ID: 1083746703

View in Genome Browser
Species Human (GRCh38)
Location 11:64741114-64741136
Sequence AGCCTGCTGGGTGATGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 1, 1: 1, 2: 6, 3: 60, 4: 512}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083746703 Original CRISPR AGCCTGCTGGGTGATGGTGG GGG (reversed) Intronic
900155994 1:1203475-1203497 TGCATGCTGGGTGCTGGGGGAGG - Intergenic
900206516 1:1434086-1434108 CGCCTGCTGGGCGAGGGTGGGGG + Intergenic
900394012 1:2445686-2445708 ACCCTCCTAGGTGGTGGTGGGGG + Intronic
900776806 1:4591904-4591926 ACCTTGCTGGGTGACTGTGGAGG - Intergenic
900796076 1:4709206-4709228 TGCCTGGTGGGGGCTGGTGGGGG + Intronic
900882839 1:5394238-5394260 GGTCTTCTGGGTGATGCTGGAGG - Intergenic
901218492 1:7568305-7568327 ATCCTGATGAGGGATGGTGGTGG - Intronic
902599588 1:17532000-17532022 TGGCTGGTGGGTGGTGGTGGGGG - Intergenic
902659264 1:17890108-17890130 TGCCTGCTGGGTGCTGGGAGAGG + Intergenic
903911702 1:26731510-26731532 AGCCTGCTGGGAGAGCGTCGAGG - Exonic
904040270 1:27580244-27580266 AGCCTGCTGGGAAGGGGTGGAGG - Intronic
904496322 1:30888837-30888859 TCCCATCTGGGTGATGGTGGTGG - Intronic
905127597 1:35726464-35726486 ACAATGCTGGGTGGTGGTGGTGG + Intronic
905528260 1:38655760-38655782 AGCTGGTTGGGTGATGGTGGAGG + Intergenic
906218489 1:44058932-44058954 AGTCTCCTGGTTGATTGTGGAGG - Intergenic
907096503 1:51786067-51786089 ATACTGCTGGGAGAAGGTGGGGG - Intronic
907304094 1:53504285-53504307 AGTCTGAAGGGTGAAGGTGGAGG + Intergenic
907491790 1:54813249-54813271 AGGCTGCTGTGGGATGTTGGTGG - Intronic
908203214 1:61819083-61819105 AGCCTACTGGGGGATGGCTGTGG - Intronic
908395873 1:63725275-63725297 AGTCACCTGGGGGATGGTGGAGG - Intergenic
908463696 1:64370589-64370611 AGCTTGGTGGGAGATGGAGGTGG + Intergenic
908540174 1:65114624-65114646 AGCCTGCTGAGTGATAGCAGTGG - Intergenic
908551233 1:65210603-65210625 CTCATGTTGGGTGATGGTGGTGG + Intronic
909099869 1:71336922-71336944 TTCCAGCGGGGTGATGGTGGTGG + Intergenic
909489814 1:76213288-76213310 AGGGTGCTAGGAGATGGTGGAGG + Intronic
909608912 1:77532791-77532813 TGCCAGCAGGGTGATGTTGGGGG + Intronic
910762205 1:90744914-90744936 TGCCTGCTGTGTGAAGGTGATGG + Intergenic
910927268 1:92410140-92410162 AGCCTGCTGGGCGAGGGGTGGGG - Intergenic
911059875 1:93738670-93738692 AGCCTGGTGGGAGATGCTGGTGG + Intronic
911068012 1:93809388-93809410 AGGCTGAGGGGTGGTGGTGGGGG + Intronic
912945520 1:114081040-114081062 AGTGTGCTGGGAGAGGGTGGAGG + Intergenic
913062917 1:115224337-115224359 ATACTGCAGGGTTATGGTGGGGG + Intergenic
913185078 1:116363556-116363578 AGCCTGCTGGGAGTTGGTCCAGG + Intergenic
913352054 1:117872678-117872700 GGCCTGTTGGGGGAGGGTGGGGG + Intronic
914329616 1:146654742-146654764 AGCCTGCTGGGAACTGTTGGTGG - Intergenic
915243390 1:154539971-154539993 AGCCTGGTGGGTGAAGGGGAGGG + Intronic
915278666 1:154807496-154807518 AGCCTGCTCTGGGATGGTGGCGG + Intronic
916599613 1:166279295-166279317 AGCCTATTTGGTGATTGTGGTGG + Intergenic
918420823 1:184362822-184362844 AGCCTGTTGGGCAATGGTGAGGG - Intergenic
