ID: 1083745601

View in Genome Browser
Species Human (GRCh38)
Location 11:64735046-64735068
Sequence ACTGAAGCCCAGGCAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 347}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083745597_1083745601 19 Left 1083745597 11:64735004-64735026 CCAAGATCATCTGGCTCAGTGAC 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1083745601 11:64735046-64735068 ACTGAAGCCCAGGCAGAAGTGGG 0: 1
1: 0
2: 3
3: 40
4: 347
1083745596_1083745601 24 Left 1083745596 11:64734999-64735021 CCAGGCCAAGATCATCTGGCTCA 0: 1
1: 0
2: 2
3: 13
4: 169
Right 1083745601 11:64735046-64735068 ACTGAAGCCCAGGCAGAAGTGGG 0: 1
1: 0
2: 3
3: 40
4: 347
1083745598_1083745601 -3 Left 1083745598 11:64735026-64735048 CCTCATCTTGCACACAAGAAACT 0: 1
1: 0
2: 7
3: 49
4: 337
Right 1083745601 11:64735046-64735068 ACTGAAGCCCAGGCAGAAGTGGG 0: 1
1: 0
2: 3
3: 40
4: 347
1083745595_1083745601 25 Left 1083745595 11:64734998-64735020 CCCAGGCCAAGATCATCTGGCTC 0: 1
1: 0
2: 3
3: 14
4: 187
Right 1083745601 11:64735046-64735068 ACTGAAGCCCAGGCAGAAGTGGG 0: 1
1: 0
2: 3
3: 40
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083745601 Original CRISPR ACTGAAGCCCAGGCAGAAGT GGG Intronic
900357284 1:2271003-2271025 ACTGAGGCCCAGTGAGGAGTGGG + Intronic
900955291 1:5882993-5883015 TCTGAAGCCCAGGAAGAACAGGG + Intronic
901636919 1:10674821-10674843 GGTGAGGCCCAGGAAGAAGTTGG - Intronic
901794304 1:11671716-11671738 AATGCCGCCCAGGCACAAGTGGG + Intronic
901863406 1:12088897-12088919 GCTGAAGCCCAGGATGAAGAGGG - Intronic
902271126 1:15305963-15305985 ACTGAGTAACAGGCAGAAGTTGG + Intronic
902706987 1:18212520-18212542 ACTGAGGCCCAGAGAGGAGTAGG + Intronic
902849217 1:19140655-19140677 TCTAAAGCCAAGGCAGAAGCAGG + Intronic
903134833 1:21302703-21302725 ACTGAGGCCCAGGGAGCACTCGG - Intronic
903203080 1:21759279-21759301 ACTGAAGGGAAGGCAGGAGTGGG + Intronic
903313009 1:22475110-22475132 ACAGAAATCCAGGCAGAGGTGGG + Intronic
903424511 1:23243963-23243985 ACTGACACCCAGGCAGCCGTGGG - Intergenic
903478778 1:23638219-23638241 GAGGAGGCCCAGGCAGAAGTGGG + Intronic
903739535 1:25550697-25550719 ACTGAAGCCCAGACAGGGATGGG - Intronic
904284194 1:29443532-29443554 CCTGGAGCCCAGGCAGGAGGTGG + Intergenic
904773182 1:32892477-32892499 ACTGAGCCCCAAGGAGAAGTGGG + Intronic
904851541 1:33463245-33463267 ACTGAGGCCCAGACAGAAGAAGG - Intergenic
904999532 1:34657451-34657473 ACTGAGGCCACTGCAGAAGTGGG - Intergenic
905225895 1:36479049-36479071 AAAGAAGCCCAGGCAGAGCTTGG - Intronic
905795697 1:40815309-40815331 TCAGAAGCTCAGGCAGCAGTGGG - Intronic
906211285 1:44013583-44013605 ACCCAGGCCCAAGCAGAAGTGGG - Intronic
906715473 1:47965441-47965463 GATGAAGCCCAGGCAGAGGGAGG + Intronic
908522386 1:64956769-64956791 ACTGGAGCTCAGGCAAAAGTGGG + Intronic
910389820 1:86729396-86729418 ACTGAAGCCCTGGCTGAATTAGG + Intronic
913185874 1:116370658-116370680 ACTGAGGCCCAGGGAGTAATTGG - Intergenic
914230411 1:145760798-145760820 ACTAAGGAACAGGCAGAAGTTGG + Intronic
915300474 1:154948511-154948533 ATCAATGCCCAGGCAGAAGTGGG - Intronic
916500558 1:165383514-165383536 ACTGAAGCACAGGCAGATTTGGG + Intergenic
918478408 1:184951175-184951197 ACTGAAGCCCAGGGAGACTGTGG - Intronic
918554983 1:185787997-185788019 ACTGATACCCAGGCAGTAGCAGG + Intronic
918950054 1:191125692-191125714 ACAGAAGCCGAGGCTGAAGAGGG + Intergenic
920188826 1:204179435-204179457 ACTGGACCCCGGGCAGAAGGGGG - Intergenic
920555562 1:206901738-206901760 ACTGAAGCCCAGGGAGGTGGAGG - Intronic
922005865 1:221530071-221530093 TCCGGAGCCCAGGCAGAGGTAGG - Intergenic
