ID: 1083737326

View in Genome Browser
Species Human (GRCh38)
Location 11:64688865-64688887
Sequence TCGAGAGTAGGGAGGGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083737326_1083737333 7 Left 1083737326 11:64688865-64688887 CCCTCCGCCCTCCCTACTCTCGA 0: 1
1: 0
2: 3
3: 16
4: 267
Right 1083737333 11:64688895-64688917 AGCTGTCTGTTCTGCTCACTTGG 0: 1
1: 0
2: 3
3: 33
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083737326 Original CRISPR TCGAGAGTAGGGAGGGCGGA GGG (reversed) Intronic
900594171 1:3472877-3472899 TGGACAGCAGGGAGGGCGGGTGG - Intronic
901125614 1:6926391-6926413 GAGAGAGGAGGGAGGGAGGAAGG - Intronic
902809215 1:18878870-18878892 CCATGAGTAGGGAGGGAGGAGGG - Intronic
903181765 1:21608459-21608481 TGGGGAGTGGGGAGGGCGGAGGG + Intronic
904774158 1:32896480-32896502 TCCAGAGCAGTGAGGGAGGAAGG - Intronic
904921513 1:34011856-34011878 TTGTGAGTGGGGAGGGAGGAGGG - Intronic
906106732 1:43299162-43299184 TTGAGAGTGGGGAGGGCAGATGG + Intergenic
906539556 1:46574791-46574813 TTGGGAGAAGGGAGGCCGGAGGG - Intronic
907435443 1:54443096-54443118 TGGGGTGTAGGGAGGGGGGAGGG - Intergenic
909953929 1:81754161-81754183 TCCAAAGGAGGGAGGGAGGAAGG - Intronic
912324847 1:108747420-108747442 CCGAGAGTAGGGAAAACGGAAGG - Intronic
912777658 1:112515932-112515954 TAGAGAGTAGTGAGGGCTGAGGG + Intronic
913714432 1:121519477-121519499 GCCAGGGTAGGGAGGGCGGAGGG + Intergenic
915308127 1:154992880-154992902 TCTGGAGCAGGGAGGGTGGAGGG - Exonic
916353199 1:163875627-163875649 ACAAGAGTAGGGAGGGCGGAAGG + Intergenic
917670707 1:177270794-177270816 TCTAGGGTAGGGTGGGCTGAAGG - Intronic
917813786 1:178687006-178687028 TGGAGAGTAGAGATGGAGGAAGG + Intergenic
919019344 1:192084326-192084348 TCCAAAGTAGGGAGGGAGGCCGG + Intergenic
919277051 1:195433894-195433916 TCGAGAGAAGGAAAGGAGGATGG + Intergenic
919967402 1:202541806-202541828 ACGAGGGTAGGGAGGTTGGATGG - Intronic
920081071 1:203373305-203373327 TCGAAAGAAGGAAGGGAGGAAGG - Intergenic
920203208 1:204273458-204273480 TGGAGAGTAGGAAGGGAAGAGGG - Intronic
920491842 1:206422047-206422069 TAGACAGCAGGGAGGGCGGGTGG + Intronic
920550351 1:206855442-206855464 TCAAGGGTGGGGAGGGCGGATGG + Intergenic
921252418 1:213310355-213310377 TGGAGCGCAGGGAGGGAGGATGG - Intergenic
922472322 1:225883947-225883969 AAGAGAGCAGGGAGGGGGGATGG - Intergenic
922974673 1:229774349-229774371 ACGAAAGTTGGGAGGGTGGAAGG + Intergenic
923836804 1:237619768-237619790 TAGAAAGTATGGAGGGCAGAAGG + Intronic
1064358988 10:14646334-14646356 TCAGGAGGAGGGAGGGTGGACGG - Intronic
1064848814 10:19686760-19686782 TGGAGGGTAGGGAGTGAGGATGG + Intronic
1064857976 10:19792955-19792977 ACGAGAGTATGGAGGGAGGATGG - Intergenic
1065502732 10:26398154-26398176 TGGAGAGGACGGAGGGCTGAGGG - Intergenic
1065901837 10:30214912-30214934 CCCAGAGTAAGGAGGGAGGAGGG - Intergenic
1066004429 10:31133876-31133898 GCGGGAGTAGGGAGGGGGGTTGG - Intergenic
