ID: 1083741456

View in Genome Browser
Species Human (GRCh38)
Location 11:64713679-64713701
Sequence GCATGGCGTCCGGGAGCCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083741456_1083741475 21 Left 1083741456 11:64713679-64713701 CCACCGGCTCCCGGACGCCATGC 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1083741475 11:64713723-64713745 CCGGCCCCCGGCCCCCGCTCAGG 0: 1
1: 2
2: 7
3: 103
4: 794
1083741456_1083741465 2 Left 1083741456 11:64713679-64713701 CCACCGGCTCCCGGACGCCATGC 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1083741465 11:64713704-64713726 ACGGCGGCCCCGGCCCCGCCCGG 0: 1
1: 0
2: 4
3: 48
4: 402
1083741456_1083741467 9 Left 1083741456 11:64713679-64713701 CCACCGGCTCCCGGACGCCATGC 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1083741467 11:64713711-64713733 CCCCGGCCCCGCCCGGCCCCCGG 0: 1
1: 7
2: 47
3: 269
4: 1543
1083741456_1083741462 -8 Left 1083741456 11:64713679-64713701 CCACCGGCTCCCGGACGCCATGC 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1083741462 11:64713694-64713716 CGCCATGCCTACGGCGGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083741456 Original CRISPR GCATGGCGTCCGGGAGCCGG TGG (reversed) Exonic
900120655 1:1047340-1047362 CCAGGGCGTCCTGGAGCTGGAGG + Exonic
900418689 1:2546398-2546420 GGAGGGCGGCCGGGAGGCGGCGG - Intergenic
900601660 1:3505389-3505411 GCATGGGGTCTGGGGGCGGGGGG - Intronic
902690588 1:18108110-18108132 GCATGGTGCCCGGGAGCTGGCGG - Exonic
903665642 1:25005845-25005867 GCATGGAGTTCGGGAGAAGGAGG + Intergenic
905182644 1:36176445-36176467 GCACGGCGTCAGGGGGCTGGCGG - Exonic
905569348 1:38991491-38991513 GCTCGGCGTCCGGGGGCCTGAGG - Exonic
907091596 1:51730052-51730074 GCCTGGCGGCCGGGACCCCGGGG - Intronic
908252221 1:62274249-62274271 GCTTGGCGTAGGGGAGCCAGGGG + Exonic
919742380 1:200988823-200988845 GCAGGGCGTCCAGGAGCAGATGG + Exonic
920223612 1:204422519-204422541 GGATGGAGTCCGGGAGGTGGAGG + Intergenic
920655176 1:207869073-207869095 GCTTGGCGGGCGGGGGCCGGGGG - Intergenic
1069920154 10:71811534-71811556 GCATGGCGGCCAGGAACAGGAGG - Exonic
1071601200 10:86959501-86959523 GGATGGTGTCTGGGGGCCGGCGG - Intronic
1073535695 10:104274961-104274983 CCATGGGGTCCGCGAGCTGGGGG + Intronic
1074382592 10:112992527-112992549 GCAGGGCCTACGGGAGCCGGAGG + Intronic
1076519928 10:131075108-131075130 GCATGGGGGCCGGGAGCGGTAGG + Intergenic
1077283828 11:1757170-1757192 TCAGGGCATCCGGGAGGCGGGGG - Intronic
1083741456 11:64713679-64713701 GCATGGCGTCCGGGAGCCGGTGG - Exonic
1083770507 11:64864376-64864398 GCAGGGAGTCCGGGTGCCCGGGG - Intronic
1084592453 11:70098507-70098529 TCATGGCGTCGGGGTGCTGGAGG - Intronic
1085337408 11:75706600-75706622 ACATGGGGTCCCGGAGCCTGAGG + Intergenic
1088159676 11:106854580-106854602 GCATGCCATCCAGGAGCCTGAGG - Intronic
