ID: 1083738571

View in Genome Browser
Species Human (GRCh38)
Location 11:64695426-64695448
Sequence GTCAAGTGGGAAGAAGGCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083738568_1083738571 -10 Left 1083738568 11:64695413-64695435 CCTCAGGCACAGTGTCAAGTGGG 0: 1
1: 0
2: 0
3: 16
4: 188
Right 1083738571 11:64695426-64695448 GTCAAGTGGGAAGAAGGCGAAGG 0: 1
1: 0
2: 2
3: 17
4: 210
1083738565_1083738571 6 Left 1083738565 11:64695397-64695419 CCTGGAGAAAGCTAGGCCTCAGG 0: 1
1: 0
2: 2
3: 18
4: 231
Right 1083738571 11:64695426-64695448 GTCAAGTGGGAAGAAGGCGAAGG 0: 1
1: 0
2: 2
3: 17
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083738571 Original CRISPR GTCAAGTGGGAAGAAGGCGA AGG Intronic
901536126 1:9883922-9883944 GTCAAGGAGGAAGAAGGTGGGGG + Intronic
901731854 1:11285740-11285762 GACCAGTGGGAAGATGGCCAGGG - Exonic
901843152 1:11966224-11966246 GGGAAGTGGGAAGCAGGCTAGGG - Intronic
903774621 1:25784884-25784906 GTCAAGAGGGGAGAAAGCGATGG + Exonic
904969568 1:34408602-34408624 AACAAAAGGGAAGAAGGCGAGGG - Intergenic
905295391 1:36951426-36951448 GTGCAGTGGGAAGAAGACAAAGG - Intronic
905297469 1:36963224-36963246 GCCAAGTGGGCAGGAGGCAAAGG - Intronic
906300540 1:44678303-44678325 GGCAAGTGGGGAGAAGATGAAGG + Intronic
907891619 1:58641983-58642005 GTCTAGTGGGAAGTAGACAAGGG - Intergenic
908201502 1:61800721-61800743 GTGGGGTGGGAAGAAGGGGAGGG - Intronic
910034918 1:82777912-82777934 CTCAAGTGGGAAGAAGCAGAGGG - Intergenic
911791074 1:102015612-102015634 GTAATGTGGGAAGAAGCTGAAGG - Intergenic
912680408 1:111725566-111725588 GTCTAGTGGGGAGAAGGCCACGG + Exonic
915495903 1:156282550-156282572 GGGAAGTGGGGAGACGGCGAGGG - Intronic
915631653 1:157157311-157157333 GGCAAGTGAGAAGAAGGTGAGGG + Intergenic
916463213 1:165047739-165047761 CTGAAGTGGGAAGAGGGTGAGGG - Intergenic
917017004 1:170543430-170543452 GAGAAGAGGGAAGAAGGTGATGG + Intronic
918016045 1:180632778-180632800 GGCAAGTGGGAAAAAGCCGAAGG - Intronic
918138637 1:181700973-181700995 GTCAAGTGGAACCAAGGAGAAGG - Intronic
920649081 1:207823416-207823438 GTCAGGTGGGAAGCAGGGGATGG + Intergenic
922165909 1:223115703-223115725 GTAAAGTGGGAAAAAGGAGATGG + Intronic
922416018 1:225424028-225424050 GTGAAGTGGTAAGAGGTCGATGG - Exonic
922628199 1:227075044-227075066 CTCAAGTGGGGAGAAGGTGAGGG + Intronic
924703178 1:246474852-246474874 GTCAAGTAGCAGGAAGGGGAAGG + Intronic
1064102794 10:12477724-12477746 GTCAAGGGGGAAGAAGCTGAAGG + Intronic
1064318287 10:14277996-14278018 GTCAGTTGGGAAGAAGGCACTGG - Intronic
1066805716 10:39250683-39250705 GTGGAGTGGGAAGAGGGGGAGGG - Intergenic
1069582598 10:69575883-69575905 GACAAGTGTGAAGAAGGAGAAGG - Intergenic
1070602462 10:77875494-77875516 CCCAAGTGGGAAGAAAGAGAAGG + Intronic
1071308311 10:84319604-84319626 GGCAAATGGGAAGATGGTGAAGG - Intergenic