1066950243 10:42110747-42110769 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
1067481034 10:46597796-46597818 CGGGGGGTAGGGAGGGCGGAAGG - Intergenic
1067613717 10:47744026-47744048 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1069279605 10:66638437-66638459 TCTAGAGTTGGGGCGGCGGAGGG - Intronic
1070659997 10:78298796-78298818 TCGAGAGTGGGGAGAGTTGAGGG - Intergenic
1071629128 10:87203998-87204020 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1071887559 10:89967584-89967606 TAGAGAGTAGCGAGGGGGCAGGG - Intergenic
1073673161 10:105614952-105614974 ACTAGAGTGGGGAGGGAGGAAGG + Intergenic
1074182664 10:111077705-111077727 GAGAGAGTAGGGAGAGCCGATGG - Exonic
1074869330 10:117564693-117564715 TGGAGAGAAAGGAGGGAGGAGGG + Intergenic
1075065395 10:119285820-119285842 GCCAGAGTAGGGAGGGATGAAGG + Intronic
1076288984 10:129329629-129329651 TCTGGAGCAGGGAGGGCGGCCGG + Intergenic
1076949484 10:133670070-133670092 TGGAGAGGGGGGAGGGGGGAGGG - Intronic
1076950468 10:133673369-133673391 TGGAGAGGGGGGAGGGGGGAGGG - Intergenic
1076953431 10:133683288-133683310 TGGAGAGGGGGGAGGGGGGAGGG - Intergenic
1076958366 10:133752868-133752890 TGGAGAGGGGGGAGGGGGGAGGG - Intergenic
1076960339 10:133759477-133759499 TGGAGAGGGGGGAGGGGGGAGGG - Intergenic
1077422170 11:2457621-2457643 ACAAGAGTGGGGAGGGGGGAAGG + Intronic
1077488905 11:2851493-2851515 TCCTGAGTAGGGAGGGGGGCTGG - Intergenic
1077894793 11:6446144-6446166 TGGAGAGGAAGGAGGGTGGAAGG - Intergenic
1078405782 11:11068745-11068767 AAGAGAGTAGGGAGGGCTGTAGG - Intergenic
1078670134 11:13357253-13357275 TGGAGAGCATGGAGGGCAGAAGG - Intronic
1079081169 11:17414625-17414647 GCGGGAGTAGGGGGTGCGGAAGG + Intronic
1080146484 11:28991165-28991187 TTCAGAGTAGGGAGGGTGGTAGG - Intergenic
1080673805 11:34405838-34405860 TGGAGAGATGGGAGGGTGGAGGG - Intergenic
1081776918 11:45681936-45681958 ACAAGAGTAGGGAGGGCTCATGG - Intergenic
1082957065 11:58881728-58881750 TGGGGTGGAGGGAGGGCGGAGGG - Intronic
1083152088 11:60798209-60798231 TCAAGAACAGGGAGGGTGGAGGG + Intronic
1083737326 11:64688865-64688887 TCGAGAGTAGGGAGGGCGGAGGG - Intronic
1083744089 11:64725788-64725810 TCAAGAGGGGGAAGGGCGGAGGG + Intergenic
1084546653 11:69818189-69818211 CCGCGAGCGGGGAGGGCGGAGGG + Intronic
1088225195 11:107612351-107612373 ACTAGAGTTGGGAGGGAGGAGGG + Intronic
1088641844 11:111880192-111880214 ACTAGAGTGGGGAGGGCGGGTGG - Intronic
1088977879 11:114831912-114831934 TGGAGAGGAGGGTGGGCAGAGGG - Intergenic
1090425462 11:126604068-126604090 TGGATAGAAGGGAGGGAGGAAGG - Intronic
1091567663 12:1661054-1661076 TGGAGAGACGGGTGGGCGGAGGG - Intergenic
1093946014 12:25110443-25110465 TCGGGAGTAGGGATGTCAGAGGG - Intronic
1096574670 12:52545201-52545223 TGGGAAGTAGGGAGGGCTGAGGG - Intronic
1100114381 12:91285778-91285800 TGGAGTGTGGGGAGGGGGGAGGG + Intergenic