922371131 1:224911336-224911358 ACTGAATAACAGGCAGAAGTTGG - Intronic
922749577 1:228064267-228064289 ACTGAGGCCCAGGCAGGAGTGGG - Intergenic
923613601 1:235517658-235517680 ACTCTAGCCCAGGCAACAGTGGG + Intergenic
924024258 1:239816483-239816505 ACTGAGGCACAGGCAGAAGAGGG + Intronic
1062805246 10:414619-414641 ACTGTAGCAGAGGCTGAAGTGGG - Intronic
1062902923 10:1159308-1159330 ACTGCAGCTCAGGGAGAGGTGGG - Intergenic
1063686006 10:8237712-8237734 ACTAAAGCCCAGGAAGACGATGG + Intergenic
1064386784 10:14901433-14901455 GCTGAAGCTCAGGCAGACCTGGG - Intronic
1065668163 10:28085255-28085277 ACTGAAGCACAGAGAGAAGTAGG - Intronic
1067529581 10:47060503-47060525 ACTGAGCCCTGGGCAGAAGTGGG - Intergenic
1069422090 10:68255579-68255601 ACTTAAGCCCAGGAAGCAGAGGG + Intergenic
1069844891 10:71364122-71364144 ACTAAAGCCCAGCCAGCAGCAGG + Intergenic
1070026527 10:72637272-72637294 TCTGTAGCCCAGGCAGAATGTGG - Intergenic
1070700721 10:78599874-78599896 ACTGAAGCCCAGGATGAAAAAGG + Intergenic
1070802167 10:79250233-79250255 ACTGAGGCTCAGACAGAAGGGGG - Intronic
1071080252 10:81802173-81802195 ACTGCAGCCTTGGCAGAAGAAGG + Intergenic
1071815500 10:89228307-89228329 AATGAAGCCCAGGCTGCTGTTGG + Exonic
1071943536 10:90614923-90614945 ATTGGGGCCCAGGCATAAGTAGG - Intergenic
1073524071 10:104162952-104162974 ACTAGAGCCCAAGGAGAAGTAGG + Intronic
1073650216 10:105351027-105351049 ACTTAAGCCCATGCAGCAGGCGG + Intergenic
1074882058 10:117667222-117667244 GCTGAAGCCCAGAGAGAGGTTGG + Intergenic
1075131485 10:119743562-119743584 AATGAAGGGCAGGCAGAAGTGGG + Intronic
1075677437 10:124305195-124305217 ACAGTATCCCAGGCAGAAGGAGG + Intergenic
1076433825 10:130426053-130426075 ACTGAAGCCCAGACAAGGGTCGG + Intergenic
1077591845 11:3498584-3498606 ACTGAAGCCTAGGCAACGGTGGG + Intergenic
1077674571 11:4184819-4184841 ACAAAAGCCCAGGGAGAAGCAGG + Intergenic
1078514870 11:12013448-12013470 ACTGCATAACAGGCAGAAGTTGG + Intergenic
1078515944 11:12022607-12022629 ACTGAGTAACAGGCAGAAGTTGG + Intergenic
1078959648 11:16249424-16249446 AATGAAGTCCAGGCTGAAGTGGG - Intronic
1079245208 11:18747008-18747030 ACTGAGACCCAGGGAGAAGAAGG - Intronic
1079644256 11:22843721-22843743 ACTGGATAACAGGCAGAAGTTGG + Intergenic
1080119419 11:28659628-28659650 ACAGAAGCCAAATCAGAAGTGGG - Intergenic
1082768515 11:57187407-57187429 AGTGATGCCCAGGAGGAAGTTGG - Exonic
1083387055 11:62318956-62318978 ACTGAAGCCAGGGAAGTAGTGGG + Intergenic
1083745601 11:64735046-64735068 ACTGAAGCCCAGGCAGAAGTGGG + Intronic
1084153229 11:67300877-67300899 ACTCCAGGCCAGGCAGAAGGTGG + Intronic
1085315339 11:75541473-75541495 GCTGGAGCCCAGGCAGCAGATGG - Intergenic
1086281522 11:85195064-85195086 TCTGAAGCCCAGGAAGAACAAGG + Intronic
1087062104 11:93989270-93989292 ACTGGAGCCCAGGAAGAGCTGGG + Intergenic
1087474432 11:98618839-98618861 ACTGATGAACAGGCAGAGGTTGG - Intergenic
1087474628 11:98620494-98620516 CTGGATGCCCAGGCAGAAGTTGG + Intergenic
1087998224 11:104838953-104838975 ACTGAAGCCCAGGCAAAATGAGG - Intergenic
1088713606 11:112529458-112529480 ACGGAAGCCGAAGCAGAAGCAGG + Intergenic
1089556067 11:119316573-119316595 CGTGATGCCCAGGCAGAAGGGGG + Intronic
1091238692 11:134038321-134038343 GCTGGAGACCAGGCAGGAGTGGG - Intergenic
1091838824 12:3604827-3604849 ACTGTGGCCCAGGCAGGAGGAGG - Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1093355971 12:18167649-18167671 TCTGTCGCCCAGGCTGAAGTGGG - Intronic
1093912794 12:24766452-24766474 ACTGGAGCCCAGGCTGCAGTGGG - Intergenic
1095335503 12:41020342-41020364 AGTGAAGCCCCAACAGAAGTAGG + Exonic
1095986964 12:48005151-48005173 TCTGGAGCACAGGCCGAAGTTGG + Intergenic
