ID: 1083742649

View in Genome Browser
Species Human (GRCh38)
Location 11:64719204-64719226
Sequence TTACTTTTCTCACCAAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083742649_1083742650 16 Left 1083742649 11:64719204-64719226 CCAGGGCTTGGTGAGAAAAGTAA 0: 1
1: 0
2: 1
3: 18
4: 200
Right 1083742650 11:64719243-64719265 CACTGCCCCTTTTACAGATGAGG 0: 1
1: 1
2: 17
3: 193
4: 1216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083742649 Original CRISPR TTACTTTTCTCACCAAGCCC TGG (reversed) Intronic
900534757 1:3171366-3171388 TTTCTTTTCTGAACGAGCCCTGG + Intronic
900968078 1:5973348-5973370 TTACTTTTCTAAGTAAGCCAAGG - Intronic
901396375 1:8985131-8985153 TCCCTTTTCTCACCGAGCTCTGG + Intergenic
903101998 1:21038250-21038272 TCAGTTTTCTCTCCAATCCCAGG + Intronic
907627285 1:56042647-56042669 TTCCTTTTCTCACCACCCCAAGG + Intergenic
907878427 1:58518579-58518601 TTAATTTTTTCACCAAGTCCTGG - Intronic
910505748 1:87948541-87948563 GTGCTTTTCTCACCAAGTGCAGG + Intergenic
910520845 1:88120697-88120719 TTACTTTTCCCAATAGGCCCTGG - Intergenic
911117848 1:94264961-94264983 TTACTATTCCCAGCATGCCCTGG + Intronic
911160176 1:94676136-94676158 TAACCTTTCTCACCAATCCCGGG + Intergenic
912126166 1:106541210-106541232 TTACTTATATGACCAAGCCTTGG + Intergenic
916831631 1:168498154-168498176 TTACTTTCTTCACCAACCCCCGG - Intergenic
917638614 1:176960685-176960707 CTTCTTTTTTCACCAAACCCTGG + Intronic
919825154 1:201498358-201498380 GTCCTTTACTCACCAAGTCCTGG - Intronic
922280102 1:224114772-224114794 TGAGTTTTCTCCCCAAACCCAGG - Intronic
1063667072 10:8069066-8069088 TTGCCTTTTTCACCAAGTCCAGG - Intronic
1064514496 10:16131576-16131598 CTCCTTTTCTCTCCCAGCCCTGG + Intergenic
1064986299 10:21213667-21213689 TTACTCTACTCCTCAAGCCCAGG - Intergenic
1072768198 10:98113544-98113566 TTAGTTTTCCTACTAAGCCCTGG + Intergenic
1073287559 10:102397884-102397906 TTCCTTATCTCAGCAACCCCTGG - Intronic
1073297460 10:102449965-102449987 TTACTTTTCTTACTAAGCTGGGG + Exonic
1073448979 10:103598318-103598340 TCACTATTCTCACCAGGCCATGG - Exonic
1073886808 10:108049130-108049152 TTAGATTTCTCTCCAAGCTCTGG - Intergenic
1074282068 10:112061972-112061994 TTAATTTTCTCAACAACCCTAGG + Intergenic
1075225558 10:120625714-120625736 TTGCTCTGCTCACCAAGCCATGG - Intergenic
1075923206 10:126230104-126230126 TTTCCTGTCTTACCAAGCCCAGG + Intronic
1076140025 10:128071241-128071263 TTCCTTGTCTCCCCAAGCCTGGG + Intronic
1077381404 11:2240844-2240866 TGACTTTTATCACCTGGCCCAGG - Intergenic
1083742649 11:64719204-64719226 TTACTTTTCTCACCAAGCCCTGG - Intronic
1085384678 11:76150244-76150266 TTGCTGTCCTCACCATGCCCTGG - Intergenic
1087267699 11:96078688-96078710 TTGCTTTTCTCACCTAGACATGG - Intronic
1087637701 11:100721268-100721290 GTGCTTTTCTCACCTAACCCAGG + Intronic
1090859721 11:130642141-130642163 TTACTTTTCCTACCTCGCCCTGG + Intergenic
1091240354 11:134047801-134047823 TCATTTTTGTCACCCAGCCCCGG - Intergenic
1091631373 12:2163506-2163528 TGACTTTTCTTACCACCCCCTGG + Intronic
1092077748 12:5687295-5687317 TTACTTTTCTCACCAGGCACAGG - Intronic
1092710300 12:11329356-11329378 TTCCTGTACTCACCAAGCCAAGG - Intergenic