918826895 1:189336421-189336443 AGACTGCTGTGTATTGGTGGTGG - Intergenic
919170447 1:193947802-193947824 AGCCTGTTGTGGGATGGGGGCGG + Intergenic
920101859 1:203521889-203521911 AGGACGCTGGGTGATGGTGGAGG + Intergenic
920183620 1:204147421-204147443 AGGTTGCTGGGAGAAGGTGGGGG + Intronic
920390935 1:205600527-205600549 AGAAAGCTGGGTGGTGGTGGAGG + Exonic
920399779 1:205669641-205669663 AGCCTGCGGGGTCAGGGTGGGGG - Intronic
920508134 1:206531477-206531499 AGGCTGCAGGGTGAGGGTGCAGG + Intronic
922568468 1:226617460-226617482 TGCCTGCTGGCTGGGGGTGGGGG - Intergenic
923063133 1:230495365-230495387 ACCCTGCTGGTTCATAGTGGAGG + Intergenic
924090051 1:240492679-240492701 TGACTGCTGGGTGGCGGTGGTGG + Exonic
924918842 1:248604495-248604517 GGCCTGTTGGGTGGTGGTGGGGG + Intergenic
1063406869 10:5804473-5804495 AGAGTGCTGGGGGATGGTGGTGG - Intronic
1064488380 10:15821501-15821523 ACCCTGCTGGTTTAGGGTGGGGG + Intronic
1065453604 10:25883550-25883572 AGCCTACTGGGTGATGATAGGGG - Intergenic
1065869944 10:29947651-29947673 TGCCTGCTGGGTGGAGGTGGGGG + Intergenic
1066025532 10:31355549-31355571 AACCTGCTCTGGGATGGTGGGGG + Intronic
1067106768 10:43371718-43371740 GGGCTGCTGGGTGAAGGGGGTGG + Intronic
1067562953 10:47316658-47316680 AGCCTGCTGGGAGATGCTAGAGG - Intergenic
1067800985 10:49359671-49359693 AGCCTGAGTGGTGGTGGTGGGGG - Intergenic
1068197153 10:53731674-53731696 GGCCTGTTGGGGGATGGGGGCGG + Intergenic
1068938574 10:62658772-62658794 AGCCTGCTGGGTCAAGTGGGTGG + Intronic
1069979592 10:72242978-72243000 AGGCTGCTGGGAGCTGCTGGTGG - Intergenic
1070700651 10:78599378-78599400 TGCTAGCTGGGTGAAGGTGGAGG + Intergenic
1071500996 10:86204315-86204337 AGGCTGCAGGGCCATGGTGGTGG + Intronic
1072026783 10:91467609-91467631 AGGCTGGTGTGTGCTGGTGGGGG - Intronic
1072417657 10:95262592-95262614 AGGGTGCTGGGTGGGGGTGGGGG - Intronic
1072640317 10:97206541-97206563 AGCCTGGTGAGTGATGCTGGGGG + Intronic
1072735854 10:97879218-97879240 AGCCTTATTGGTGTTGGTGGTGG - Intronic
1073332014 10:102676355-102676377 AAGCTGCTGGGTGGGGGTGGGGG - Exonic
1074556541 10:114496490-114496512 AGCCTGTTGGGGGAGGGTGGCGG + Intronic
1075055804 10:119217610-119217632 AGCCCCATGGGTGGTGGTGGTGG + Intronic
1075323953 10:121515062-121515084 AGCTGGCTGGGTCATGGGGGAGG + Intronic
1076344988 10:129773763-129773785 CTCCTTCTGGGTGGTGGTGGTGG - Intergenic
1076772956 10:132677037-132677059 AGGTGCCTGGGTGATGGTGGGGG - Intronic
1076772970 10:132677097-132677119 AGGTGCCTGGGTGATGGTGGGGG - Intronic
1076948546 10:133666873-133666895 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076949530 10:133670172-133670194 GGCCGGCGGGGTGGTGGTGGTGG - Intronic