1103030124 12:117606384-117606406 AGGAGAGGAGGGAGGGAGGAAGG - Intronic
1103030158 12:117606464-117606486 AGGAGAGGAGGGAGGGAGGAAGG - Intronic
1103143429 12:118572436-118572458 ACGAGAGAAGGGAGGGAGGAAGG - Intergenic
1103737757 12:123071151-123071173 TCTTGAGTAGGGTGGGCAGAGGG + Intronic
1104463377 12:128971863-128971885 GAGAGAGGAGGGAGGGAGGAGGG - Intronic
1104484803 12:129141760-129141782 GCTAGAGCAGGGAGGGAGGAAGG + Intronic
1107989589 13:45806562-45806584 ATGAGAGTGGGGAGGGTGGAAGG + Intronic
1112960028 13:105112692-105112714 TGGTGATTAGTGAGGGCGGAGGG - Intergenic
1113930252 13:113964598-113964620 GGGAGAGTAGGGAGGAAGGAGGG - Intergenic
1115901575 14:38156845-38156867 GAGAGAGGAGGGAGGGAGGAAGG + Intergenic
1116433908 14:44875964-44875986 TCAAGAGTAGGGAGGCAGCATGG + Intergenic
1118022675 14:61734761-61734783 ATGAGATTAGGGAGGGGGGAGGG + Intronic
1118522732 14:66604851-66604873 TCTAAAGGAGGGAGGGGGGAGGG - Intronic
1126222982 15:46236303-46236325 GAGAGAGTTGGGAGGGCCGAAGG + Intergenic
1128307391 15:66608533-66608555 ACTAGAGTGGGGAGGGAGGAGGG + Intronic
1128585199 15:68843168-68843190 TAGAAAGAAGGGAGGGGGGAAGG + Intronic
1128615406 15:69104977-69104999 TTCAGAGTAGGGAGGGAGGCTGG + Intergenic
1129293051 15:74583348-74583370 TCCAGAGTGGGTAGGGTGGAGGG + Intronic
1129675707 15:77631753-77631775 TGGGGAGTAGGGAGAGTGGAAGG - Intronic
1130054041 15:80507186-80507208 TAGACAGTAGGGAGGGGAGAGGG + Intronic
1130094485 15:80845898-80845920 TCTAGAGGATGGAGGGAGGAGGG - Intronic
1130239372 15:82171715-82171737 TAGAGAGTGGGGAGGGAGGTTGG + Intronic
1131634251 15:94213174-94213196 GGGGGAGTAGGGAGGGGGGAGGG + Intergenic
1132484830 16:185402-185424 TTGGGAGGAGGGAGGGAGGAGGG + Intergenic
1132514811 16:361317-361339 TCGAGGGTGGGGTGGGCCGAGGG + Intergenic
1133588584 16:7220137-7220159 TCGGGAGTGGGGAGGGGAGATGG - Intronic
1133958444 16:10468536-10468558 TCAAGAGCAGGGATGGAGGAGGG + Intronic
1136076588 16:27821428-27821450 GCAAGAGCAGGGAGGGAGGAAGG - Intronic
1136477751 16:30524211-30524233 GCTAGAGCAGGGAGGGGGGAGGG - Exonic
1138256960 16:55573808-55573830 TAGAAAGTAGGGAGGACTGAAGG - Intronic
1140615561 16:76658339-76658361 TCTAGAGTGGGGAGGGAGGGAGG + Intergenic
1141128029 16:81415112-81415134 TCGGGGGGAGGGAGGGCGGGGGG + Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141728378 16:85805863-85805885 TGGTGAGTAGAGAGGGAGGAAGG + Exonic
1142972358 17:3621482-3621504 TGGAGAGAAGGAAGGGAGGAAGG - Intronic
1144548349 17:16217316-16217338 TCGGGAGCAGGGAGGACGGCTGG + Exonic
1144705877 17:17367544-17367566 GCGAGGGAAGGGAGGCCGGAGGG + Intergenic
1146547230 17:33749736-33749758 TGGAGAGCAGGCAGGGCTGACGG - Intronic
1146896237 17:36544465-36544487 TCGAGATCAGAGGGGGCGGAAGG - Intergenic
1149945586 17:60921690-60921712 ACTAGAGTGGGGAGGGAGGAAGG + Intronic
1150124477 17:62627616-62627638 CCGGGCGGAGGGAGGGCGGAGGG - Exonic