1072243439 10:93519386-93519408 TTTAAGGGGGAAGAAGGAGAAGG - Intronic
1074713736 10:116199275-116199297 GTCAGGTGAGAAGAAGGCTTAGG - Intronic
1074885437 10:117689320-117689342 GGTAAGGGGGAAGAAGGGGAGGG + Intergenic
1075729425 10:124627499-124627521 GTCAAGAGAGCAGAAGTCGACGG - Intronic
1077076521 11:704855-704877 GCCAAGTGGGAAACAGGCGCTGG - Intronic
1078033993 11:7783699-7783721 GTCAAAAGGAAAGAAGGCCAAGG + Intergenic
1078646222 11:13143201-13143223 GTCTATTGGGTAGAAGGCCAGGG + Intergenic
1083295430 11:61712758-61712780 GGCCACTGGGAAGAAGGGGAAGG + Intronic
1083738571 11:64695426-64695448 GTCAAGTGGGAAGAAGGCGAAGG + Intronic
1086915130 11:92521627-92521649 GTCAATTGGGTAGAAAGTGAAGG + Intronic
1087127331 11:94640856-94640878 GACAGGTGGGAAGAGGGGGATGG - Intergenic
1087509064 11:99067022-99067044 AATAAGTGGGAAGAAGGCTAAGG - Intronic
1088729064 11:112664699-112664721 GTCATGTGGGAAGAGAGGGAAGG + Intergenic
1089038881 11:115426693-115426715 GTAAAGGGGGAAGCAGGGGAGGG - Intronic
1090204087 11:124875365-124875387 GACAAGAGGGAAGAAGGGGTGGG + Intronic
1091232502 11:133997897-133997919 GGCAAGTGGGGAGAAGGCACTGG - Intergenic
1091356861 11:134944108-134944130 GACCAGTGGGAAGCAGGAGAAGG + Intergenic
1091816709 12:3444349-3444371 GGCAAGCAGGAAGAAGGGGAAGG + Intronic
1092957030 12:13560597-13560619 CTCCAGGAGGAAGAAGGCGAAGG - Exonic
1094484147 12:30910851-30910873 GAGAAGTGGGAAGAAGACAAAGG + Intergenic
1094488266 12:30941904-30941926 AAGAAGTGGGAAGAAGGCAATGG - Intronic
1096054999 12:48643075-48643097 GGCAAGTGAGAAGCAGGTGAGGG + Intergenic
1099590695 12:84585266-84585288 GTGTAGTGGGAAAAAGGAGATGG - Intergenic
1100335686 12:93626876-93626898 GTCAAGTGGGAGCAAGGTGAGGG - Intergenic
1100631667 12:96395802-96395824 GTGAAGTGGGAGGGAGGGGAGGG - Intronic
1101940789 12:109097842-109097864 GTGAAGGGGGAGGAAGGCGGTGG + Intronic
1103394495 12:120597432-120597454 GTGAAGAGGGAAGAATGAGACGG + Intergenic
1105383358 13:19907931-19907953 ATCAAGTGTGAAGAAAGAGAGGG - Intergenic
1106843675 13:33713520-33713542 TTAAAGTGGGAAGAAGGAGAAGG - Intergenic
1108415339 13:50192668-50192690 GTCCACTGGGAAGAAGGGAATGG + Intronic
1112450255 13:99501546-99501568 GTCAAGAGGGAAGGAGGGGTGGG - Exonic
1113273500 13:108701451-108701473 GTAAGGTAGGAAGAAGGGGAGGG - Intronic
1113776731 13:112951968-112951990 GTGAAGTGGGAAGAGGGAAAAGG + Intronic
1115270099 14:31541850-31541872 GTCAAGTGGGGACAAGCCTAAGG + Intronic
1115498219 14:34027308-34027330 GGGAAGGGGGAAGAAGGGGAGGG + Intronic
1117194980 14:53330810-53330832 GCCAGGTGGGAAGAAAGCAATGG + Intergenic
1119135319 14:72213020-72213042 GTCAAGTGGGAAGGGGTGGAGGG + Intronic
1119476634 14:74934309-74934331 TTCTAGGGGGAAGAAGGGGAAGG + Intergenic
1120925534 14:89793704-89793726 GGCAAGTGAAAAGAAGGGGAAGG + Intergenic
1121075386 14:91063806-91063828 GTGAAGTGGGAAGCAGTAGAAGG + Intronic