1076950514 10:133673471-133673493 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076951504 10:133676781-133676803 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076952494 10:133680091-133680113 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076953477 10:133683390-133683412 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076955450 10:133743052-133743074 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076956440 10:133746362-133746384 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076957428 10:133749671-133749693 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076958412 10:133752970-133752992 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076959401 10:133756280-133756302 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076960385 10:133759579-133759601 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1077368477 11:2170795-2170817 AGCCTGGTGGGGGAGGGTAGGGG + Intronic
1078283717 11:9929982-9930004 GGCCTGTTGGGGGATGGTGGGGG + Intronic
1078596091 11:12688033-12688055 GGCCTACAGGGTGATGGAGGGGG - Intronic
1079442643 11:20530735-20530757 AGACTACAGGGTGATGGTAGTGG + Intergenic
1079491592 11:20994971-20994993 AGACTGCAAGGTGAGGGTGGTGG - Intronic
1079611240 11:22435270-22435292 TGCCTGCTGGGGGTTGGGGGAGG + Intergenic
1079885306 11:25981063-25981085 AGGCTGCGGGGTGGAGGTGGGGG + Intergenic
1081756696 11:45549789-45549811 AGCCTGCTGGGGAAAGCTGGTGG + Intergenic
1081903169 11:46647231-46647253 GACTTGCTGGGTGGTGGTGGTGG + Intronic
1082078391 11:47992967-47992989 TGCCTGGTGGGGGATGGAGGTGG + Intronic
1083148142 11:60773671-60773693 AGCCTGCAGGGTGAAGGGGAGGG + Intronic
1083186653 11:61021720-61021742 TGCCTGCGGGGTGAGGGTTGGGG + Intergenic
1083541778 11:63516308-63516330 GGCCTGCTGGTTCATGCTGGTGG - Exonic
1083746703 11:64741114-64741136 AGCCTGCTGGGTGATGGTGGGGG - Intronic
1083821036 11:65171490-65171512 AGCCTTCTGGGTGAGTTTGGAGG + Exonic
1083943566 11:65911697-65911719 GGCCTGATGGGTGTTGGAGGTGG - Intergenic
1083997349 11:66278859-66278881 AGGCGGCTGGATGGTGGTGGGGG - Intronic
1084935858 11:72586325-72586347 AGTCTGCAGGGTCATGGGGGTGG - Intronic
1085988312 11:81810497-81810519 AGCTTGCTGAGAGATAGTGGAGG - Intergenic
1086333242 11:85775037-85775059 AGCTAGCTTGGTGATGGTGTTGG - Intronic
1088884941 11:113999031-113999053 TGCCTTCTGGGTAAGGGTGGAGG - Intergenic
1089159312 11:116425165-116425187 AGCCTGAGGGGAGAAGGTGGAGG + Intergenic
1091782220 12:3221036-3221058 AGCCTGCTGGCTGTTGGTACGGG + Intronic
1091825989 12:3513224-3513246 AGACGACTGGGTGATGATGGGGG - Intronic
1092029051 12:5268766-5268788 AGCCTGGTTGGAGATGGGGGTGG - Intergenic
1092659511 12:10723058-10723080 AGCCTGCGGGAGGGTGGTGGTGG + Exonic
1093180807 12:15965451-15965473 GGCCTGTTGGGGGAGGGTGGAGG - Intronic
1093928031 12:24928043-24928065 AGCTTGCTGGGGGCTGGTGGTGG - Intronic
1096260414 12:50086472-50086494 AGAATGCTTGGTGGTGGTGGTGG + Intronic
1096520195 12:52180681-52180703 TGCCTCCTGGGTGAGAGTGGGGG + Intronic
1096649326 12:53054156-53054178 AGCCTGCTGGGTCCTGAGGGTGG - Intronic
1096661128 12:53124674-53124696 AGGTTTCTGGGAGATGGTGGTGG - Intergenic
1096866794 12:54569261-54569283 GGCCTGCTGGGTGAAGGTGGAGG - Exonic
1097234005 12:57527651-57527673 AGCCTGCTGGGTGAGTCTGAGGG + Exonic
1097416525 12:59322955-59322977 AGTCTGCAGGGGGATGGGGGAGG - Intergenic
1099708770 12:86192511-86192533 AGCAAGGTGGGTGATGGGGGTGG - Intronic
