCTGGCTGCTTCTTCCAGG + Intergenic
914566372 1:148871036-148871058 GATTCCTGGCTGCTTCTTCCAGG - Intronic
914606447 1:149259204-149259226 GATTCCTGGCTGCTTCTTCCAGG + Intergenic
914816957 1:151070404-151070426 AACTCTTGGCTGCTTCTTCGGGG - Intergenic
915236405 1:154486520-154486542 GACTCACGGCTGCTTCTCCAGGG + Exonic
923286584 1:232501916-232501938 TTCCTTCGGCTGCTTCTCCCTGG + Intronic
923592064 1:235328053-235328075 GACCCTCTGCAGCTCCCTCCGGG + Exonic
1066616497 10:37300317-37300339 GAGCCTCAGCTGCTTCTGCAGGG - Intronic
1069832953 10:71292124-71292146 GTCCCTCTGCTGCTAGTTCCAGG - Intronic
1073345149 10:102777273-102777295 CACCCTCTGCTGCCTGTTCCTGG + Intronic
1075062930 10:119269385-119269407 AACCCTCGGCTGCATGTTCAGGG - Intronic
1075633407 10:124014996-124015018 GGCGCTCGGCTGCTTCTCCCGGG + Intronic
1076293111 10:129362727-129362749 CACCCTAGGCTGTTTCTCCCGGG - Intergenic
1076496221 10:130899412-130899434 TGCCTTCGCCTGCTTCTTCCCGG - Intergenic
1077142366 11:1030216-1030238 CACCTTCGGGTGCTTCTGCCCGG - Exonic
1078149995 11:8750361-8750383 GAACATCAGCTGCTTCTTGCTGG + Intronic
1079381917 11:19945640-19945662 GACCCCCAGCTGTTTCTTACAGG + Intronic
1081899802 11:46617959-46617981 GCCCCTTGGCTGCTGCTTCGTGG + Intronic
1083736381 11:64683836-64683858 GACCCTCGGCTGCTTCTTCCTGG - Intronic
1089073363 11:115717819-115717841 GCCTCTCAGCTGCTTGTTCCAGG - Intergenic
1090402512 11:126458156-126458178 GGCCCTGGGCTGCATCTTCTGGG + Intronic
1090801348 11:130174473-130174495 GGCCCTCTGCTGCTTCTCCTGGG + Intronic
1103449925 12:121021466-121021488 GACCCTCGCCAGCATTTTCCAGG - Intronic
1104232700 12:126900521-126900543 GAACCCAGGCTGCTCCTTCCCGG - Intergenic
1113670401 13:112171868-112171890 GACCCTCGGAGGCTTCTGCGTGG + Intergenic
1113749770 13:112769125-112769147 GCCCCCCGGCTCCTCCTTCCAGG + Intronic
1117548006 14:56808982-56809004 GACCTTCGGATGGTTCTTACTGG + Intronic
1121928912 14:97954279-97954301 TACCCTAGGCTGCTTCTAGCTGG - Intronic
1122372259 14:101235329-101235351 CACCCTGGGCCGCTTCCTCCTGG + Intergenic
1127262772 15:57338030-57338052 GACTCACGGCTGCTTCCTCCTGG + Intergenic
1130486915 15:84403206-84403228 GCCCATCTGCTGCTTCATCCAGG - Intergenic
1131401367 15:92128158-92128180 GGCCCTGGGCTGCTCCTTGCTGG + Intronic
1132742185 16:1420383-1420405 GCCCCTCAGCTGCTTCCTCGTGG - Exonic
1133631808 16:7629148-7629170 GGCCCTGGGCTGCTTCTCCCTGG + Intronic
1135111073 16:19691277-19691299 GACACACGGCTGCCTCTCCCTGG + Intronic
1137696651 16:50466229-50466251 GACCCTTGGCTGCTGGATCCAGG + Intergenic
1139314316 16:66055627-66055649 GACCCTCCCCTGCCTCTCCCCGG + Intergenic
1139527346 16:67525085-67525107 CAGCCTCAGCTGCTCCTTCCAGG + Intronic
1142197399 16:88745154-88745176 GACCCACTGCTGCCTCTTCCAGG + Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143130184 17:4672814-4672836 GTCCCTCCCCGGCTTCTTCCTGG - Exonic
1143854629 17:9839552-9839574 CACCCTCTGCTGCTTCTCCATGG + Intronic
1147239498 17:39081235-39081257 GACCCCAGGTTGGTTCTTCCTGG - Intronic
1152134422 17:78495410-78495432 GGCCCTCGCCTGCCTCATCCTGG + Intronic
1153777523 18:8466880-8466902 GACCCTAGGCCGCTTCCTTCAGG + Intergenic
1153839138 18:8990489-8990511 GACCCTGTGCTGCTCCGTCCGGG - Intergenic
1153841791 18:9014587-9014609 GTGCCTCTGCTGCTTATTCCAGG + Intergenic
1155127684 18:22895577-22895599 GCCCTTCTGCTGCTTTTTCCAGG + Intronic