1096103934 12:48985832-48985854 CCTGAGGCCCAGGAGGAAGTGGG + Intergenic
1097567335 12:61287631-61287653 CTGGATGCCCAGGCAGAAGTTGG - Intergenic
1098167323 12:67711689-67711711 AATAAAGCTCAGGCAGAAGATGG + Intergenic
1101496456 12:105259128-105259150 GCTGCAGCACAGGCAGAGGTTGG - Intronic
1102382728 12:112481450-112481472 TTGGAAGACCAGGCAGAAGTGGG - Intronic
1102382784 12:112481873-112481895 TCGGAGGACCAGGCAGAAGTGGG - Intronic
1103204815 12:119120385-119120407 ACTGAGGCCCAGGAAGATGAAGG - Intronic
1105306271 13:19171237-19171259 ACTGGAGCCAGGGCAGGAGTGGG - Intergenic
1105770922 13:23611047-23611069 CCTGAAGCCCAGGCTAAAGATGG + Intronic
1106357891 13:29001514-29001536 ACTGAAACGCAGGCAGATATGGG + Intronic
1108444456 13:50493417-50493439 ACTGAAGCCCAGCTAATAGTAGG - Intronic
1109416756 13:62050916-62050938 ACTGAGTCACAGGCAGAGGTTGG + Intergenic
1110175389 13:72549721-72549743 TCTGAAAGCCAGGTAGAAGTTGG + Intergenic
1111824489 13:93250737-93250759 ACAGAATCCTAGGCAGAATTTGG + Intronic
1112603658 13:100882003-100882025 ACTGAGGACCAGGCATAACTGGG + Intergenic
1112740511 13:102467780-102467802 ATGGAAGCACAGACAGAAGTGGG + Intergenic
1112943728 13:104898147-104898169 ACTGATCCACAGGCAGAAGCAGG - Intergenic
1113078564 13:106492629-106492651 AATGCACCCCAGGCAGAAGCCGG + Exonic
1113084156 13:106550261-106550283 ACTGAAGGCCAGTCAAAAGATGG - Intronic
1113722774 13:112573389-112573411 AGATCAGCCCAGGCAGAAGTGGG + Intronic
1116070617 14:40039916-40039938 AGTGAAGCCCATGCAGGAGCAGG + Intergenic
1117529908 14:56650234-56650256 GCCGAAGTCCAGGCAGAAGTTGG - Intronic
1117809907 14:59535086-59535108 ACTGAATCAAAGGCAGAAATGGG + Intronic
1118971880 14:70643652-70643674 TCTGAAGCCGAGGCAGTGGTGGG + Intronic
1120858807 14:89235967-89235989 ACTGAAGCCCAGGCAGGTTAAGG + Intronic
1121520471 14:94582922-94582944 CCTGCAGCCTATGCAGAAGTTGG + Intronic
1122151816 14:99729939-99729961 ACTGAGGCCCAGGCAGGTGGGGG - Intergenic
1122185929 14:99996020-99996042 ACTGAATCTAAGACAGAAGTGGG - Intronic
1122403345 14:101480754-101480776 ACTGAAGTCCAGGCTGAACTCGG + Intergenic
1122742645 14:103881060-103881082 AATGAAGCCCAGGGAGGAGGGGG - Intergenic
1123735711 15:23180472-23180494 ACTGAGGCCAAGGCAGAGGCGGG - Intergenic
1124286425 15:28403455-28403477 ACTGAGGCCAAGGCAGAGGCGGG - Intergenic
1124296278 15:28508181-28508203 ACTGAGGCCAAGGCAGAGGCGGG + Intergenic
1126679949 15:51192943-51192965 ACGGAAGCCCAAGCAGCAGCCGG - Intergenic
1126802648 15:52313708-52313730 AATGAAGCCCAGGCCGAGGCTGG + Exonic
1127254225 15:57275243-57275265 TCTGAAGGCCGGGGAGAAGTAGG - Intronic
1127810209 15:62559287-62559309 ATTGTAGCCCACGCAGAACTGGG - Intronic
1127872751 15:63087203-63087225 ACTGAAGCCCAGACTGCACTTGG + Intergenic
1128709063 15:69858378-69858400 ACTGGAGCCCAGTGAGAAGCAGG - Intergenic
1129258716 15:74350450-74350472 ACTGAGGCCCAGTGAGAAGAAGG - Intronic
1132305002 15:100804742-100804764 ACAGAAACCCATGCAGAAGGAGG + Intergenic
1132468997 16:91415-91437 ACTGGAGCCCAGGCAGAACCTGG + Intronic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1133636848 16:7674849-7674871 ACTGAAACTAAGGCAGAAGGTGG + Intronic
1134435059 16:14248983-14249005 CCTGAGGCCAAGGCAGCAGTTGG - Exonic
1136008156 16:27345163-27345185 ACTGAGGCCCAGGCAGGGGCAGG - Intronic
1139717140 16:68822672-68822694 ATAGAAGCCCAGAGAGAAGTAGG - Intronic
1144623907 17:16834711-16834733 AGTGGAGCCCAGGCAGAGGCAGG - Intergenic
1144882522 17:18438005-18438027 AGTGGAGCCCAGGCAGAGGCAGG + Intergenic
1145149712 17:20506381-20506403 AGTGGAGCCCAGGCAGAGGCAGG - Intergenic
1145937294 17:28722135-28722157 ACTGAGTCCCAGGCTGAAGCAGG + Intronic