1121739601 14:96242140-96242162 GGCAAGAGGGAAGAAAGAGAAGG + Exonic
1124224346 15:27879002-27879024 GTCAAGGGGGAAAAGGGGGAGGG - Intronic
1124394705 15:29291083-29291105 GTCTAGGGGGAAGAAAGGGATGG - Intronic
1126840418 15:52712174-52712196 CTCAACTGGGAAGAAGGCAGGGG + Intergenic
1127484690 15:59408130-59408152 GCCAAAAGGGAAGAAGGCCAAGG - Intronic
1129010381 15:72410683-72410705 GTTAAGTGGGAAGAGAGAGAGGG + Intergenic
1130562611 15:84970458-84970480 GAAAAGTGGGAAGTAGGTGAGGG + Intergenic
1130997490 15:88912072-88912094 GTCCAGTGGGAAAAAGGGAAAGG + Intronic
1131075919 15:89494896-89494918 GTCAAGTGGGAAGCAAGTGCGGG + Intronic
1131143731 15:89998970-89998992 CACAAGTGGGAAAAAGGGGAGGG - Intergenic
1131192172 15:90325578-90325600 CTCAAGGCGGAAGAAGGTGAAGG + Intergenic
1134068447 16:11245549-11245571 GTCAAGTGAAAAGAAAGCAAGGG + Intergenic
1135323053 16:21509637-21509659 GTCAAGTGGGCAGAGCACGAGGG - Intergenic
1136468054 16:30458845-30458867 GGCAGGTGGGAAGAAGGGGAAGG + Intergenic
1137622117 16:49883013-49883035 GTTCAGTGGGAAGAGGGCCAGGG + Intergenic
1138339262 16:56278147-56278169 TTCAAGTAGGAAGGAGGGGAAGG + Intronic
1139282931 16:65785387-65785409 GTCAGGCGGGAACAAGCCGAGGG - Intergenic
1139709267 16:68763431-68763453 GTAAAGTGGGGAGGAGGCTAGGG - Intronic
1140991117 16:80212572-80212594 GGCAAATGGGATGAAAGCGAGGG + Intergenic
1141278074 16:82606094-82606116 GTCCAGGGGGAAGAGGGCTAAGG - Intergenic
1141801078 16:86309708-86309730 GTCACTTGGGTAGAAGGTGAGGG - Intergenic
1142890019 17:2937182-2937204 GTGGAGTGGGAAGGAGGAGAGGG + Intronic
1142894582 17:2965594-2965616 GTCAAGTGCGAGGAAGCAGAGGG + Exonic
1143582414 17:7834858-7834880 GGGTGGTGGGAAGAAGGCGAAGG - Intergenic
1144182162 17:12762576-12762598 TTCAAGTGGGGAAAAGGCAATGG + Intronic
1144765159 17:17728555-17728577 GTCAAGTGGGAAGGTGTTGAGGG + Intronic
1146797192 17:35790816-35790838 GTCAAGTGGGAAGTGAGAGATGG - Intronic
1147162405 17:38575825-38575847 GCCAAGGGGAAAGAAGGCCACGG - Intronic
1147179267 17:38674349-38674371 GGCAAGGGCGCAGAAGGCGAGGG + Exonic
1147358034 17:39912708-39912730 GTCATGTGGTAAGAAGGTGGAGG - Intronic
1150436717 17:65159728-65159750 GTGAAGTGGGAAGGAGAGGAAGG + Intronic
1152025654 17:77807354-77807376 GCCAAGTGGAAAGATGGGGAGGG - Intergenic
1152439413 17:80296520-80296542 GTTCAGTGGTGAGAAGGCGATGG + Intronic
1155704203 18:28787844-28787866 GACAGGTGGGAAGAAGCTGAGGG - Intergenic
1156485063 18:37460055-37460077 GCCAAGGGGGAGGAAGTCGAAGG + Intronic
1163267010 19:16227629-16227651 GTCGGGTGGGATGAAGGAGATGG - Exonic
1163693445 19:18750265-18750287 GTCCAGTGGGAAGCAGTGGAAGG - Intronic
925212598 2:2062748-2062770 CTCAAGAGGTAAGAAGACGAGGG - Intronic
928435798 2:31253736-31253758 GTCTTGTGGGAAGAAGGCTGGGG + Intronic
928642797 2:33318304-33318326 GTGAAGTGGGAAGTAGGTGGTGG + Intronic