1092711408 12:11341342-11341364 TTCCTGTACTCACCAAGCCAAGG - Intergenic
1092714059 12:11369849-11369871 TTCCTGTACTCACCAAGCCAAGG - Intronic
1093061484 12:14611886-14611908 TTAGATTTCCCACAAAGCCCAGG - Intergenic
1096229524 12:49889373-49889395 TTACTTCTCTCCCCAGCCCCAGG + Intronic
1096555808 12:52402999-52403021 TAAATTTTCTCACCAGGTCCCGG - Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097230081 12:57505500-57505522 TTTTTTTTTTCTCCAAGCCCAGG - Intronic
1098259021 12:68648315-68648337 TTACGTATCTGGCCAAGCCCTGG - Intronic
1098861315 12:75713830-75713852 TTACTTTTCACCACAATCCCAGG + Intergenic
1099470283 12:83040042-83040064 TTACATTCCTGACCAAGCACTGG + Intronic
1101800350 12:108016472-108016494 TTTCTTTTCTCTGCTAGCCCAGG + Intergenic
1103964538 12:124630424-124630446 CTGCTTCTCTCACCCAGCCCAGG - Intergenic
1104083602 12:125455378-125455400 TTACTTTAATCACTAAGCACAGG - Intronic
1105826103 13:24125093-24125115 TTTCCTTTCTCTCCAACCCCTGG + Intronic
1112489326 13:99847902-99847924 TTCCTTGTGTCTCCAAGCCCTGG + Intronic
1114046337 14:18879824-18879846 ATACTTTCATCACCAAGCCTAGG - Intergenic
1114117875 14:19639626-19639648 ATACTTTCATCACCAAGCCTAGG + Intergenic
1114876764 14:26730029-26730051 TTACTTCTCTCTCAAAGCCAGGG - Intergenic
1115654331 14:35429022-35429044 TTACATTTCTAACAAATCCCAGG - Intergenic
1116584711 14:46687616-46687638 TTACTCTTCTCCCCAACCTCAGG - Intergenic
1117464508 14:55978800-55978822 TTAATTTTCACAGTAAGCCCAGG - Intergenic
1119227831 14:72957541-72957563 TTACTATTCTCATCAACACCAGG + Intronic
1121842912 14:97149782-97149804 GGAGTTTTCTCTCCAAGCCCAGG - Intergenic
1122493114 14:102133451-102133473 ATCCCATTCTCACCAAGCCCTGG - Intronic
1126448118 15:48773341-48773363 TTCCTTTTCTCAGGAATCCCTGG - Intronic
1127646690 15:60965724-60965746 CTATTTTTCTCCCCAAGCACTGG + Intronic
1131502960 15:92988111-92988133 TTGCTCTTCTCACCAAGGCTGGG + Intronic
1138080374 16:54084946-54084968 TGACTTTTCTTCCCAAGGCCTGG - Intronic
1139637307 16:68265427-68265449 TTAACTGTGTCACCAAGCCCAGG - Intronic
1139810050 16:69607153-69607175 TTACTTATCACAGCAAGCCTTGG - Intronic
1140304299 16:73788330-73788352 CTACTATTCTCTCCAAGCCCAGG - Intergenic
1142560497 17:806329-806351 TTACTTTTCTTCCCCAGCCCTGG - Intronic
1146061463 17:29609729-29609751 TTACTCTTCACAACAACCCCAGG + Intronic
1146634472 17:34493883-34493905 TTAATCCTCTCACCAACCCCAGG - Intergenic
1150191024 17:63239391-63239413 TTACTTTCCTCATGAAGACCTGG + Intronic
1150656343 17:67042212-67042234 TTGCTGTCCTCACCAAGGCCTGG + Intergenic
1150945852 17:69744840-69744862 TTGCTGTTCTCAGAAAGCCCAGG + Intergenic
1151092403 17:71457711-71457733 TTACTTTTGGCATCAAGACCTGG + Intergenic
1153291966 18:3510420-3510442 TTCCTTTTCTCTCCTAGCCAGGG - Intronic
1156091325 18:33474451-33474473 TTTCTTTTCTCACCTAGACATGG - Intergenic
1156412693 18:36849182-36849204 TTACTCCTCTCACCAGCCCCTGG + Intronic
1157299562 18:46469673-46469695 TTACCTTTATCATCTAGCCCTGG + Intergenic
1157803999 18:50644538-50644560 CTTCCTTTCTCTCCAAGCCCTGG + Intronic
1159885010 18:73895454-73895476 TTATTTTCCTGACAAAGCCCGGG - Intergenic
1161827764 19:6580434-6580456 TTACCCTTCTGACCAAGCCGAGG + Intergenic