1146123913 17:30217428-30217450 ACTGAGGCCCAGGAAGAGCTGGG + Intronic
1146940425 17:36840310-36840332 ACAGGGGCCCAGACAGAAGTTGG - Intergenic
1147436481 17:40419588-40419610 ACTGAAACCCAGGTAGAGGAAGG - Intergenic
1147578197 17:41614416-41614438 AGTGGAGCTCAGGCAGAAGCAGG - Intronic
1147920417 17:43913401-43913423 ATTGGAGCCCAGACAGAAGAGGG + Intergenic
1148483849 17:47977926-47977948 CCTGCAGCCCTGGCAAAAGTGGG + Intronic
1149568698 17:57657086-57657108 ACAGAAGCCCAGGAAAACGTCGG + Intronic
1150132746 17:62678207-62678229 ACTGAAGTCTAGGGAGAAGAAGG + Intronic
1151188615 17:72381789-72381811 CCTGGAGCCCAGGCTGAGGTGGG - Intergenic
1151197834 17:72444724-72444746 GCTGCACCCCAGGCAGAACTGGG + Intergenic
1151380703 17:73723951-73723973 ACTGAACCCTAGGCAGGAGAAGG - Intergenic
1151595980 17:75078203-75078225 ACCCAAGCCCAGGCAGGGGTGGG + Intergenic
1151765508 17:76131444-76131466 ATTGCAGCCCAGGGAGAACTTGG - Intergenic
1151957561 17:77388025-77388047 GCAGAAGCCCAGGGAGGAGTAGG - Intronic
1153274959 18:3359413-3359435 ACTGAAGAACAGGCAGCAATGGG - Intergenic
1155906939 18:31462986-31463008 GGAGAAGCCCAGGCAGCAGTGGG + Intronic
1156654550 18:39269788-39269810 ACTTAAGACAAGGCAGAATTTGG - Intergenic
1157115579 18:44859688-44859710 ACAGAAGAACAGGCAAAAGTAGG + Intronic
1157191395 18:45585149-45585171 TCTGAAGCCCAGGAAGGAGGAGG - Intronic
1157319663 18:46624387-46624409 ACTCAAGCCCACACAGATGTGGG + Intronic
1159718893 18:71859952-71859974 ACTGAATAACAGGCAGAAGTTGG - Intergenic
1159921966 18:74234796-74234818 ACTAACCCCCAGGCAGAAGAAGG - Intergenic
1160542925 18:79634884-79634906 AATGAAGCCCATGCAGAGGAAGG + Intergenic
1161494365 19:4579532-4579554 ACTGAAGCCCAGAAAGGACTAGG + Intergenic
1161510577 19:4668882-4668904 TCTGTCGCCCAGGCTGAAGTGGG + Intronic
1162056226 19:8065751-8065773 ACAGAGGCCCAGGCAGAGGCCGG + Exonic
1162156090 19:8678937-8678959 ACTGAAGACCAGACTGAAGGAGG + Intergenic
1162550689 19:11356842-11356864 ACTGAGGCCCAGGCAGGCGAGGG - Exonic
1163441079 19:17323006-17323028 GCTGAAGCCAGGGCTGAAGTTGG + Exonic
1163592559 19:18202795-18202817 GCCCAAGCCCAGGCAGAAGATGG + Intronic
1164365591 19:27578719-27578741 GCTGAAGCCATGGCAGAAGAAGG + Intergenic
1164576394 19:29407797-29407819 ACTGAGGCCCAGTGAGAAGAAGG + Intergenic
1165495730 19:36151229-36151251 GCTGAGGCCCAGGGAGGAGTCGG - Intronic
1167096633 19:47378005-47378027 ACTGAAGCTCAGGCAGGGGCGGG + Intronic
1167302185 19:48684495-48684517 ACAAAAGCCCAAGCAGAAGCTGG + Intergenic
1168115481 19:54219743-54219765 ACTGAGGCCCAGGCAGGGGAGGG + Intronic
1168121284 19:54253892-54253914 ACTGAGGCCCAGGCAGGGGAAGG + Intronic
1168132824 19:54332050-54332072 ACTGAGGCCCAGGCAGAGGAGGG + Intergenic
925702793 2:6655605-6655627 ACTGAGGCCCAGATAGAGGTTGG + Intergenic
925873539 2:8292456-8292478 TCTCAAGCCCAGGCAGGAGGTGG + Intergenic
928155850 2:28875760-28875782 TCTGAAGCCCAGACAGGAGCAGG - Intergenic
929433296 2:41907137-41907159 ACTGAGGCCCAAACAGAAGTGGG - Intergenic
930321821 2:49864612-49864634 GCTGATGCCCAGGCAGAAGTGGG + Intergenic
932804210 2:74768918-74768940 TCTGCAGCACAGTCAGAAGTTGG - Intergenic
934610695 2:95733165-95733187 ACTGGATAACAGGCAGAAGTTGG - Intergenic
935093720 2:99923199-99923221 TCTGAAGACAAGGCAGAATTGGG + Intronic
936256819 2:110923138-110923160 ACACAAGCCCAGGAAAAAGTTGG + Intronic
937589126 2:123592300-123592322 ACTGGATAACAGGCAGAAGTTGG - Intergenic
937819114 2:126287921-126287943 ACTGAAGCCCATGCAGCAATAGG + Intergenic
938540001 2:132278087-132278109 TCTGACGCCCAGGCTGAAGCTGG - Intergenic
938723849 2:134089659-134089681 ACTTAAGCACAGCCAGGAGTTGG - Intergenic