1151674904 17:75592337-75592359 CCCAGAGTAGGAAGGGCAGAGGG + Intergenic
1151886469 17:76925859-76925881 CAGGGAGTAGGGAGGGCAGAGGG + Intronic
1151956666 17:77383544-77383566 TGGAGAGTGGGGATGGCTGAGGG + Intronic
1155562973 18:27100253-27100275 TCTAGAGTGAGGAGGGAGGATGG + Intronic
1156192792 18:34739061-34739083 ACTAGAGCAGGGAGGGAGGAAGG - Intronic
1157091322 18:44640492-44640514 TTGAGAGTAGGGTGGGAGGGAGG - Intergenic
1157523428 18:48361036-48361058 TAGAGGCTAGGGAGGGAGGAAGG + Intronic
1158468731 18:57714577-57714599 GGGAGAGGAGGGAGGGGGGAAGG + Intronic
1160091956 18:75835440-75835462 TTGAGAGTAGTGTGGGCTGAAGG + Intergenic
1162053827 19:8051072-8051094 TGAAGATTAGGGAGGGCGAAAGG - Intronic
1166672409 19:44718872-44718894 TGGAGAGCAGGGAGGAGGGAAGG + Intergenic
1167515055 19:49918474-49918496 CCAATAGTAGGGAGGGAGGAAGG + Intronic
1168501904 19:56899949-56899971 TCAAGAGAAGGGAAGGAGGAAGG + Intergenic
927053065 2:19348856-19348878 TCTTGGGCAGGGAGGGCGGAAGG - Intergenic
928410696 2:31051916-31051938 ATGAGAGTTGGGTGGGCGGAGGG - Intronic
929319316 2:40522476-40522498 TGGAGATTTGGGAGGGCGGGAGG + Intronic
929896242 2:45963130-45963152 TCGATAGAAGGGAGGATGGAAGG + Intronic
930568204 2:53049660-53049682 TGGGGTGTAGGGAGGGGGGAAGG + Intergenic
931288694 2:60853934-60853956 TCGAGAATAGGAAGAGAGGAAGG - Intergenic
933124920 2:78593202-78593224 AGGAGAGGAGGGAGGGAGGAAGG - Intergenic
933252002 2:80039174-80039196 TGGAGGGTAGGGAGGATGGAAGG + Intronic
934331824 2:92075314-92075336 ATGAGAGAAGGGAGGGAGGAAGG + Intergenic
934686676 2:96326445-96326467 TCGAGAGAAAAGAGGGCGAAAGG - Exonic
935341784 2:102065387-102065409 TGGAGAACAGGGAGGGCGGTGGG - Intronic
935700520 2:105807846-105807868 TAGAGAGAAGGGAGGGAGGGAGG - Intronic
935716995 2:105947978-105948000 GGGAGTGTAGGGAGGGAGGAAGG + Intergenic
936887757 2:117333690-117333712 TGGAGAGTAGGGAGAGGGAAAGG + Intergenic
938112488 2:128578392-128578414 TGGAGAGGAGGGAGGGAGGAAGG - Intergenic
938516120 2:132009493-132009515 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
940453703 2:153871756-153871778 GCGGGAGCAGGGAGGGAGGAGGG + Intergenic
940767538 2:157806387-157806409 TGAAGAGTAGGGATGGAGGATGG - Intronic
941490113 2:166133216-166133238 TCGATAGCAGGGAAGGCAGAGGG - Intergenic
942384857 2:175431837-175431859 TAGAAAGGAGGGAGGGAGGAAGG + Intergenic
945200171 2:207273276-207273298 TCGGAAGGAGGGAGGGAGGAGGG - Intergenic
946077832 2:217090076-217090098 TGGAGGGTAGGGAGGGAGGACGG + Intergenic
946753170 2:222914201-222914223 TAGAGAGAAGGAAGGGTGGAAGG + Intronic
948266003 2:236635755-236635777 TCGGGAGTGGGGAGGGCGGGTGG - Intergenic
948476941 2:238226492-238226514 CCGAGAGTGGGGAGGGCGGTGGG + Intronic
948584806 2:239012607-239012629 TCCACAGTTGGGAGGGAGGATGG - Intergenic
948871955 2:240805113-240805135 GAGAGGGGAGGGAGGGCGGAGGG + Intronic
1171279101 20:23881547-23881569 TCAGGAGTAGGGAGGGTGGAAGG + Intergenic