1163327383 19:16613890-16613912 TTGATTCTGTCACCAAGCCCAGG - Intronic
1168353334 19:55688460-55688482 CTACCATTCTCAACAAGCCCTGG + Intronic
926117417 2:10222201-10222223 TGATTGTTCTCACCATGCCCGGG - Intergenic
926319065 2:11735650-11735672 TTACTCTCCTCACCAACCCCAGG + Intronic
926600010 2:14832336-14832358 GTTCTTTTCTCACAAAGACCAGG + Intergenic
927186363 2:20485308-20485330 TTACCTGTCTCGCCCAGCCCAGG - Intergenic
927414907 2:22868981-22869003 TTAATTTTCTCACTGAGCACAGG - Intergenic
929052150 2:37846966-37846988 TTCCTTTTCTCCCCAAACTCTGG + Intergenic
929454541 2:42056484-42056506 TAACTTCTCTCCCCAAGGCCAGG + Intronic
931678206 2:64718967-64718989 ATACTTTTCTCACTAAATCCTGG - Intronic
932315807 2:70781300-70781322 GTACTTTTCTATCCCAGCCCTGG - Intronic
934045225 2:88168209-88168231 TTACCTTTGTCACCATGCACTGG - Intergenic
935375137 2:102388097-102388119 TTCCGTTTCTCACAAAGCCAAGG - Intronic
935919290 2:107993492-107993514 TTAGTATTCTCACTAACCCCTGG - Intronic
938267036 2:129935106-129935128 ATACTTTCATCACCAAGCCTAGG + Intergenic
938581804 2:132653018-132653040 TAACTTCTTTCACCAAGCTCTGG + Intronic
938715528 2:134018165-134018187 GTACTTTTGCCACCAAGCCATGG + Intergenic
938909802 2:135875919-135875941 TTACTATACTCAGCGAGCCCAGG + Intronic
940665691 2:156606377-156606399 TAACTTTGCTCAGCTAGCCCAGG + Intronic
940674143 2:156708314-156708336 ATTCTATGCTCACCAAGCCCTGG + Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
945105707 2:206311673-206311695 TTAGTTTTCTCACCAAAGCTGGG - Exonic
947871732 2:233442457-233442479 TTAATTTCCACACCAAGCCACGG + Intronic
1170662890 20:18360111-18360133 TTACTTACCTATCCAAGCCCTGG - Intergenic
1170697409 20:18671775-18671797 TCACTTCTCTCTCCAGGCCCAGG - Intronic
1170963202 20:21043792-21043814 TTATTTTTCTCTCCAGGTCCAGG + Intergenic
1172651765 20:36508037-36508059 ATCCTTTTCTGACCTAGCCCTGG + Intronic
1173310722 20:41893939-41893961 TTATTTTTCTAACCAAACCTAGG - Intergenic
1173383285 20:42565503-42565525 TTGCTTTTCCCACCAGGCTCTGG - Intronic
1173930873 20:46817301-46817323 TTACTTTTCTCCCCAAACTCTGG + Intergenic
1175287879 20:57849911-57849933 TACCTTTTCTGACCAAGGCCTGG - Intergenic
1175682401 20:60999371-60999393 TTGCTTTGCTCACCAAACCCTGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1180200450 21:46220863-46220885 CTATCTTTCTCTCCAAGCCCTGG - Intronic
1180464873 22:15602460-15602482 ATACTTTCATCACCAAGCCTAGG - Intergenic
1182397270 22:30045662-30045684 TCACTTTCCCCACCGAGCCCTGG + Intergenic
1182788766 22:32931160-32931182 AGTCTTTTCTCTCCAAGCCCAGG + Intronic
1184419956 22:44373961-44373983 TTACCTTTCTACTCAAGCCCTGG + Intergenic
949528706 3:4932303-4932325 TTTTTTTTCTCACCAAGACCAGG - Intergenic
951701008 3:25496781-25496803 TTCCTTTTCTCAGTAAACCCAGG - Intronic
951745005 3:25968449-25968471 TTATTCTTCACACCAAACCCAGG - Intergenic
952492078 3:33882517-33882539 TGGCTTTTCTCCCCAAGCCGTGG + Intergenic
958451943 3:94284050-94284072 TGACTTTTCTAACCTAGCCATGG + Intergenic
958928906 3:100188271-100188293 TTCCTCTTCTCACTCAGCCCTGG + Intronic
959679635 3:109080013-109080035 TTAATCTTCTCAACAACCCCTGG + Intronic
962417229 3:135194089-135194111 TTACTTTTGTGACCCAGCCTAGG + Intronic