931442788 2:62303213-62303235 GTCAAGAGGGAAGAAATAGAGGG - Intergenic
931471978 2:62547539-62547561 GTGAAATGGGAAGAAAGCAAGGG - Intergenic
931716131 2:65030107-65030129 GGAAAGTGGGGAGAAGGCCAGGG - Intergenic
935422381 2:102883222-102883244 GTTTAGTGGGGAGAAGGGGATGG - Intergenic
935511590 2:103982865-103982887 GTCATTTGGGAAGAAGGCAGAGG + Intergenic
935949542 2:108316337-108316359 GAGAGGTGGGAAGAAGGAGAGGG - Intergenic
935959854 2:108414198-108414220 ATCAAGGTGGAAGAAGGCTAGGG - Intergenic
936762918 2:115807709-115807731 GACAAGTAGGAGGAAGGCTAGGG + Intronic
937363075 2:121242529-121242551 GTGAGGTGGGAAGCAGGAGAGGG - Intronic
938707420 2:133944631-133944653 GTCATGGGGGAAAAAGGGGAGGG + Intergenic
941885914 2:170527210-170527232 GTCCAGTGAGAAGAAGGCAGAGG + Intronic
942728029 2:179032060-179032082 GTAAAGTGGGAAGACAGAGAAGG - Intronic
944073543 2:195701022-195701044 GTCAAGTAAGATGAAGGGGAGGG - Intronic
946179206 2:217939877-217939899 GGCAAGTAGGAAGATGGCCAAGG + Intronic
946394307 2:219435463-219435485 GGCACCTGGGAAGAAGGCGGCGG - Intronic
948227257 2:236320850-236320872 ATGAAATGGGAGGAAGGCGATGG - Intergenic
948251907 2:236536163-236536185 GTGAAGTGGGGAGAAGGGCAAGG + Intergenic
1168752245 20:290933-290955 GCCAAGAGTGAAGATGGCGAAGG - Intergenic
1170616328 20:17955206-17955228 GTCAAGTGGAAAGTATGTGAAGG - Intronic
1172998721 20:39090512-39090534 GTCTACTGGGAAGAATGAGATGG + Intergenic
1173639690 20:44592224-44592246 CACAATTGGGAAGAAGGAGAAGG + Intronic
1173687819 20:44936548-44936570 GGCAAGTGAGCAGAAGGCCAGGG - Intronic
1175452081 20:59077873-59077895 GAGAAGGGGGAAGAAGGAGAAGG + Intergenic
1175598357 20:60253436-60253458 CTCAGGTGGGAAGAAGCTGATGG + Intergenic
1175632377 20:60552571-60552593 GTCATGGGAGAAGAAGGAGATGG + Intergenic
1175692516 20:61075812-61075834 GTGAAGGGGGAAGAAGGAGAAGG + Intergenic
1175940092 20:62533806-62533828 GTCATGGGGGAAGAAGGAGGCGG + Intergenic
1175973407 20:62698580-62698602 GTCCAGTGGGCAGAAGACCAGGG - Intergenic
1176981509 21:15386694-15386716 GTCAAGAGGGAAGAAGCAGCTGG + Intergenic
1178532171 21:33384992-33385014 GTCAAGAGTGAAGAATTCGAAGG + Intergenic
1178743303 21:35223569-35223591 GTCAGGTGGGTAGATGGAGAGGG + Intronic
1178817690 21:35946566-35946588 GTCAGATGGGAGGAAGGAGAAGG - Intronic
1179431897 21:41327042-41327064 GTCAGGTGGGAGGAAGGCCCGGG + Intronic
1181567786 22:23750452-23750474 GAAAATTGGGAAGAAAGCGAGGG - Intronic
1182416235 22:30223160-30223182 GTCCAGTGGGAAGACGGACATGG - Intergenic
1182625545 22:31643183-31643205 GTCACATGGCAAGAAGGCGTGGG + Intronic
1183279576 22:36924706-36924728 GTCAAGTAGGAAGAAGGCGGAGG - Intronic
1183284037 22:36951599-36951621 GTCAAGTAGGAAGAAGGCGGAGG + Intergenic
1185111833 22:48904580-48904602 GACAAGAGTGAAGATGGCGAAGG + Intergenic
950883656 3:16344484-16344506 GGCGAGGGGGAAGAAGGCCAGGG - Intronic