939573497 2:143867540-143867562 CCTGAGGCCAAGGCAGAAATGGG + Intergenic
942302468 2:174575153-174575175 ACTGAAGACAAGGCAGAGTTTGG - Intronic
945942296 2:215961767-215961789 ACTGAATCCCAGGAAAAACTGGG + Intronic
946104576 2:217358029-217358051 ACTGAAGCCAGGACAGGAGTGGG + Intronic
946310143 2:218878778-218878800 ACTGAGGCCCAGAAAGAATTAGG - Intergenic
946605913 2:221404340-221404362 ACTGAAGCCAAGTGAGACGTTGG - Intergenic
946836342 2:223776391-223776413 ACTGAAGCCCATTGTGAAGTGGG - Intronic
947227181 2:227851957-227851979 AATGAAATCCAGGAAGAAGTAGG - Intergenic
947923675 2:233902062-233902084 ACTTGAGCCCAGGCTGTAGTGGG - Intergenic
948612119 2:239176378-239176400 ACGGAAGGCCAGGCAGAGGGAGG - Intronic
948919289 2:241053839-241053861 ACCGAAGCCCCTGGAGAAGTAGG + Intronic
949072005 2:242030986-242031008 ACTGAGGCCCAGGGTGAAGTGGG - Intergenic
1168837098 20:884708-884730 ACTGAGGCCCAGGGAGGGGTAGG + Intronic
1169342808 20:4809455-4809477 GCTGAAGGGCAGGCCGAAGTGGG - Intronic
1172264444 20:33598840-33598862 GCTGAAGCCATGGCAGAAGAAGG - Intronic
1173622748 20:44449169-44449191 TCAGATGCCCAGGCAGAAGCCGG - Intergenic
1173863607 20:46300075-46300097 ACTGAGGCCCAGGGAGAGGCTGG - Intronic
1174139791 20:48404708-48404730 ACTGGGGCCCATGCAGAAGCTGG + Intergenic
1174565875 20:51464110-51464132 TCTGAAACCCAGGCAGCAGTAGG - Intronic
1175601074 20:60273583-60273605 CCTGAAGCCCAGCCAGCAGTGGG - Intergenic
1176185478 20:63776050-63776072 TCTGTAGCTCAGGCAGAAGCTGG - Intronic
1176667120 21:9697967-9697989 GCTGAACCCCAGGCAGAAGCCGG - Intergenic
1177259501 21:18711901-18711923 ACTGAATTACAGGCAGAAGTTGG + Intergenic
1178200737 21:30401762-30401784 ACAGAAGTCCCAGCAGAAGTGGG + Intronic
1179379997 21:40889518-40889540 ACTGGGGCCCAGGCAGTAATTGG - Intergenic
1179412188 21:41170342-41170364 ACCGTAGCCAAGGCAGTAGTTGG + Intronic
1179553086 21:42155610-42155632 ACAGAAGCCCAGGCAGATAGTGG - Intergenic
1181765657 22:25090076-25090098 AGTGAAACCCTGGCAGAGGTGGG - Intronic
1182125537 22:27813268-27813290 ACTTGAGCCCAGGCAGCAGAGGG - Intergenic
1182447259 22:30397137-30397159 TCTGAGCCCCAGGCAGAAGGAGG + Exonic
1182458759 22:30469745-30469767 ACTGAAGCCCAGCAAAAATTAGG - Intronic
1182797693 22:33003268-33003290 ACTGGATGACAGGCAGAAGTTGG + Intronic
1182873635 22:33671054-33671076 ACTCAAGCCCTGGTCGAAGTGGG + Intronic
1183583583 22:38739539-38739561 GCTGGTGCCCAGGCAGATGTGGG + Intronic
949837025 3:8280362-8280384 ACTGCAGCCGAGGCTGTAGTTGG - Intergenic
949897256 3:8777173-8777195 ACTGAGGCCCAGGGAGATGTGGG - Intronic
950361498 3:12452599-12452621 ACTGAAGCCCAGAGAGAAAAGGG + Intergenic
950639259 3:14337770-14337792 ACTGAAGACCAGGAAGGATTGGG - Intergenic
950653700 3:14423672-14423694 ACTGAGGCCCAGGCAGAAGATGG - Intronic
952289067 3:31997815-31997837 TCTGTCGCCCAGGCAGGAGTGGG + Intronic
952511160 3:34057520-34057542 ACTTCAGCCCAGGATGAAGTGGG + Intergenic
952820541 3:37482223-37482245 CCTGCAGCCCAGGCAGATGCTGG + Intronic
953129341 3:40123527-40123549 ACAGCAGCCCAGGCTGAAGCAGG + Intronic
954369510 3:50162832-50162854 AGGGAAGCTGAGGCAGAAGTAGG + Intronic
956634728 3:71352433-71352455 TCTGTTGCCCAGGCTGAAGTTGG - Intronic
957676862 3:83378162-83378184 ACTGGATAACAGGCAGAAGTTGG - Intergenic
957867103 3:86039543-86039565 ACTGAAGCCTAGGCAATGGTGGG - Intronic
958151806 3:89701726-89701748 ACTGAGTAACAGGCAGAAGTTGG - Intergenic
959733282 3:109628573-109628595 AAGGAAGCCCAGGCAGAAGATGG - Intergenic
962636634 3:137338571-137338593 CTTGATGTCCAGGCAGAAGTTGG + Intergenic
963018276 3:140846631-140846653 AATGACACCCAGACAGAAGTGGG + Intergenic