1091720674 12:2811021-2811043 GCTGGGCGGCCGGGCGCCGGTGG + Intergenic
1096073636 12:48789114-48789136 GCGGGGAGTCCGGGAGCCAGCGG - Intergenic
1096258146 12:50075124-50075146 GCCTGGCATCTGGGAGCTGGTGG - Intronic
1102049892 12:109855038-109855060 GCATGGCGCAGGGCAGCCGGAGG + Intronic
1103339048 12:120211629-120211651 GCACGCCGTCCCGGAGACGGAGG + Exonic
1103393651 12:120591679-120591701 GGAAGGCTTCCTGGAGCCGGTGG + Intergenic
1104942064 12:132399822-132399844 CCCAGGCGTCCGGGAGCCCGCGG - Intergenic
1104986605 12:132601003-132601025 GCCTGGCGCTCGGGAGACGGTGG - Intergenic
1105854970 13:24364757-24364779 GCATGGCGGCCTGCAGCCTGAGG + Intergenic
1108385603 13:49896708-49896730 GAATTGCCTCCGGGAGGCGGAGG - Intergenic
1109304702 13:60625702-60625724 GTATGGTGTCTGGGAGCGGGGGG + Intergenic
1113472634 13:110557799-110557821 GCCTGGCGGCCGGGAGGCGGGGG - Intronic
1117092815 14:52267796-52267818 TCATGGCGTGCGGGAGCAGAGGG - Exonic
1121657392 14:95607216-95607238 GCAAGGCGTCTGGGAGACGTAGG + Intergenic
1122346208 14:101062137-101062159 GGATGGCTTCCGGGACCCAGTGG + Intergenic
1124628923 15:31326457-31326479 GCATGACGTCCGGGGGCGGCGGG - Intergenic
1126702910 15:51383781-51383803 GCAGGACCTCCGGGAGCCGGCGG + Exonic
1128870628 15:71152854-71152876 CCATGGAGTACGGGAGCTGGGGG - Intronic
1131517532 15:93089087-93089109 GCATGCAGCCCGGGAGCAGGAGG - Intronic
1134125751 16:11614936-11614958 GCATGGCTTCCAGGACCCTGTGG + Intronic
1136172613 16:28497806-28497828 TCATGGTGACCGGGGGCCGGAGG + Exonic
1136717032 16:32289327-32289349 GCAAGGCGCCCGGGAGCCGCCGG + Intergenic
1136835409 16:33495572-33495594 GCAAGGCGCCCGGGAGCCGCCGG + Intergenic
1137456750 16:48623482-48623504 GCAGAGCTTCTGGGAGCCGGTGG + Intergenic
1138619087 16:58197733-58197755 GCATGGCGGGCGGGACCGGGGGG + Exonic
1139272591 16:65698034-65698056 GCCTGGGGTCCGGGTGCCTGTGG - Intergenic
1141438104 16:84012444-84012466 GCATGGGGCCTGGGAGCCAGGGG + Intronic
1141741957 16:85899272-85899294 GCCTGGCGTCGGGGACCCCGCGG - Intronic
1203009394 16_KI270728v1_random:228460-228482 GCAAGGCGCCCGGGAGCCGCCGG - Intergenic
1203145581 16_KI270728v1_random:1795894-1795916 GCAAGGCGCCCGGGAGCCGCCGG + Intergenic
1143587548 17:7858035-7858057 CCGTCGCGTCCGGGAGCCGAGGG - Exonic
1144391979 17:14802262-14802284 GCATGGCTGCCGGGAGCCTCAGG + Intergenic
1147307436 17:39573764-39573786 CCATGGTGTCGGGGAGCAGGAGG - Intergenic
1147393209 17:40122446-40122468 GGATGGCGCCCGGGCCCCGGAGG + Intronic
1147971005 17:44219134-44219156 GGACGGCGGCCGGGAGGCGGGGG + Intronic
1149011906 17:51865545-51865567 CCATGGCCTCAGGGAGCCGGTGG + Intronic
1149858079 17:60102659-60102681 GCATGGCGGCCGCGGGCCGCGGG + Intergenic
1156432593 18:37092055-37092077 GCATGCCATCCGGTAGCCTGGGG + Intronic
1160442920 18:78906176-78906198 GGACGGCGTCCGGCAGCCAGCGG - Intergenic
1160529007 18:79552784-79552806 GCATGGCCTCCCGGAGCCTCAGG - Intergenic