952059714 3:29492699-29492721 GTCCAGTGGGAGGAAGGATATGG + Intronic
953418327 3:42735625-42735647 GGCAAGTGGAAAGAAGTGGAAGG + Intronic
953982452 3:47419519-47419541 ATCAGGTGGGAAGATGGAGAAGG + Exonic
954289411 3:49641893-49641915 CTGAAGTGGGAAGCAGGGGAAGG + Intronic
954792248 3:53142112-53142134 GTCAAGTAGGCAGAAGGGGCTGG - Intergenic
954857643 3:53660394-53660416 GTCAACTGTGAAGGAGGCCATGG - Intronic
955331436 3:58050671-58050693 GTCAGGTGGGATGGAGGCCAGGG - Intronic
958638632 3:96777274-96777296 GATAACTGGGAAGAAGGCGGAGG + Intergenic
959582977 3:108000932-108000954 GTCAAGGGGGAAGAAGGTACAGG - Intergenic
962102036 3:132352780-132352802 GTCAAGTGGCAAGAAGCATAGGG - Exonic
965354582 3:167657822-167657844 GTCAAGAGGCAAGAAGATGATGG - Intergenic
965771407 3:172185301-172185323 GTACAGTGGGAAGAAGATGAGGG - Intronic
966162869 3:176986190-176986212 GTGAAGTGGGAAGAGAGTGATGG - Intergenic
966586823 3:181635482-181635504 GTCTTGTGGGAAGTAGGAGAAGG - Intergenic
970968172 4:21950837-21950859 GGCAAGTGGGAAGAATGCATTGG - Intergenic
971417223 4:26442851-26442873 GTCAAGGGTAAAGAAAGCGATGG - Intergenic
973703992 4:53563870-53563892 GTCAAGGGGGTGGGAGGCGAAGG + Intronic
976498524 4:85758649-85758671 GGCAAGTGGGAAGATGGACAAGG + Intronic
977641432 4:99361963-99361985 GTCAAGAGGAAAGAAGCTGAAGG + Intergenic
980377436 4:131968036-131968058 GGCAAGGGGAAAGAAGGGGAAGG + Intergenic
981331463 4:143514401-143514423 GTCTAGTGGGAAAAAAACGATGG - Intronic
983414044 4:167433393-167433415 GCCAAGTTGGAAAAAGGAGAAGG - Intergenic
988831066 5:34987851-34987873 GTCAAGTAGGATGAAGGCTGAGG + Intergenic
990149924 5:52805172-52805194 ATTAAGTGGGAAGATGGGGAGGG + Intronic
990358559 5:54995520-54995542 GGCAGGTGGGAGGAAGCCGAAGG - Intronic
991202042 5:64006045-64006067 ATGAAGTGGGAAGAAGACAAGGG - Intergenic
991969166 5:72122191-72122213 GGCAAGTGGGAGAAAGGCTAGGG - Intronic
996425001 5:123304850-123304872 CTCAGGTGGGAAGAAGGAGGTGG - Intergenic
996642403 5:125771997-125772019 GTTGAGTGGGTAGAAGGTGAGGG + Intergenic
996706805 5:126506178-126506200 GTGAAGTTGGAAGCAGGGGATGG - Intergenic
997696328 5:135863955-135863977 GGCAAGTGGGAGGAAGTTGAGGG + Intronic
997819541 5:137052213-137052235 GTCAAGTGGTAGGAAGTCCAGGG - Intronic
998687040 5:144539777-144539799 GTCAAGTGGAAATAAAGAGAGGG - Intergenic
1001050382 5:168409297-168409319 GACAAGTGGGAAGACAGCTATGG - Intronic
1001260986 5:170228310-170228332 CTAAAGTGAGAAGAAGGAGATGG - Intergenic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1004000731 6:11594560-11594582 GTCACGAGGGAAGAAGCCAATGG + Intergenic
1004002017 6:11604571-11604593 GTAAAGTGGGAAGGAGGGAAGGG + Intergenic
1007102931 6:39262299-39262321 GTCAAGTGGGAAGAACTAGATGG + Intergenic
1008338282 6:50333272-50333294 GTCATTTGTGAAGAAGGTGACGG - Intergenic