1171766287 20:29282998-29283020 TGGAGTGTGGGGAGGGGGGAGGG + Intergenic
1172114017 20:32563150-32563172 TGGAGTGCAGGGAGGGTGGAGGG + Intronic
1172540727 20:35713758-35713780 TAGAGATTAGGGTGGGAGGATGG + Intronic
1173760459 20:45555260-45555282 TGGAGAGTAGGGTGGGGTGAAGG - Intronic
1174673014 20:52325251-52325273 TGGGGAGTAGGGAGGGCAGGTGG + Intergenic
1179218583 21:39387665-39387687 TGGGGAGTAGGGGGGGTGGAGGG - Intronic
1179228302 21:39476184-39476206 TGGAGAGTAGGGAAGGCAGGAGG + Intronic
1179645103 21:42770850-42770872 TCTGGAGTCGGGAGTGCGGAGGG - Intronic
1180231566 21:46429614-46429636 TCTAGACAACGGAGGGCGGAGGG - Intronic
1182299475 22:29329665-29329687 ACAAGACTGGGGAGGGCGGACGG + Intronic
1182474077 22:30566531-30566553 TCCAGAGTAGGGAGCACTGATGG + Intronic
1183054435 22:35294785-35294807 AGGAAAGAAGGGAGGGCGGAAGG - Exonic
1183138306 22:35911828-35911850 TCCAGAGTATGGAGTGGGGAAGG - Intronic
1183244379 22:36682485-36682507 TCGGGAGTGGGGTGGGGGGAGGG - Intronic
1183545156 22:38451526-38451548 TGGAGAGAAGGGAGGGAGAAAGG + Intronic
1183730905 22:39617837-39617859 CAGAGAGCAGGGAGGGAGGAGGG - Intronic
1184035301 22:41915137-41915159 GAGAGAGGAGGGAGGGCGGAAGG + Intergenic
1185051199 22:48555177-48555199 CCGAGTGAAGGGAGGGAGGATGG + Intronic
950109755 3:10411470-10411492 TCGACAGGAGGGAGAGCGGAAGG - Intronic
953830839 3:46296593-46296615 TCAAGACTAGGGAGGGGGCATGG - Intergenic
955628079 3:60941504-60941526 TCTAGAGAAGGGAGAGCAGAGGG - Intronic
955709154 3:61760752-61760774 TGGAGAGCAGGGAGGGGCGAGGG - Intronic
959665685 3:108918181-108918203 TGGAGAGTAGAGAGGGCGTAGGG - Intronic
961004635 3:123396712-123396734 GAGAGAGAAGGGAGGGAGGAAGG + Intronic
961042999 3:123690461-123690483 TGGGGAGTAGGGAGAGCTGAGGG + Intronic
961353142 3:126316584-126316606 TCCAGAGTGGGGAGTGGGGAAGG + Intergenic
961812063 3:129527696-129527718 TGGAGTGGAGGGAGGGAGGATGG - Intergenic
962969059 3:140382080-140382102 TAGAGAGATGGGAGGGTGGAGGG - Intronic
963284691 3:143422590-143422612 ACTAGAGGAGGGAGGGAGGAGGG + Intronic
966406035 3:179599347-179599369 TGGAGAGTAGAGAAGGCAGATGG + Intronic
966886474 3:184380231-184380253 GCGGGAGTGCGGAGGGCGGAGGG - Exonic
966886492 3:184380279-184380301 TGGGGAGGAGGGAGGGAGGAGGG - Exonic
966935905 3:184709338-184709360 TCGGGGGCAGGGTGGGCGGATGG - Intergenic
968657537 4:1785201-1785223 CCCAGAGAAGGGAGGGTGGAAGG + Intergenic
969313280 4:6366722-6366744 TCAGGAGAAGGGATGGCGGATGG + Intronic
970328041 4:14948827-14948849 GAGAGAGAAGGGAGGGGGGAGGG - Intergenic
972662620 4:41130776-41130798 TGGAGAGAAGGGAGGGCGGATGG - Intronic
973316022 4:48760972-48760994 TAGAGAGTAGCGAGGGTGGCCGG - Intronic
973925680 4:55735202-55735224 ACAAGAGTGGGGAGGGAGGAAGG + Intergenic
974593846 4:63991140-63991162 TCCAGAGGAGGGAGGGTGGAAGG + Intergenic
975837627 4:78441328-78441350 TTGAGAGAAGGGAGGGGAGAGGG + Intronic