1160533116 18:79576980-79577002 GCATGGCCTTGGGGAGGCGGCGG + Intergenic
1160721830 19:600951-600973 GCATGGGTGCCGGGGGCCGGGGG - Intronic
1160987815 19:1847811-1847833 ACATGGGGTCCGGGAAGCGGCGG + Intronic
1161919429 19:7255036-7255058 GCCTGGCTTCCTGGAGCGGGTGG - Intronic
1161925048 19:7293871-7293893 CCATGGCCACCGGGGGCCGGCGG - Exonic
1162216652 19:9140278-9140300 GCATGGCGGCCGTGCCCCGGTGG - Intergenic
1162762554 19:12897213-12897235 GGAAGGCGTCCTGGAGCAGGGGG + Intronic
1163394278 19:17050068-17050090 GCATGGCGCCCCCCAGCCGGTGG - Exonic
1167425137 19:49426335-49426357 GCGTGGCCTCCGGGAGTGGGCGG + Intronic
926982322 2:18584943-18584965 GGATGGAGTCCGGGAGCTCGTGG + Exonic
927567195 2:24123515-24123537 GCGCTGCGTCCGGGAGACGGTGG + Exonic
929118488 2:38464867-38464889 GCAGGGCGTCAGGGAGACAGAGG - Intergenic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
932418314 2:71586795-71586817 GGATGGGGCCCTGGAGCCGGAGG + Intronic
935818097 2:106866560-106866582 GCATGGCCTCTGGGAGCTGTGGG - Intronic
937447754 2:121973128-121973150 GCCTGGAGGCCGAGAGCCGGGGG - Intergenic
938414532 2:131093350-131093372 GCGCGGCGTCCGGGAGGCGGCGG - Exonic
943888382 2:193252650-193252672 GAATTGCTTCCGGGAGGCGGAGG + Intergenic
944683313 2:202096454-202096476 GCATGGCCTTCAGGAGCCAGTGG + Intronic
948151005 2:235744607-235744629 GCATGGCGGCAGGCAGCAGGGGG - Intronic
948598223 2:239094120-239094142 GCAGGGAGGACGGGAGCCGGTGG - Intronic
1169412430 20:5383052-5383074 GCATGGCCTCTGGGGGCCTGAGG + Intergenic
1172422010 20:34825619-34825641 GCAGGGCCTCACGGAGCCGGCGG + Intronic
1175469410 20:59216499-59216521 GCAGGGTTTCCGGGAGCCAGAGG - Intronic
1175992079 20:62794579-62794601 GCGCGGCGGCCGGGAGTCGGAGG + Intergenic
1178992291 21:37366418-37366440 GCGGGGCGGCCGGGAGGCGGCGG + Intronic
1179198086 21:39183953-39183975 CCGTGGCGTCCGGGAGCTGTGGG + Intergenic
1179724386 21:43333676-43333698 ACAGGGCAGCCGGGAGCCGGGGG + Intergenic
1179999050 21:44986922-44986944 GCATGGCACCCCGGAGCCTGGGG - Intergenic
1181022232 22:20109578-20109600 GCTTGGCCTCCTGGAGCCAGTGG + Intronic
1181085484 22:20437699-20437721 GCGCGGCGCCGGGGAGCCGGGGG - Exonic
1181509769 22:23383923-23383945 GCACAGGGTCCGGGAGCAGGTGG + Intergenic
1182549692 22:31094096-31094118 GCAGGGCGGCAGGGAGCTGGGGG - Intronic
1183357772 22:37368727-37368749 GCAAGCCGTCGGGGAGCCTGGGG - Exonic
1183680804 22:39328146-39328168 GCATGGAGACCGAGAGCCAGTGG - Intergenic
1184087731 22:42275275-42275297 GCATGGGGTCCGAGAGTCTGAGG - Intronic
1184294375 22:43514706-43514728 GCATGGAGTCAGGGAATCGGGGG - Intergenic
1185370567 22:50459100-50459122 GCATGCCCTCCGGGTGCCGTGGG - Intronic
1185384663 22:50526267-50526289 GCCTCGCGCCCGGGAGCAGGAGG - Exonic
950767760 3:15286170-15286192 GTATGGCCTCCGGCAGCCAGAGG - Intronic
961326466 3:126112212-126112234 GCATGGCCTCGGGGATCTGGTGG - Intronic