1009539694 6:64938113-64938135 TTCAAGGGGGAAGAAGGAAATGG + Intronic
1012520839 6:100119417-100119439 GTCAACTGGGATGATGGCAAAGG - Intergenic
1015865827 6:137725396-137725418 GACAATTGGGAAGAAGAGGAAGG - Intergenic
1016636789 6:146302165-146302187 GTCAGGTGAGGAGAAGGGGAGGG - Intronic
1018474770 6:164129826-164129848 GTCCTTTGGGGAGAAGGCGAAGG + Intergenic
1019625499 7:2013847-2013869 GTGCAGTGGGAAGAAGGAGCTGG - Intronic
1028674722 7:93445415-93445437 GTCACTTGGGGAGAAGGAGATGG + Intronic
1029650920 7:101890824-101890846 GTAAAGTGAGAAGCAGGAGATGG - Intronic
1030743073 7:113133060-113133082 GATAAATGTGAAGAAGGCGAAGG - Intergenic
1036145033 8:6246996-6247018 ATCATGTGGGAAGAAGGAAAAGG - Intergenic
1037568014 8:20133999-20134021 ATCAAGGTGGAAGAAGGTGAAGG + Intergenic
1038671999 8:29590115-29590137 GTCAAGGAGGAAGGAGGAGAAGG - Intergenic
1039819640 8:41124509-41124531 GACAGGTGGGAAAAAGGAGAAGG + Intergenic
1041418535 8:57641557-57641579 GGCAAGTGGGAAGTAAGAGATGG + Intergenic
1043672597 8:82906285-82906307 TTAAAGTGAGAAGAAGGAGATGG + Intergenic
1045548931 8:103152883-103152905 TTCAAATGGGAAGAAGGAGACGG + Intronic
1046368313 8:113267594-113267616 GTGAATGGGGAAGAAGGGGAGGG + Intronic
1046588132 8:116173014-116173036 GACAGGTGGAAAGAAGGGGAGGG + Intergenic
1049620504 8:143596321-143596343 GGCATGTGGTGAGAAGGCGAAGG + Intronic
1052283466 9:26758360-26758382 GCCCAGTGGGAAGAAGGGCAAGG + Intergenic
1052932182 9:34064776-34064798 GTCCAGTGGGGAGGAGGAGAAGG - Intergenic
1053642432 9:40098410-40098432 GGCAAGGGGAAAGAAGGGGAAGG + Intergenic
1053763707 9:41367066-41367088 GGCAAGGGGAAAGAAGGGGAAGG - Intergenic
1054323304 9:63695700-63695722 GGCAAGGGGAAAGAAGGGGAAGG + Intergenic
1054542323 9:66278234-66278256 GGCAAGGGGAAAGAAGGGGAAGG - Intergenic
1055621128 9:78126132-78126154 GTCAGGTGGGAGGAGGGAGAGGG - Intergenic
1058583892 9:106486333-106486355 GTGAAGTGGGTAGAAGAAGAAGG + Intergenic
1061959114 9:133979067-133979089 GTCAAGTGGGCACATGGGGAGGG + Intronic
1062182263 9:135196762-135196784 GGGAAGTGGGAAGAAGAAGAGGG - Intergenic
1185812165 X:3120713-3120735 GTCAAGAAGGAAAAAGGCAAAGG + Intergenic
1186062531 X:5725694-5725716 GTCAATTGGGAAGAGGGAGAAGG - Intergenic
1187569143 X:20483030-20483052 GGCAAGGGGAGAGAAGGCGAGGG - Intergenic
1188229472 X:27643721-27643743 TTTAATTGGGAAGAAGGCAAAGG - Intronic
1188475773 X:30590067-30590089 GTCAAGTTGGAAGAGAGAGATGG - Intergenic
1190504149 X:51109524-51109546 GACAAGTTGCAAGAAGGTGAGGG - Intergenic
1195745831 X:108117020-108117042 GTCTAATGGGAAGAAAGAGAAGG - Intronic
1197712421 X:129681063-129681085 GTAGAGTGGGAAGAAGTAGAAGG - Intergenic
1198520651 X:137449094-137449116 GTCAAGTGGGAACAAACCCATGG - Intergenic
1200079935 X:153571320-153571342 GTCAAGGGGGAGGGAGGCGGAGG - Intronic
1200133256 X:153862731-153862753 GTACAGTGGCAAGAAGGAGAAGG - Exonic