1100604932 12:96143807-96143829 AGCCTGCTGGATGGTGGTGGTGG + Intergenic
1100679065 12:96899039-96899061 AGGCTGGGGAGTGATGGTGGAGG - Intergenic
1100762478 12:97824469-97824491 AGCCTGCAGGGTGGCGGTTGCGG - Intergenic
1101280923 12:103254752-103254774 GGCCTGCTGGGGGATTGTGTGGG + Intronic
1101608499 12:106268822-106268844 TGGGTACTGGGTGATGGTGGTGG - Intronic
1101641337 12:106587318-106587340 AGACTGCTGGAAGTTGGTGGTGG + Intronic
1102823385 12:115926685-115926707 AGCCTGCAGGCTGTTGATGGGGG + Intergenic
1103436009 12:120925876-120925898 CCCCTGCTGGGGGATGGGGGTGG + Intergenic
1103530078 12:121595096-121595118 AGACTGCTGGCTGGTGGCGGTGG - Intergenic
1103586271 12:121958616-121958638 AGCCTGCTGGGGGCTGGAGTCGG - Intronic
1103939829 12:124495650-124495672 AGCCATCTGGGTGGTGGTGAGGG - Intronic
1104118424 12:125773256-125773278 GACGTGCTGGGTGTTGGTGGAGG - Intergenic
1106627670 13:31437211-31437233 AGCCAGCAGTGTGATGTTGGAGG + Intergenic
1107019503 13:35737087-35737109 AGCCAACTGAGAGATGGTGGTGG - Intergenic
1107300557 13:38961550-38961572 AACCTTCTGGGAGGTGGTGGTGG - Intergenic
1107682283 13:42864534-42864556 ACTCTCCTGGGAGATGGTGGTGG - Intergenic
1107808366 13:44175608-44175630 CTGCTGCTGGGGGATGGTGGGGG + Intergenic
1107809151 13:44182646-44182668 GGCCTGTTGTGGGATGGTGGCGG - Intergenic
1108463535 13:50692106-50692128 ATCCTGCTGGGTCTTGCTGGTGG - Intronic
1108587430 13:51882912-51882934 AGCCTGCTGGGTGGAGTGGGTGG - Intergenic
1108798539 13:54064582-54064604 AGCCTGGTCTTTGATGGTGGTGG - Intergenic
1110565351 13:76952198-76952220 TGCGTGATGGGTGGTGGTGGAGG - Intronic
1110939199 13:81328361-81328383 GGCCTGCTGGGGGGTGGTGGGGG - Intergenic
1112302183 13:98240338-98240360 TGCCTGCGTGGTGATGGTGACGG + Intronic
1112491416 13:99867840-99867862 ATTCTGCTGGGTGATGGTGGAGG - Intronic
1113485043 13:110647037-110647059 GGCCTGCTGGGTGCTGCTGGTGG - Intronic
1113607399 13:111620179-111620201 AGCCCTCTGGGAGCTGGTGGTGG + Intronic
1113694252 13:112332795-112332817 AGGCTGCAGGGAGATGGAGGGGG - Intergenic
1113720818 13:112554608-112554630 ATCCTGCTGTGTGATGGCTGAGG - Intronic
1114385281 14:22247626-22247648 TTCCTGCTGGGTGTGGGTGGAGG + Intergenic
1114673863 14:24428796-24428818 CCCCTGCTGGCTCATGGTGGTGG + Exonic
1115076684 14:29400887-29400909 AGCCTGTGTGGTGTTGGTGGAGG - Intergenic
1115949375 14:38702702-38702724 GGCCTGTTGGGAGAGGGTGGAGG - Intergenic
1116651081 14:47593717-47593739 GGCCTGTTGGGGGATGGGGGAGG + Intronic
1116765994 14:49070932-49070954 AACCTGCTGTGGGTTGGTGGTGG + Intergenic
1118727355 14:68638574-68638596 GGGTTGCTGGGTGATGGGGGAGG + Intronic
1119409609 14:74422208-74422230 TGCTTGCTGGGTGATGGGGGTGG + Intronic
1119618646 14:76115032-76115054 AGCCTGCTGGGTAAGGCTGCAGG + Intergenic
1120820177 14:88905082-88905104 ATGATGCTGGGTGATGCTGGAGG - Intergenic
1121106018 14:91280189-91280211 CACCTGCTGGGTGCTGGGGGTGG - Intronic
1121282115 14:92706468-92706490 AGCCTGCTGGCTCACCGTGGGGG + Exonic
1122027500 14:98888345-98888367 ATCCAGGGGGGTGATGGTGGTGG + Intergenic
