ID: 1083743652

View in Genome Browser
Species Human (GRCh38)
Location 11:64723582-64723604
Sequence TCTCGCGGCGTCCCAAGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083743652_1083743659 -7 Left 1083743652 11:64723582-64723604 CCCCGACTTGGGACGCCGCGAGA No data
Right 1083743659 11:64723598-64723620 CGCGAGAGCAGGGCTGATGCGGG No data
1083743652_1083743664 19 Left 1083743652 11:64723582-64723604 CCCCGACTTGGGACGCCGCGAGA No data
Right 1083743664 11:64723624-64723646 TGGGCCGCAGCGCCCTCTGCTGG No data
1083743652_1083743658 -8 Left 1083743652 11:64723582-64723604 CCCCGACTTGGGACGCCGCGAGA No data
Right 1083743658 11:64723597-64723619 CCGCGAGAGCAGGGCTGATGCGG No data
1083743652_1083743660 -6 Left 1083743652 11:64723582-64723604 CCCCGACTTGGGACGCCGCGAGA No data
Right 1083743660 11:64723599-64723621 GCGAGAGCAGGGCTGATGCGGGG No data
1083743652_1083743666 30 Left 1083743652 11:64723582-64723604 CCCCGACTTGGGACGCCGCGAGA No data
Right 1083743666 11:64723635-64723657 GCCCTCTGCTGGCTACCCCCAGG No data
1083743652_1083743662 0 Left 1083743652 11:64723582-64723604 CCCCGACTTGGGACGCCGCGAGA No data
Right 1083743662 11:64723605-64723627 GCAGGGCTGATGCGGGGCCTGGG No data
1083743652_1083743661 -1 Left 1083743652 11:64723582-64723604 CCCCGACTTGGGACGCCGCGAGA No data
Right 1083743661 11:64723604-64723626 AGCAGGGCTGATGCGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083743652 Original CRISPR TCTCGCGGCGTCCCAAGTCG GGG (reversed) Intergenic