963677646 3:148333199-148333221 AATTTAGCCCAGGCAGTAGTAGG + Intergenic
964475087 3:157090791-157090813 ACTGAAGCCAAGGCAGGGCTGGG + Intergenic
966918516 3:184597769-184597791 ACTGAGGCCCAGGGAGAGGAGGG - Intronic
967474724 3:189903120-189903142 ACTGAGGCCCAGGCAGGAAAAGG + Intergenic
967951919 3:194847817-194847839 ACTATAGCCCAGGCAGGAGGGGG - Intergenic
969044312 4:4325650-4325672 ACTGAAGACCAGTGAGAAGAGGG - Intergenic
969454460 4:7293363-7293385 ACAGAAGCCAAGAGAGAAGTCGG - Intronic
970461961 4:16283578-16283600 ACTGCATAACAGGCAGAAGTTGG + Intergenic
971004226 4:22356436-22356458 ACTAAAGCCAAGGCTGAAGAGGG + Intronic
971424451 4:26502401-26502423 ACTGAAGACCAGACCGGAGTGGG - Intergenic
972398299 4:38675863-38675885 ACTTAAGCCCTGGAAGAATTAGG - Intronic
972448945 4:39176892-39176914 TCTGAAGCCCAGGCTGGAGTGGG - Intergenic
972733461 4:41817482-41817504 ACTGAAGACCAGGCAGAGGCAGG - Intergenic
972786003 4:42327357-42327379 ACTGAAACCCAGGCAGGAAAAGG - Intergenic
974632383 4:64510323-64510345 ACTTGAGGCCAGGCAAAAGTGGG + Intergenic
976027958 4:80713954-80713976 GCTGATGCCCAAGTAGAAGTAGG + Intronic
976428410 4:84933348-84933370 ACAGAAACCCAGCTAGAAGTAGG + Intronic
978666101 4:111183686-111183708 ACTGGGGAACAGGCAGAAGTTGG - Intergenic
981763318 4:148217746-148217768 ACTCAAGCCCAGTCAGAGGGTGG - Intronic
982611035 4:157574771-157574793 ACAGGCGCCTAGGCAGAAGTGGG + Intergenic
985628416 5:1002182-1002204 GCTGCAGCTCAGGCAGAAGCAGG + Intergenic
986194547 5:5526222-5526244 AGTGAAGCCCTGGCTGAGGTGGG + Intergenic
988601016 5:32639501-32639523 AGTGAAGCCCAGGAAGATGAAGG - Intergenic
989593459 5:43133431-43133453 ACTTTAGCCCAGGCAACAGTGGG + Intronic
989632369 5:43498650-43498672 AGTGAAGGCCAGGCAGTGGTAGG - Intronic
989684385 5:44067996-44068018 AGTGAGGCCAAGGCAAAAGTTGG - Intergenic
990575966 5:57123811-57123833 ACTGAAGCCCAGGGAGGTGGAGG - Intergenic
991452935 5:66771894-66771916 ACTGTGGCCCAGGCACAAGTAGG + Intronic
992969731 5:82043944-82043966 ACTGAATAACAAGCAGAAGTTGG - Intronic
995299845 5:110566748-110566770 ACTGAGTAACAGGCAGAAGTTGG - Intronic
996052758 5:118951253-118951275 GCAGAAGCCGAGGAAGAAGTGGG + Intronic
997977087 5:138446813-138446835 ACTGAAGCCGTGGCAGAAGCTGG - Exonic
999084197 5:148872736-148872758 AGTGAAGCCCAGGCATACGAAGG - Intergenic
999324064 5:150632123-150632145 ACTGATGCCCAGGGAGAAAAAGG - Intronic
999370350 5:151051493-151051515 ACTGAGGCCCAGGGAGAGGCAGG - Intronic
1000571254 5:162916605-162916627 CCTGTAGCCCAGGCAGATGTTGG + Intergenic
1001253754 5:170168124-170168146 ACTGAAGCCCAGAGAGAGGAAGG - Intergenic
1001485239 5:172115210-172115232 AGTGAGGCCCAGGCAGGAGGGGG - Intronic
1001921889 5:175607008-175607030 ACTGTGGGCCAGGCAGAATTTGG + Intergenic
1003081647 6:3025990-3026012 AATGCAGCCCAGGCAGAGGACGG + Intergenic
1003367047 6:5484844-5484866 GCTGAAGGCCAGGCAGACGGGGG + Intronic
1003551326 6:7104603-7104625 ACTGAGGACTAGGGAGAAGTAGG - Intergenic
1004101274 6:12614582-12614604 ACTGAAGACCATGACGAAGTGGG + Intergenic
1004756802 6:18619072-18619094 ACTGAGTAACAGGCAGAAGTTGG - Intergenic
1005958737 6:30682183-30682205 TGAGAAGCCCAGTCAGAAGTTGG - Intronic
1006189145 6:32196942-32196964 ATTGCAGCCCAAGCAGACGTGGG - Exonic
1006285983 6:33094716-33094738 ACTGAAGCCAGGGGAGATGTGGG + Intergenic
1006949895 6:37812999-37813021 CCTGAAGAGCAGGGAGAAGTAGG + Intergenic
1006994639 6:38247434-38247456 GCTGAAGACCAGGCAGCAGATGG + Intronic
1007321041 6:41028814-41028836 ACTGAAGCCTAGAGAGGAGTAGG - Intronic
1007337382 6:41163278-41163300 ACTGCAGCCCTGGCAGAAGGAGG + Intergenic