1122262604 14:100531781-100531803 AGCCTGCTGGGTGGGGGTGATGG - Intergenic
1122632365 14:103112784-103112806 AGCCTGCAGGGTGCCGGTGGGGG + Intergenic
1124149931 15:27168331-27168353 TGCCTGCTGGGGAGTGGTGGAGG - Intronic
1124206234 15:27723521-27723543 TGCCTTCTTGGTGGTGGTGGGGG - Intergenic
1124407351 15:29404474-29404496 AGCCTGCTGGGTGCTGAAGGGGG - Intronic
1126100061 15:45113423-45113445 AGCCTGCGGGGTGAGGGTGGGGG + Exonic
1126572372 15:50165467-50165489 TTCCTGGTGGGGGATGGTGGGGG + Intronic
1126797952 15:52275522-52275544 AGGCAGCTGGGTGTTGGTGATGG - Intronic
1127218087 15:56846332-56846354 AGCCTGCAGGGACATGGTGGCGG - Intronic
1128215779 15:65933175-65933197 GGCCTGCTGGGGACTGGTGGGGG - Intronic
1128350790 15:66887031-66887053 TGGCTTCTGGGTGATGGAGGAGG + Intergenic
1128595518 15:68944030-68944052 AGCCTGCAGGGGGATGGTTCAGG + Intronic
1129190694 15:73935846-73935868 AGGGTGCAGGGTGGTGGTGGAGG + Intronic
1129377817 15:75145261-75145283 AGCCTGCAGGGGGAAGGGGGTGG + Intergenic
1129679010 15:77647394-77647416 AGGCAGCTGGGGGGTGGTGGGGG + Intronic
1131195471 15:90351794-90351816 AGCCTGCAGGGTGTTTGCGGAGG - Intergenic
1132317498 15:100900639-100900661 AGCCTCCAGGGTGTTCGTGGAGG + Exonic
1132786764 16:1661328-1661350 GGCCTCCTGGGTGACGGAGGGGG + Intronic
1132786781 16:1661367-1661389 GGCCTCCTGGGTGACGGAGGGGG + Intronic
1132786798 16:1661406-1661428 GGCCTCCTGGGTGACGGAGGGGG + Intronic
1132786815 16:1661445-1661467 GGCCTCCTGGGTGACGGAGGGGG + Intronic
1132786832 16:1661484-1661506 GGCCTCCTGGGTGACGGAGGGGG + Intronic
1132786849 16:1661523-1661545 GGCCTCCTGGGTGACGGAGGGGG + Intronic
1133511391 16:6461094-6461116 AGCCTGTTGGGAGAGGGTGGGGG + Intronic
1133923942 16:10179705-10179727 AGGCTGTGGGGTGGTGGTGGTGG - Intronic
1134869686 16:17640598-17640620 GGCCTGTTGGGGGAGGGTGGAGG - Intergenic
1135462992 16:22661302-22661324 TGGCTGCTGTGTGATGATGGGGG - Intergenic
1135698035 16:24607414-24607436 AGCCTGCAGTGCCATGGTGGTGG + Intergenic
1135840424 16:25871157-25871179 AGGCAGCGGGGTGATGGAGGTGG + Intronic
1135949351 16:26898738-26898760 AGCCTGCTGGGTGATGGTGTTGG - Intergenic
1136005568 16:27326741-27326763 AGGCTGGTGGGTGCTGTTGGTGG + Intronic
1136070685 16:27785179-27785201 GTCCTGCTGGGAGATGGCGGTGG - Intergenic
1136460947 16:30409655-30409677 GGCCTGCTGGGTGCTGGGGGAGG + Intronic
1136672132 16:31867868-31867890 GGCCTGTTGGGGGATGGGGGAGG + Intergenic
1137044086 16:35640098-35640120 ACCCAGCTGGGAGATGTTGGAGG - Intergenic
1138574258 16:57897523-57897545 AGCTTGCTGGCTGTTGGGGGCGG - Exonic
1139296714 16:65907632-65907654 ACTCTTCTGGGTAATGGTGGTGG + Intergenic
1139373277 16:66481308-66481330 AGCTTGCTGGGCGAGGGTAGGGG - Exonic
1140003944 16:71056195-71056217 AGCCTGCTGGGAACTGTTGGTGG + Intronic
1141619453 16:85229093-85229115 AGCCTGCAGCGTGGGGGTGGCGG + Intergenic
1142102816 16:88284665-88284687 ACCCTGCAGAGTGTTGGTGGTGG - Intergenic
1142130988 16:88431368-88431390 AGCCTGCTGGGTGGTCCTGGGGG + Exonic
1142248051 16:88978791-88978813 AGCACCCTGGGTGAGGGTGGTGG + Intergenic