962939245 3:140110720-140110742 TTGCTTTTCTAACTCAGCCCTGG + Intronic
968299104 3:197599785-197599807 AAGCTTTCCTCACCAAGCCCCGG + Intergenic
968540556 4:1166241-1166263 TCACTTCTCTCACCGAGGCCTGG - Intergenic
968657334 4:1784337-1784359 TCACTTATCTCCCCGAGCCCCGG + Intergenic
968696913 4:2035204-2035226 TTACTTTTCTAAACTAGACCAGG - Intronic
969834139 4:9825538-9825560 TTTTTTTTCCCACCAAGCCTAGG + Intronic
974572789 4:63675906-63675928 TCATCTTTCTCACCAAGCCTGGG - Intergenic
975553698 4:75639049-75639071 CCCCTTTTCTCACCAAGACCTGG + Intergenic
975718716 4:77229787-77229809 TTCCATTTCTCACCAAGACTTGG - Intronic
978276837 4:106962012-106962034 TTAGTTTTCTCACCAAGCAGTGG + Intronic
979129449 4:117023082-117023104 TTACTTTTCTCACTGAGATCAGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
983399147 4:167241372-167241394 TTACTCTTCTAATCAAGCTCTGG + Intergenic
983706999 4:170674037-170674059 CTTCTTTGCTAACCAAGCCCTGG + Intergenic
985524132 5:393321-393343 TTACGTGTCTCATCCAGCCCAGG + Intronic
986239185 5:5941881-5941903 TTACTTTGCCCAAGAAGCCCAGG - Intergenic
987122471 5:14780063-14780085 TTTTTTTTCTGACCAGGCCCTGG + Intronic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
987792178 5:22581838-22581860 TAACTTTTCTTACCAAATCCTGG + Intronic
988172273 5:27673664-27673686 TTACTTCTCTCCCCATGCCCTGG + Intergenic
988219412 5:28323125-28323147 TTACTGATTTCACCAAGCCAAGG + Intergenic
988411664 5:30893902-30893924 CTACTTTACTCACACAGCCCAGG + Intergenic
989506943 5:42236983-42237005 TTACTTTTCTAGGTAAGCCCAGG - Intergenic
990257431 5:53985466-53985488 TTATTTCTCTCCCCAAACCCTGG + Intronic
990499870 5:56385417-56385439 TTACTTCTCTCACAGACCCCTGG + Intergenic
991553718 5:67871978-67872000 TTACTTTTCTCCATAAGCTCAGG - Intergenic
995532436 5:113105013-113105035 TTATTTCTCTGACCAGGCCCTGG - Intronic
999299381 5:150481774-150481796 CTACATTTCTAACCACGCCCTGG - Intergenic
1000827244 5:166060155-166060177 TTATTTTTTTGACCATGCCCTGG + Intergenic
1001694623 5:173660805-173660827 TGACTTTACTCACCAGGTCCAGG + Intergenic
1001905479 5:175469072-175469094 TTTCATATCTCACCAAGACCTGG - Intergenic
1002646560 5:180659295-180659317 TTACTTTTCTTTACAAGCCGGGG - Intergenic
1002772679 6:302998-303020 GTCCTTTTCTCAACAAGGCCTGG - Intronic
1003292311 6:4789767-4789789 TTACTCTTCTCACCTGCCCCTGG + Intronic
1003966257 6:11255450-11255472 TTACCTCTCTCACAAGGCCCTGG - Intronic
1004276143 6:14236620-14236642 TTCCTGCTCTGACCAAGCCCAGG - Intergenic
1004698546 6:18056914-18056936 TCACTTTTTTTTCCAAGCCCGGG - Intergenic
1006943010 6:37765432-37765454 TTACCTCTCTCACCAAGTGCAGG - Intergenic
1008174372 6:48249258-48249280 TTCCTTATCCCAGCAAGCCCAGG + Intergenic
1013071182 6:106730804-106730826 TTCCTTTTCTCTGCAAGCCCGGG + Intergenic
1014324591 6:119976786-119976808 TTGCTTTTCTCTCCAAACCAAGG + Intergenic
1016135930 6:140542983-140543005 TTTCTTTTCTCACACAGCCAGGG - Intergenic
1016792065 6:148076474-148076496 TTAATTTTCTCAACAGTCCCAGG - Intergenic
1018303548 6:162429516-162429538 TTTCTCTTCTCATGAAGCCCTGG + Intronic
1019193827 6:170269635-170269657 TGACTCTGCTCACCGAGCCCAGG + Intergenic
1020288307 7:6703309-6703331 CTACTTTCCTCCACAAGCCCAGG - Intronic