1007391656 6:41552927-41552949 ACTGAGGCCCAGAGAGAAGACGG - Intronic
1007393302 6:41562840-41562862 ACTGAGGCCCAGGCCCAAGTGGG + Intronic
1008063008 6:47018332-47018354 ACTGAGGCCCAATGAGAAGTTGG + Intronic
1008119366 6:47593402-47593424 ACTGCAGCACAGGCTGAAATAGG + Intronic
1010254963 6:73747109-73747131 AAAGAAGCCAAGGCAGAAATCGG - Intronic
1011902178 6:92312638-92312660 ACTTAAGCCCAGCCAGAGATTGG - Intergenic
1013280737 6:108634568-108634590 AGAGAAGCCAAGGCAGAAGGGGG - Intronic
1014173889 6:118310222-118310244 AGGGAAGCTCAGGCAGAAGGTGG - Intronic
1014892360 6:126858221-126858243 GCTCAAGCCCAGGCTGAAGAAGG + Intergenic
1015200528 6:130574908-130574930 ACTGCATTCCAGGCAGAAGAAGG - Intergenic
1015786651 6:136925480-136925502 ACTGAAACCCAGCCAGAAGAGGG + Exonic
1016730291 6:147421127-147421149 ACAGAATCCCAGGCAGAAGCAGG - Intergenic
1017058585 6:150459759-150459781 ATTGAAGCCCAAGCAGAGGAAGG - Intergenic
1017878942 6:158546476-158546498 ACTGAACCCCAGGAAGGAGCTGG + Intronic
1017878948 6:158546506-158546528 ACTGAACCCCAGGAAGGAGTTGG + Intronic
1018841375 6:167519569-167519591 ACTGAAGCCAAAGCAGAGGGTGG + Intergenic
1019336548 7:485532-485554 AGAGAACCCCTGGCAGAAGTGGG - Intergenic
1019341286 7:510268-510290 ACTGAGGCCCAGGGAGGAGAAGG - Intronic
1020441894 7:8226109-8226131 ACTTAAACCCAGCCAGATGTGGG - Intronic
1021758739 7:23882351-23882373 ACTGGACAACAGGCAGAAGTTGG - Intergenic
1021838862 7:24706304-24706326 GCTGAAGCCCCGGCAGCAGCAGG - Exonic
1022336133 7:29423749-29423771 ACGTAAGCCCAGGGGGAAGTGGG - Intronic
1022927198 7:35068630-35068652 ACTGGATAACAGGCAGAAGTTGG + Intergenic
1023843921 7:44110739-44110761 GCTGAAGCCCACGAAGAAGGTGG - Exonic
1025113447 7:56238254-56238276 TCTGACGCCCAGGCTAAAGTGGG - Intergenic
1025582342 7:62736339-62736361 TCTGAAGCCCAGGAAGAACAAGG + Intergenic
1026154318 7:67813863-67813885 ACTGCGGCCCAGGTAGAAGCAGG + Intergenic
1026506995 7:70993371-70993393 ACCAAAGGCTAGGCAGAAGTAGG - Intergenic
1029327588 7:99823309-99823331 ACAGATTCCCAGGTAGAAGTAGG + Intergenic
1029609070 7:101617025-101617047 ACTGAAGCCCAGAGAGAGGAAGG + Intronic
1029616902 7:101664899-101664921 ATTGAAGCCCACGGAGAAGAAGG - Intergenic
1029927697 7:104334990-104335012 ACTGATGCCCAGTAAGAAGTGGG - Intronic
1030508245 7:110451590-110451612 ACTGAAGCCCAAAGAGAATTTGG + Intergenic
1031535901 7:122932464-122932486 CCTGAAGCCATGGCAGATGTGGG - Intergenic
1031774497 7:125890459-125890481 GCAGAAGCCCAAGGAGAAGTAGG - Intergenic
1032232987 7:130092561-130092583 ACTAACACCCAGGCAGAAGAGGG - Intronic
1032992378 7:137408016-137408038 AAAGAAGCTCAGGCAGAATTCGG + Intronic
1033012208 7:137634813-137634835 ACTGAAGCCTACTCAGGAGTGGG + Intronic
1035371323 7:158380788-158380810 CTGGATGCCCAGGCAGAAGTTGG - Intronic
1036604856 8:10295743-10295765 TCTGCAGCCCAGGCAGCAGTGGG + Intronic
1036635770 8:10548674-10548696 ACAGAAGCCCAGGCACAAGGTGG + Intronic
1036690106 8:10939885-10939907 CCCGAAGCCCAGGGAGAAGCTGG - Intronic
1037082088 8:14799779-14799801 ACTGCAGGCCAGCGAGAAGTAGG - Intronic
1038604609 8:28987012-28987034 ACTGAAGCCCTGGCAGGACAAGG - Intronic
1042364202 8:67917693-67917715 ACTGAAGGACAAGCAGGAGTTGG - Intergenic
1042483912 8:69331285-69331307 AATGAGGCCCAGGGTGAAGTGGG - Intergenic
1043075639 8:75695453-75695475 TCTGCAGCCCAGGCAGGAGGGGG - Intergenic
1043195566 8:77287814-77287836 GCTGAGACCCAGGCAGATGTTGG + Intergenic
1044256413 8:90068492-90068514 ACTGAAGGCCACACAGAAATCGG - Intronic
1044628318 8:94255996-94256018 ACGGAAGCCCAGGGAGAGGCCGG - Intronic
1044824505 8:96183545-96183567 ACTCAAGCGCAGGCAGAAAGAGG + Intergenic