1142363470 16:89638002-89638024 AGCCTGCCTGCTGGTGGTGGTGG - Intronic
1142401234 16:89859872-89859894 TGCCTGCTGGGATGTGGTGGTGG - Intronic
1142434475 16:90047769-90047791 GACCTGCTGGGGGGTGGTGGGGG + Intergenic
1142756382 17:2018771-2018793 ATCCTGCAGGGTGGGGGTGGAGG + Intronic
1143020908 17:3916805-3916827 ACCCTGGTGGGGGAGGGTGGAGG - Intergenic
1143025897 17:3941906-3941928 AGTCTGCTGTGGGCTGGTGGGGG - Intronic
1143353178 17:6304412-6304434 TGCCTGAGGGATGATGGTGGTGG - Intergenic
1143747184 17:9003292-9003314 AGCCTGCGCGGGGATGGCGGGGG + Intergenic
1144178725 17:12732483-12732505 TGCCTGGTGAGTGCTGGTGGTGG - Intronic
1144998775 17:19288999-19289021 ATCCAGGTGGGAGATGGTGGGGG + Intronic
1145028879 17:19489559-19489581 CCCCTGCTGGGTGAGGGTTGGGG + Intergenic
1145792780 17:27638243-27638265 AGCCTGCAGGGAGAAGGTGTGGG - Exonic
1145807646 17:27746112-27746134 AGCCTGCAGGGAGAAGGTGTGGG - Intergenic
1146628869 17:34455770-34455792 AGTGTTCTGGGTGGTGGTGGGGG - Intergenic
1146971126 17:37073233-37073255 GGCCTGCTGGGAGGTGGAGGGGG + Intergenic
1148044994 17:44738049-44738071 AGCCAGGTGTCTGATGGTGGTGG + Intronic
1148460110 17:47834890-47834912 AGGCTGTTTGGTGGTGGTGGTGG + Intronic
1148901948 17:50884995-50885017 CCCCTGCTGGGTGAGTGTGGTGG - Intergenic
1149356029 17:55840164-55840186 AGTCTGCTGGGACAGGGTGGGGG + Intronic
1149690643 17:58573002-58573024 AGGGGGCGGGGTGATGGTGGTGG - Intronic
1150123142 17:62619751-62619773 AGCCTCCTGGGACAGGGTGGAGG + Intergenic
1150193689 17:63271609-63271631 GGCCTGTTGGGGGATGGGGGGGG - Intronic
1150488000 17:65557378-65557400 AGGCAGCTGGGTTGTGGTGGAGG - Intronic
1150492304 17:65582921-65582943 TGCCTGGAGGGAGATGGTGGTGG - Intronic
1151463855 17:74272132-74272154 AGCCTTCTGGGTGAGGGTGGGGG + Intergenic
1153774046 18:8437339-8437361 TCCCTGCTGGGAGAGGGTGGAGG - Intergenic
1156490596 18:37493646-37493668 AGCCTGCAGGGTGGGGGTGATGG + Intronic
1157177928 18:45468040-45468062 ATCCTGCTGGGAGGTGGGGGTGG - Intronic
1157287996 18:46390328-46390350 TGCCCGCTGGGTGTTGGTGCAGG + Intronic
1157564551 18:48670941-48670963 AGCCTACTCGGTGATGCTGCAGG + Intronic
1157664055 18:49470326-49470348 GGCTTGCGGGGTGGTGGTGGGGG - Intergenic
1157700518 18:49759178-49759200 CTCCTGCTGGCTGATGGGGGTGG + Intergenic
1158574404 18:58624032-58624054 AGGCTGCTGAGTGATGGAAGAGG - Intronic
1158826903 18:61231765-61231787 AGCCAGGTGGGTGGTGGTGATGG - Intergenic
1159011628 18:63063607-63063629 GGCCTGCAGGGTGTGGGTGGTGG - Intergenic
1161050347 19:2160590-2160612 AGGCTACTGGGAGCTGGTGGAGG - Intronic
1161101316 19:2423491-2423513 AGCCAGCTGGGTGGTGATAGAGG + Intronic
1161575605 19:5052728-5052750 AGTCTGGTGGGTGATGGAGCTGG + Intronic
1162371692 19:10283801-10283823 AGCCAGCAGGGAGAAGGTGGGGG + Intronic
1162477964 19:10912269-10912291 AGCGTGCTGGGCCATGGTGCTGG - Exonic
1163195642 19:15717722-15717744 AGGCTACTGGGTGGTGGAGGAGG - Intergenic
1163392619 19:17039533-17039555 CTCCTGCTGGATCATGGTGGTGG + Intergenic
1163469036 19:17486314-17486336 AGCCAGCTGGGGTATGGGGGAGG + Intronic