1156382915 18:36580220-36580242 GACTCTGGGCTGCCTCTTCAGGG + Intronic
1159092888 18:63869700-63869722 GACGCTCTGCTGCTCTTTCCCGG + Intergenic
1160847471 19:1172945-1172967 CTCCCCTGGCTGCTTCTTCCCGG - Intronic
1161069285 19:2252404-2252426 CACCCAGGCCTGCTTCTTCCTGG + Exonic
1166569484 19:43784739-43784761 GACCCCCAGCTTCTTCCTCCTGG - Intergenic
1166745827 19:45141460-45141482 GAGCCTGAGCTGCCTCTTCCTGG - Intronic
1167696048 19:51016109-51016131 GACCACCTGCTGCTTCTTCAGGG - Exonic
928112582 2:28522564-28522586 GACTCTCGGGTCCTTCTGCCTGG + Intronic
934730730 2:96655139-96655161 GATCCTCTGCTTCTACTTCCTGG - Intergenic
937262922 2:120597899-120597921 GACCCTCTGCAGCCTCTGCCTGG - Intergenic
939962854 2:148581106-148581128 GACCCTCCCCTGCTTCATCCGGG - Intergenic
941065189 2:160893741-160893763 GTCCCTGGGCTGCTGCTCCCTGG - Intergenic
943993455 2:194728993-194729015 GAACCTCTGCTGCATCTTCTAGG - Intergenic
946348565 2:219131433-219131455 TATCTTCGGCTGCTTTTTCCTGG + Intronic
948055789 2:235008389-235008411 AGGCCTCGGCTGGTTCTTCCTGG - Intronic
948230118 2:236343096-236343118 CAGGCTCGGCTGCTTCTTCACGG + Intronic
948787236 2:240359004-240359026 GCCACTCGGCCGCCTCTTCCTGG + Intergenic
948824047 2:240565908-240565930 GACCGGCGGCTGCTTCCTTCCGG - Intronic
1169075667 20:2758654-2758676 GACCCCAGGCTCCTTCTCCCAGG - Intronic
1172775384 20:37403894-37403916 GACCCTCTGCCGCTGCTTCCAGG + Exonic
1172865565 20:38094486-38094508 GGACCTCAGCTGCTTCTTACAGG + Intronic
1174285593 20:49470641-49470663 GACTCTCAGCTGCTTATGCCAGG - Intronic
1174418259 20:50382193-50382215 GAACCTTGGCTTCTTCCTCCAGG + Intergenic
1174550824 20:51360281-51360303 GACCCCAGGCTGCTACTACCTGG - Intergenic
1179403142 21:41102661-41102683 GACCCACAGCTCCTTCTCCCAGG - Intergenic
1181667027 22:24405424-24405446 GTCCCTAGGCTGCTCCTACCTGG - Intronic
950055567 3:10021492-10021514 CCTCCTCGGCTACTTCTTCCAGG - Intergenic
952102550 3:30031631-30031653 GACCCAAGGCTGCTTATTACAGG + Intergenic
954106568 3:48412718-48412740 TACCCCCAGCTGCATCTTCCTGG - Intronic
956400354 3:68872808-68872830 GAGCCTCAGTTTCTTCTTCCTGG - Intronic
958641622 3:96813856-96813878 CCCCCTCTGCTGCTTCCTCCCGG + Intergenic
961780039 3:129315953-129315975 GCCCCTCGCCTTCCTCTTCCCGG - Exonic
966642337 3:182204820-182204842 GACGCTCAGCAGCTACTTCCTGG - Intergenic
966881531 3:184353722-184353744 GGCCCTCAGCTGCACCTTCCGGG - Exonic
967363453 3:188658542-188658564 CACTCTTGGCTGCTTCTTCCTGG + Intronic
968826251 4:2899880-2899902 GCCCCTCAGCTGCTTATTGCAGG + Intronic
969402278 4:6963343-6963365 GTCCCTCAGCTGCTGCTTCATGG - Intronic
969662046 4:8536042-8536064 CTGGCTCGGCTGCTTCTTCCAGG + Intergenic
969704355 4:8783949-8783971 GACCCTGGGCTGCACCATCCAGG + Intergenic
970329563 4:14965536-14965558 TAGCCTCAGCTGCTTCCTCCTGG - Intergenic
979506948 4:121509754-121509776 TACCCTCCTCTGCTCCTTCCAGG + Intergenic
982198610 4:152938129-152938151 GAGCGCCGGCTGCTCCTTCCAGG - Intronic
983368243 4:166823989-166824011 GTCCCTAAGCTGCTGCTTCCAGG + Intronic
985608867 5:875150-875172 GAGCCTCGGCTGCTCACTCCCGG - Intronic
986451687 5:7871387-7871409 AAAACTCGGCTGCTTCTTCAGGG + Intronic
997474474 5:134134599-134134621 GGCCCTTGGCTCCTTCTCCCTGG + Intronic
999197578 5:149793023-149793045 TACCCTCAGCTGCTTCATCCAGG + Intronic