1046580967 8:116091847-116091869 ACTGAAGCACAGTAAGAATTTGG - Intergenic
1047141052 8:122140216-122140238 ACTAAAGCCCATGCCGAATTTGG + Intergenic
1047208571 8:122822382-122822404 ACTGAGGCCCAGGGAACAGTGGG + Intronic
1049624655 8:143614584-143614606 GCTGAGGCCCAGCCAGGAGTCGG - Intronic
1050382786 9:5048172-5048194 ACTCCAGCCCAGGCAACAGTGGG - Intronic
1050683205 9:8138126-8138148 ACTGAAGTCAAGACAGAATTGGG + Intergenic
1051135870 9:13919636-13919658 AGTGAAAGCCAGGCAGATGTGGG - Intergenic
1051508311 9:17848983-17849005 ACTGAGGGCCTGGCAGGAGTTGG - Intergenic
1052802633 9:32984428-32984450 ACTGAATTATAGGCAGAAGTGGG + Intronic
1055101632 9:72471616-72471638 ACTCCAGCCCAGGCGGCAGTTGG + Intergenic
1055678815 9:78693375-78693397 ACAGAAGACCATGTAGAAGTGGG - Intergenic
1055737787 9:79350761-79350783 ACTGAAGGAGAGGCAGAATTTGG - Intergenic
1055795734 9:79973024-79973046 AATGAAGACCAGGCAGCTGTGGG + Intergenic
1056430882 9:86526734-86526756 ACTGAAGCCCATGATGAGGTGGG - Intergenic
1057046922 9:91893198-91893220 ACAGAACCCCAGGCTGAAGCTGG + Intronic
1057259972 9:93577606-93577628 ACTGAAGGCCAGGGAGGAGGTGG - Intronic
1059304617 9:113344144-113344166 ACACAGGCCCAGGCAGAAGGGGG + Intergenic
1059308130 9:113370532-113370554 ACTAAGGCCCAGGGAGTAGTAGG - Exonic
1059464928 9:114462432-114462454 ACTGAGGCCCAGGGAGAGGAAGG + Intronic
1059984763 9:119811389-119811411 TGTGAAGCCCAGAGAGAAGTTGG - Intergenic
1060072814 9:120565179-120565201 TCTGAAGCCCAGACAGGGGTAGG - Intronic
1060252750 9:121999233-121999255 ACTGAAGTCCAGGAAGTGGTTGG - Intronic
1060861376 9:126957432-126957454 TCTCAGGCCCAGGCTGAAGTGGG - Intronic
1060943857 9:127558436-127558458 ACTGAGGCCCAGGAAGATGATGG - Intronic
1060972021 9:127743763-127743785 ACTGAAGCACAGAGAGAACTGGG + Intronic
1061045582 9:128163311-128163333 ACTGAGGCTCAGGAAGCAGTAGG + Intronic
1061131753 9:128712491-128712513 ACTGAGGCCCAGGGAGCAGGTGG + Intronic
1061853806 9:133430465-133430487 ACTGAACCCACAGCAGAAGTGGG + Intronic
1062542604 9:137048299-137048321 AGTGATGCCCAGGCTGAAGCGGG + Exonic
1203658976 Un_KI270753v1:23795-23817 GCTGAACCCCAGGCAGAAGCCGG + Intergenic
1185797638 X:2980632-2980654 ACTGGATAACAGGCAGAAGTTGG + Intergenic
1187016508 X:15334762-15334784 ACTGAAAACCTGGCGGAAGTGGG - Intronic
1187324960 X:18278263-18278285 ACTGAAGCAAAGGCTGAAGAGGG + Intronic
1189250583 X:39598261-39598283 ATGGAAGCCCAGGGAGAGGTGGG + Intergenic
1189293146 X:39900124-39900146 GCAGAAGCCCAGACATAAGTGGG - Intergenic
1192103079 X:68286441-68286463 GCTGAAGGTCAGCCAGAAGTGGG + Intronic
1192234087 X:69285260-69285282 ACTGAAGCCCAGGGAGAGGATGG + Intergenic
1194083782 X:89500739-89500761 ACTGGATAACAGGCAGAAGTTGG - Intergenic
1194850136 X:98859302-98859324 AATGAAGTCCAGGCTGAGGTGGG + Intergenic
1195275252 X:103275205-103275227 ACTTAAGCCAGAGCAGAAGTTGG - Intronic
1195752684 X:108174174-108174196 ACTGAAGGGCAGGCAGATATTGG + Intronic
1197580163 X:128272507-128272529 CCTGAAGCCCTGGCATAAGAAGG + Intergenic
1197717337 X:129718978-129719000 ACTGTAGCCCAGGGAGAGGATGG - Intergenic
1199237664 X:145509706-145509728 ACTGAGTGACAGGCAGAAGTTGG + Intergenic
1199881455 X:151976640-151976662 ACTGAATCCCAGGCAGACAAAGG + Intergenic
1199997364 X:153033901-153033923 ACTGAAGGCCAGGCAGAGCACGG + Intergenic
1200436431 Y:3156621-3156643 ACTGGATAACAGGCAGAAGTTGG - Intergenic
1201796451 Y:17901777-17901799 ACTGTAGCCCGGTCAGAATTGGG + Intergenic
1201805104 Y:18004208-18004230 ACTGTAGCCCGGTCAGAATTGGG - Intergenic
1202357834 Y:24070841-24070863 ACTGTAGCCCTGTCAGAATTGGG + Intergenic
1202512944 Y:25599272-25599294 ACTGTAGCCCTGTCAGAATTGGG - Intergenic