1163505213 19:17701722-17701744 AGGCTACTGTGTGATAGTGGAGG + Intergenic
1163633310 19:18427687-18427709 ACCCTGCTGGGTGGTGGGGCAGG + Intronic
1163775375 19:19214266-19214288 GGCCTGCGGGGTGCTGGAGGAGG - Intronic
1164655154 19:29915605-29915627 AGCCAGTTGGGTGGGGGTGGGGG + Intergenic
1164670868 19:30071242-30071264 AGCTTGGTGGGTGAGGCTGGGGG + Intergenic
1165149889 19:33754032-33754054 AGGTTGTTGGGGGATGGTGGGGG - Intronic
1166781491 19:45345715-45345737 AGCCGGCTTGGAGATGCTGGAGG + Exonic
1166949443 19:46416675-46416697 AGGCTGCAGGGAGATGGTGGGGG + Intergenic
1167615695 19:50531681-50531703 AGCCTCGTGGGGGATGGTTGAGG + Intronic
1167679847 19:50912545-50912567 AGCTTGGAGAGTGATGGTGGGGG + Intergenic
1168338540 19:55610924-55610946 GGCCTGGTGGGAGAGGGTGGTGG - Intronic
1168350650 19:55674069-55674091 AGGCGGCTGGGGGAGGGTGGGGG + Exonic
925325025 2:3012136-3012158 AGCCCTCTGGGTGGGGGTGGGGG - Intergenic
925781726 2:7387848-7387870 TGCCAGCCTGGTGATGGTGGGGG + Intergenic
925919544 2:8629474-8629496 AGCCTGCTGGGTGAGGCGGTGGG - Intergenic
926251217 2:11156473-11156495 ACCCCACTGGGTGATGGCGGGGG - Intronic
927148194 2:20180420-20180442 AGCCTGCATGGTGGTGGTGGTGG + Intergenic
927152544 2:20204155-20204177 AGCCGGCAGGGTGGAGGTGGAGG + Exonic
927716398 2:25356083-25356105 GGGCTGCTGGCTGCTGGTGGGGG - Intergenic
927859740 2:26553163-26553185 GGCCTGCTGAGTGATTGTGCAGG - Intronic
928171813 2:29009276-29009298 AGCCTGCGGGGTGGGGGTGAAGG + Intronic
928864128 2:35896397-35896419 ATGCTGCTGGGAGATGGAGGAGG + Intergenic
929359831 2:41074379-41074401 TTCCTGCTGGGTGGTGGTGGAGG + Intergenic
929815021 2:45223656-45223678 AGCCTGTTGGGTTTTGGGGGCGG + Intergenic
929874572 2:45786040-45786062 GCCCTGCTGGGTCATCGTGGGGG + Intronic
930025081 2:47024854-47024876 TGCCTGCAGAGTCATGGTGGAGG - Intronic
930054411 2:47240872-47240894 AGCCTTCAGGGTGATGGGAGAGG + Intergenic
930521532 2:52473620-52473642 AGCTCGCTGGTTGATGGTGCTGG - Intergenic
931234945 2:60405445-60405467 AGCCTGTTTGGTGATGGAAGAGG - Intergenic
933116218 2:78476305-78476327 ACAATGCTGGGTGAGGGTGGGGG + Intergenic
933285555 2:80381153-80381175 AGTCTCCTGGGTGTTGGTGCTGG + Intronic
933719680 2:85390003-85390025 AGGCTCCTGGGGAATGGTGGGGG + Intronic
933869625 2:86553031-86553053 AGCTTGATGGGGGATGGTGGGGG + Intronic
934572070 2:95379130-95379152 AGCCTCCTGGGGGATGGGTGGGG - Intronic
934617084 2:95778880-95778902 AGCCTTGTGGGAGGTGGTGGAGG + Intergenic
934643809 2:96045679-96045701 AGCCTTGTGGGAGGTGGTGGAGG - Intergenic
934837226 2:97601773-97601795 AGCCTTGTGGGAGGTGGTGGAGG - Intergenic
934984045 2:98871037-98871059 AGCATGCTGGGAGGCGGTGGAGG - Intronic
935251479 2:101265758-101265780 ATCCAGCTGTGTGATGGGGGCGG - Intronic
935812808 2:106816865-106816887 TCCCTGCTGGGGGATGGAGGAGG - Intronic
936465393 2:112744145-112744167 AGCCTTCTGGTTAATGATGGTGG + Intronic
937721234 2:125099517-125099539 ATTCTGGTGGGTGGTGGTGGGGG - Intergenic
937911031 2:127075760-127075782 AGCATTCTGGGAGAGGGTGGTGG - Intronic
938371061 2:130768548-130768570 ACCCTGCTGGGGGATGGAGGGGG + Intergenic