999278795 5:150350735-150350757 CACCCCTGGCTGCTTCCTCCCGG - Intergenic
1000195479 5:158953397-158953419 GTCCCTCTGCTGCCTTTTCCTGG - Intronic
1001506593 5:172284392-172284414 GGCCGTCGGCTCCTTCTTGCTGG + Intergenic
1002541129 5:179907415-179907437 GACCGGCGGCGGCTTCTGCCCGG - Intronic
1003098517 6:3159702-3159724 GTCCCTCGGATGCTACTCCCAGG + Intergenic
1003347347 6:5282784-5282806 GACCCTCAGCATCTTCCTCCTGG - Intronic
1005174378 6:23027231-23027253 TGCCCTCCTCTGCTTCTTCCAGG - Intergenic
1007032311 6:38639683-38639705 GCCCCTCCGCCGCTTTTTCCGGG - Intronic
1007400600 6:41600270-41600292 GACCCTGGGCTGCTTCCTGGGGG + Exonic
1007495803 6:42259694-42259716 CACACTCGGCTGATGCTTCCTGG + Exonic
1009645071 6:66391063-66391085 GACCCCAGGCTGCTTATGCCTGG + Intergenic
1011865101 6:91816005-91816027 CACCCTCTTCTGCTTCATCCTGG + Intergenic
1017311797 6:152983763-152983785 GACCTGCGGCTGCATCTCCCAGG + Intergenic
1017821095 6:158049542-158049564 GACCCTAAGCTGCTTCTTTTAGG - Intronic
1018988062 6:168652897-168652919 ACCCCTGGGCTGCTCCTTCCTGG - Intronic
1019622809 7:2000881-2000903 GCCGCTGGGCAGCTTCTTCCAGG + Intronic
1019910389 7:4096907-4096929 GAGCCCAGGCTGCCTCTTCCTGG - Intronic
1022183716 7:27946471-27946493 GACTCTCGGATGTTTTTTCCAGG - Intronic
1023059914 7:36316925-36316947 GTCCCACGGGTGATTCTTCCAGG - Intergenic
1025806539 7:64838649-64838671 GGCCCTCCGCTGCCTCATCCAGG + Intergenic
1026899645 7:74029696-74029718 GACCCGGGGCTGCTGCTTTCAGG - Intronic
1029856922 7:103526872-103526894 CACCATCAGCTGCTACTTCCCGG + Intronic
1031363224 7:120871804-120871826 GACCCTGGCTTGCTTCTTGCAGG - Intergenic
1032087373 7:128891151-128891173 ACCCCTCGGCTGCTCCTCCCTGG - Intronic
1033209959 7:139453403-139453425 TTCCCTCGGATGCATCTTCCTGG + Exonic
1033588854 7:142794139-142794161 GCCCCTGAGCTGCTTCTTTCAGG + Intergenic
1034432223 7:151046774-151046796 GAGCCACTGCTGCCTCTTCCAGG - Intronic
1034734068 7:153412643-153412665 GGCCCTCCGCTGCCTCATCCAGG + Intergenic
1036490183 8:9218057-9218079 TTCACTCGGCTGCTTCTTCATGG - Intergenic
1039266296 8:35827632-35827654 GACTCTCTGCTGCCCCTTCCTGG + Intergenic
1039608437 8:38901253-38901275 GTCCCTCGGCTCTTTTTTCCGGG - Intronic
1039912090 8:41833928-41833950 GTCCCTCCGCAGCCTCTTCCTGG - Intronic
1041841954 8:62282336-62282358 GTCCCTCGGCCTATTCTTCCCGG + Intronic
1042461276 8:69072112-69072134 GTCCTTTGGCTGCTTCTTCAGGG - Intergenic
1048919329 8:139213521-139213543 GCCCCGCGGCCGCCTCTTCCTGG - Intergenic
1049439010 8:142600785-142600807 GAGCCTGAGCTGCTTCCTCCAGG - Intergenic
1057269937 9:93645025-93645047 GCCCCTCTGCTGCTTCCTCTGGG + Intronic
1057782943 9:98064756-98064778 GTCCCTCAGCTGCTGCTGCCTGG + Intronic
1061296052 9:129677434-129677456 GAGCCTAGGCTGCTTCTAGCAGG - Intronic
1061971319 9:134046995-134047017 GAGCCTCGGCTGCAGCCTCCAGG - Intronic
1062566181 9:137164938-137164960 GGCTCTCGGCTGGCTCTTCCTGG - Intronic
1203771165 EBV:50755-50777 GAATCTCCGCGGCTTCTTCCCGG + Intergenic
1186817927 X:13256269-13256291 GTCCCTTGGCTGCTGCTTGCAGG - Intergenic
1197712472 X:129681410-129681432 GACCCACAGCTGCTTCTTTAAGG - Intergenic
1198739750 X:139829141-139829163 GACATTCTGCTGCTTCTTTCAGG - Intronic
1199561978 X:149172679-149172701 GACCCTGGGCTGCTTTTTCATGG + Intergenic
1199775724 X:151009703-151009725 GCCCCTCAGCTGCTTCTTCTCGG - Intergenic