962333670 3:134505527-134505549 GCATGCCATCTGGGAGCCTGAGG - Intronic
968577342 4:1374084-1374106 GCAAGGCGTCCTGGCCCCGGCGG - Intronic
969563777 4:7965732-7965754 GCAGGGCATCCCGGAGCAGGAGG - Intronic
970205826 4:13654639-13654661 GGATGGAGCCCGGGAGCTGGCGG - Intergenic
971406003 4:26321140-26321162 GCTTGGCGTTCGGGGGCCCGCGG + Intronic
971475247 4:27066438-27066460 GCAAGGCGTCGGGGACCCAGAGG + Intergenic
985670618 5:1204718-1204740 AGGTGGCGTGCGGGAGCCGGAGG + Intronic
985849963 5:2381718-2381740 GCTTGGAGGCCGGGAGACGGTGG - Intergenic
985884743 5:2668822-2668844 GCAGGGCCTCTGGGAGCCTGGGG - Intergenic
992106239 5:73451302-73451324 GCTTGGGGGCGGGGAGCCGGGGG - Intergenic
1002021169 5:176365393-176365415 GCAGGCCGCCCGGGACCCGGCGG - Intergenic
1002448025 5:179301997-179302019 GCAGGGAGTCCCGGAGCCTGGGG - Intronic
1003952524 6:11129062-11129084 GCATTGCTACCGGGAGCGGGGGG + Intronic
1015994863 6:138987688-138987710 GCGGGGCGGCCGTGAGCCGGAGG - Exonic
1019048680 6:169167236-169167258 GCCTCGCGTCAGGGAGCCCGGGG - Intergenic
1019765105 7:2844186-2844208 CCATGGCCCCCGGGCGCCGGCGG - Exonic
1021318533 7:19182237-19182259 GCATGTCATCAGGGAGCCTGGGG + Intergenic
1026522874 7:71132001-71132023 GGAACGTGTCCGGGAGCCGGCGG + Intergenic
1028173705 7:87628822-87628844 CCATGGCCTCCCGGAGCCTGGGG + Exonic
1028626276 7:92880909-92880931 GCATGCCATCCGGGGGCCTGGGG + Intergenic
1040015033 8:42692739-42692761 GCAGCGCGTCCAGGAGCCTGCGG + Intergenic
1041083246 8:54233587-54233609 GCATGGCGACCGGGGGGCAGGGG - Intergenic
1047499495 8:125430684-125430706 GCTGTGCGTCCGGGAGGCGGAGG - Exonic
1049100868 8:140578088-140578110 GCATGGGGGCTGCGAGCCGGTGG - Intronic
1049649943 8:143761209-143761231 GGGTGGCGGCGGGGAGCCGGAGG - Intergenic
1049721105 8:144115955-144115977 GCTTGGCCTCCTGCAGCCGGAGG - Exonic
1056406838 9:86282775-86282797 GCGTGACGTCGGGGAGCGGGCGG + Intergenic
1058053294 9:100427270-100427292 GCCCGGCGTTCGGGAGCCCGCGG + Intronic
1061734681 9:132645894-132645916 GCATGGCGGCATGGAGCAGGAGG - Exonic
1061856665 9:133445330-133445352 GCCTGGCGTCCAGGGGCTGGAGG + Intronic
1062237038 9:135515282-135515304 GCATGGGGTCCGTGAGCCAGGGG - Intergenic
1062435529 9:136545193-136545215 GCGGGGCGACCGGGAGCCCGGGG + Intronic
1189185600 X:39052257-39052279 GCAAGGAGTCCGGGAGCCTGAGG + Intergenic
1191860888 X:65666094-65666116 GAATCGCTTCCGGGAGGCGGAGG - Intronic
1192089021 X:68132976-68132998 GCTTGGCGTCCGGGGGCCTGAGG - Intronic
1192434836 X:71136815-71136837 GAATGGGGTCGGGGAGCTGGGGG - Intronic
1194130351 X:90073952-90073974 GCATGGGGTCAGGGAGCTGGTGG + Intergenic
1194807192 X:98344452-98344474 GCATGTTGTCCGGGAGCCTGGGG - Intergenic
1198024496 X:132692022-132692044 GCTTGGAGTCCGGGAGACAGGGG + Intronic
1199736902 X:150693637-150693659 GCTGGGCTGCCGGGAGCCGGCGG - Exonic