1022657680 7:32335364-32335386 TTAGAGTTCTCACCAAGGCCAGG + Intergenic
1026107039 7:67429528-67429550 TTACATTTCTAACAATGCCCAGG - Intergenic
1027186250 7:75972481-75972503 TTACTCTTCTCAGGAAGCCTCGG + Intronic
1027230191 7:76267878-76267900 TCCCTCTTCCCACCAAGCCCTGG + Intronic
1027608560 7:80330834-80330856 TCACTTTTCTGACCAAACTCTGG + Intergenic
1028287895 7:89026581-89026603 ATCCTTTTCTCACCACACCCAGG - Intronic
1028851158 7:95539349-95539371 TGACTTTTCTTACACAGCCCTGG - Exonic
1029327921 7:99825566-99825588 TTACTTTTCTCAGCCAGACATGG + Intergenic
1032500157 7:132394082-132394104 TTCTTTTTTTCTCCAAGCCCTGG + Intronic
1033539916 7:142347085-142347107 TTCCTTTTCTCACCCTGCCCTGG + Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1039514652 8:38122311-38122333 CTACTTCTTTCACCGAGCCCTGG + Intronic
1039762421 8:40591709-40591731 TTATTCTTCTCATCAAACCCTGG + Intronic
1039833073 8:41233177-41233199 TTAGTTTTCACAACAACCCCTGG - Intergenic
1041427930 8:57743710-57743732 TTACTGCTCTCAGCAAACCCAGG - Intergenic
1041475115 8:58256335-58256357 TTACTTCTCTCACCAATTCTGGG + Intergenic
1041563859 8:59252544-59252566 TTACTTTTCTCACCAATGTTTGG + Intergenic
1042564109 8:70095706-70095728 TTTCTTTTTTTACCTAGCCCAGG - Intergenic
1042804934 8:72760827-72760849 TTACTGTTCTCCCCAAGTCCAGG - Intronic
1042901483 8:73732636-73732658 TTACTTTTCTTTCCAAGACTGGG - Intronic
1044815999 8:96113690-96113712 TTCCTTTTCTGAACAAACCCAGG + Intergenic
1044887071 8:96790724-96790746 TTACTGTTCTCATCAAGACTTGG + Intronic
1045581719 8:103488496-103488518 ATGCTTTTCTCACAAACCCCTGG + Intergenic
1045861012 8:106815096-106815118 TTTCTTTTCTCTCCAAGGCCTGG + Intergenic
1047454839 8:124999002-124999024 TTTCTTTTCTCACCAAGAGCAGG - Exonic
1048182354 8:132207613-132207635 TTACATTTCTTACCATGCCCTGG + Intronic
1048549898 8:135424604-135424626 TCACTTTTCTAACCTAGCCCTGG + Intergenic
1051485670 9:17605283-17605305 TTACTTTTGTTTCCAATCCCAGG + Intronic
1054873014 9:70066632-70066654 TGGCTTTTCTCATCAAGCCAGGG + Intronic
1055167375 9:73213159-73213181 TTACTTATTTCTCCAAGTCCAGG - Intergenic
1055671006 9:78606165-78606187 TTTCTTTTCTTATCAGGCCCTGG + Intergenic
1056224322 9:84480611-84480633 TTCCTCTTTTCACCAAGCCTGGG - Intergenic
1058153792 9:101489474-101489496 TTACTTTGCTCATCAGGCCTAGG - Intronic
1058749276 9:108023283-108023305 TTCCTCTTTTTACCAAGCCCTGG + Intergenic
1059201312 9:112419785-112419807 TAAATTTGCACACCAAGCCCAGG - Intronic
1060027814 9:120187708-120187730 TTTCTTTTCTCAAGAAACCCCGG - Intergenic
1060978995 9:127781829-127781851 TTTCTTTACTCTCAAAGCCCAGG - Intergenic
1203769938 EBV:44653-44675 TTACTTTTCACACGTAGACCTGG + Intergenic
1189008919 X:37025787-37025809 TTAATATCCTCACCAAGCCATGG + Intergenic
1194313783 X:92348249-92348271 TTGATTTTCTGACCCAGCCCGGG - Intronic
1195674339 X:107496353-107496375 TTCCCATTCTCACCATGCCCAGG - Intergenic
1197353351 X:125403840-125403862 TTACTTTTGTCATCAATGCCTGG + Intergenic
1197678759 X:129359796-129359818 TTACTTTACTCTCTAAGGCCAGG - Intergenic
1198744218 X:139873262-139873284 TTTCTTTTCTCCCCAGCCCCTGG - Intronic
1200622052 Y:5462364-5462386 TTGATTTTCTGACCCAGCCCGGG - Intronic