977023390 4:91786166-91786188 TGGGGTGGAGGGAGGGCGGAGGG - Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978607805 4:110501427-110501449 TTGAAAGTAGAGAGGGAGGAGGG - Intronic
980505878 4:133720592-133720614 AAGAGAGAAGGGAGGGAGGAAGG + Intergenic
981592985 4:146385746-146385768 ACTAGAGTCGGGAGGGAGGAAGG - Intronic
984675555 4:182543236-182543258 TGGAGGGAAGGGAGGGAGGAAGG + Intronic
989953212 5:50325942-50325964 TAGAGACTTGGAAGGGCGGAGGG - Intergenic
989963313 5:50441000-50441022 TCCAGGGTAGGGAGGGCGGAGGG - Intronic
990401793 5:55445442-55445464 TGGAGAGTAGGGAGGAGGAAAGG - Intronic
991371653 5:65925854-65925876 GCGAGGGGAGGGAGGACGGAGGG - Intergenic
993481188 5:88426324-88426346 TGGGGAGAAGGGAGGGAGGAAGG + Intergenic
993644205 5:90443160-90443182 TGGGGAGTGGGGAGGGGGGAGGG - Intergenic
995317389 5:110791368-110791390 ACTAGAGTAGGGAGGGTGGGAGG - Intergenic
996595079 5:125191451-125191473 TTGAGAGGAGGGAGGGAGGGTGG - Intergenic
1001279543 5:170376955-170376977 TGGATAGTTGGGAGGGCTGAAGG - Exonic
1001759981 5:174199407-174199429 TCTAGAGGCGGGAGGGAGGAAGG - Intronic
1001933145 5:175687180-175687202 TTGAGGGCATGGAGGGCGGAGGG + Intergenic
1004226535 6:13789818-13789840 TGGAGAAGAGGGAGGGAGGAGGG + Exonic
1004808158 6:19226817-19226839 TCGGGTGGAGGGAGGGGGGAGGG + Intergenic
1006395065 6:33781872-33781894 CCGAGAGCAGGGAGGGTGCAGGG + Intronic
1006948380 6:37800830-37800852 TCCAGAGCAGGGAGGATGGAGGG + Intergenic
1007110951 6:39313398-39313420 TCGAGAGGAGGGCGGACGCAGGG - Intronic
1007576640 6:42929423-42929445 GCGAGAGGAGGGCGGGCGGGAGG + Exonic
1009457393 6:63873143-63873165 TGGGGTGTAGGGAGGGGGGAGGG - Intronic
1012412185 6:98971224-98971246 TAGAGAGTAGGGTGGGCTGGAGG + Intergenic
1015843057 6:137493526-137493548 TAGCGAGTGGGGAGGCCGGATGG + Exonic
1017775076 6:157674200-157674222 TCGGAAGTAGGGAGAGGGGAGGG + Exonic
1018380561 6:163254747-163254769 ACGAGAGAAGGGAGTGAGGAGGG - Intronic
1020363614 7:7356358-7356380 TAGAGAGCTGGGATGGCGGAGGG + Intronic
1020808760 7:12825291-12825313 ACTAGAGGAGGGAGGGTGGAGGG + Intergenic
1021340877 7:19460851-19460873 TGGGGAGTGGGGAGGGGGGAGGG + Intergenic
1022222737 7:28330019-28330041 TCAAGAGTAGGGAGGTCCCATGG - Intronic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023434015 7:40123364-40123386 TGGAGAGTAGGAAGGGTGGGAGG + Intergenic
1023741879 7:43288309-43288331 CCGGGAGCAGGGAGGGAGGAAGG + Intronic
1024628564 7:51229401-51229423 GCGAGAGTTGTGAGGGAGGAAGG + Intronic
1026795692 7:73364562-73364584 CCGAGAGTAGGAAAGGCGGCGGG + Intergenic
1027578475 7:79961473-79961495 TCCAGAGTAGGTAGGTCTGAAGG + Intergenic
1029150289 7:98475532-98475554 GGGAGAGAAGGGAGGGAGGAAGG + Intergenic
1030688591 7:112510415-112510437 ATGAGAGTAGTGAGGGAGGAAGG + Intergenic
1031143469 7:117971948-117971970 AAGAGAGAAGGGAGGGAGGAAGG - Intergenic
1032806652 7:135361672-135361694 TCAACAGTGGGGAGGGAGGATGG - Intergenic
1033354918 7:140591939-140591961 AGGGGAGTAGGGAGGGGGGAGGG - Intronic
1034439839 7:151080971-151080993 TGGGGAGAAGGGAAGGCGGAGGG + Intergenic
1034844134 7:154428841-154428863 TCGCAAGTGGGGAGAGCGGAAGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035425029 7:158764938-158764960 TCGAGAATTGGGAGTGCCGAGGG + Intronic
1037221965 8:16534608-16534630 TCAAAAGTGGGGAGGGAGGAGGG + Intronic
1041274815 8:56146292-56146314 TTGAGTGGGGGGAGGGCGGAGGG - Intergenic
1041546803 8:59054947-59054969 AAGAGAGGAGGGAGGGAGGAAGG + Intronic
1042399546 8:68330528-68330550 GCTAGAGTAGGCAGGGCAGAAGG + Intronic
1042648868 8:71017431-71017453 TTGAGAGTAGAGAGGTAGGAGGG + Intergenic
1042859252 8:73295845-73295867 TCCGGGGTAGGGAAGGCGGAGGG + Intronic
1043274932 8:78381223-78381245 TGGGGTGCAGGGAGGGCGGAGGG - Intergenic
1045367737 8:101492611-101492633 GCGAGAGTGGTGAGGGGGGACGG + Exonic
1046577215 8:116045492-116045514 ACTAGAGTTGGGAGGGTGGAAGG - Intergenic
1047724911 8:127676024-127676046 TTGAGAATAGGTAGGGTGGAGGG - Intergenic
1049442629 8:142616240-142616262 GACAGAGAAGGGAGGGCGGAGGG + Intergenic
1049909120 9:248461-248483 GAGAGAGGAGGGAGGGAGGAAGG - Intronic
1050009425 9:1171031-1171053 TCTAGAGTAGGAAGAGGGGAGGG + Intergenic
1050297650 9:4222116-4222138 TGGAGAAGAGGGAGGGAGGAAGG - Intronic
1050624045 9:7484872-7484894 TGGAGGGTAGGGTGGGAGGAAGG + Intergenic
1050809874 9:9731600-9731622 TGGGGTGTAGGGAGGGGGGAAGG - Intronic
1053280509 9:36817422-36817444 GAGAGAGGAGGGAGGGAGGAAGG + Intergenic
1053307652 9:36995523-36995545 TCAACAGTGGGGATGGCGGACGG + Intronic
1055824501 9:80307147-80307169 AGGAGAGGAGGGAGGGAGGAGGG - Intergenic
1056101278 9:83302606-83302628 TTGATATTAGGGAGGGAGGAAGG - Intronic
1057142939 9:92738508-92738530 TTGAGAGTGGGGAGGGAGGGGGG - Intronic
1061281982 9:129602751-129602773 GAGAGAGAAGGGAGGGAGGAAGG + Intergenic
1187028703 X:15463026-15463048 TCAAGAGGAGGGAGAGAGGAGGG - Intronic
1187034350 X:15522222-15522244 AGGAGAGAAGGGAGGGAGGAAGG - Intronic
1187635036 X:21218760-21218782 TGGGGTGTAGGGAGGGGGGAGGG - Intergenic
1188563606 X:31499198-31499220 TGGGGAGTAGGGAGAGAGGAAGG + Intronic
1189750165 X:44212543-44212565 TCTAGAGTAGGGGGAGGGGAGGG + Intronic
1193414407 X:81204034-81204056 TACAGAGGAGGGAGGGAGGAAGG - Intronic
1197399925 X:125977754-125977776 TTGAGAAAAGGGCGGGCGGAGGG + Intergenic
1198776001 X:140179533-140179555 TGAAGAGTAGGGAGGGAGAAGGG - Intergenic
1198930274 X:141850218-141850240 ACTAGAGCAGGGAGGGAGGAAGG + Intronic
1199872068 X:151907547-151907569 TGGAGAGAAGGAAGGGAGGAAGG + Intergenic
1199928105 X:152490726-152490748 TGGGGAGTGGGGAGGGGGGAGGG + Intergenic
1201329002 Y:12798109-12798131 TCGAAAGAAGGAAGGACGGAAGG - Intronic
1202302999 Y:23437567-23437589 ACGAGGGTAGGGAGGTTGGATGG - Intergenic
1202567812 Y:26233027-26233049 ACGAGGGTAGGGAGGTTGGATGG + Intergenic