939175147 2:138739588-138739610 AGGCTGGTGGGACATGGTGGGGG + Intronic
940183246 2:150957131-150957153 AGCTTGCTGAGAGATAGTGGAGG - Intergenic
941013920 2:160333116-160333138 AGGCTGCTGGGTGATGATGGAGG + Intronic
942302015 2:174571858-174571880 GGCCTGCTGGGAGGTGGCGGCGG + Exonic
942913269 2:181271896-181271918 ATTCTGCTGGGTGATGGGGAGGG - Intergenic
943355382 2:186849126-186849148 AGCATGCTGGGTGCGGGCGGAGG + Exonic
943833506 2:192490346-192490368 AGCCCACTGGGTGATGATAGGGG + Intergenic
944722775 2:202440612-202440634 AGGCGGCTGGGAGGTGGTGGAGG + Intronic
945444634 2:209921618-209921640 AGCCTCCTGGGTGATGGGGATGG - Exonic
945599271 2:211838243-211838265 AGCGGGGTGGGGGATGGTGGTGG + Intronic
947787557 2:232837242-232837264 AGCCTGCTGACTGATGGCTGAGG + Intronic
947863125 2:233376833-233376855 AGCCTCCTGGGTGCTGCTGCGGG + Intronic
947872814 2:233449188-233449210 AGCCTCCTCGGCAATGGTGGGGG - Exonic
948711054 2:239825817-239825839 AGTGTGCTGGGTCATGGTGCTGG - Intergenic
948745757 2:240092357-240092379 GGCCTGCTGGGTGGTGGGGTGGG - Intergenic
948924679 2:241087684-241087706 GGCATGCTGGGTGCTGGGGGGGG + Exonic
1168978819 20:1988027-1988049 GGCCTGCTGGGTGTTGGTCTGGG + Intronic
1169860505 20:10146530-10146552 AGACTTCTGGGTGGTGGAGGTGG - Intergenic
1170775379 20:19370889-19370911 AGCCTGGTGGGTCCCGGTGGTGG + Intronic
1171376798 20:24699392-24699414 AGCCTGCTGGGTGCTGGAGCGGG + Intergenic
1172194520 20:33083093-33083115 GGCCTGCTTGGTGGTGGGGGTGG + Intronic
1172589329 20:36106143-36106165 CTCCTGCTGGGTGTGGGTGGGGG + Intronic
1172613665 20:36269196-36269218 GGCCTGCAGGGAGCTGGTGGGGG + Intronic
1172858580 20:38028631-38028653 GTCCTGTTGGTTGATGGTGGTGG - Intronic
1172931493 20:38589339-38589361 AGGCTGCAGGATGATGGGGGTGG + Intergenic
1173485570 20:43438581-43438603 AGGCTGCTGGGTGGGGGTGTGGG - Intergenic
1174546875 20:51332282-51332304 GGCCTGATGGGGGATAGTGGGGG - Intergenic
1175272340 20:57743260-57743282 AGCTTGCTAGGTAATGGGGGAGG - Intergenic
1175477376 20:59286355-59286377 AGCATGCTGGGTTATGGGGAAGG + Intergenic
1175790786 20:61738692-61738714 AGCCTGGTGGAGGATGGGGGCGG - Intronic
1175809419 20:61849721-61849743 ACCTTGCTGGGTGACAGTGGAGG - Intronic
1176023829 20:62975925-62975947 CGCCTGCTGGGGGAAGGTTGGGG - Intergenic
1176314830 21:5232489-5232511 GCCCAGCTGGGGGATGGTGGGGG - Intergenic
1176350742 21:5794176-5794198 AGCCCATTGGGTGATGATGGGGG + Intergenic
1176357556 21:5914760-5914782 AGCCCATTGGGTGATGATGGGGG + Intergenic
1176545063 21:8192246-8192268 AGCCCATTGGGTGATGATGGGGG + Intergenic
1176564014 21:8375291-8375313 AGCCCATTGGGTGATGATGGGGG + Intergenic
1176982430 21:15398515-15398537 AGCATGGTGGGTGTTGGTGAGGG + Intergenic
1180201874 21:46229144-46229166 GGCCTGGTGGGTGCGGGTGGGGG + Intergenic
1180635732 22:17261627-17261649 AGCCAACTGGGTGGTGGTGAGGG + Intergenic
1180891310 22:19291360-19291382 GGCCGGCTGGGGAATGGTGGGGG - Intronic
1180959694 22:19756980-19757002 ATCCTGCTGCGCGATGGAGGCGG + Intronic
1181163451 22:20971093-20971115 AGCCTTCTGGGAGGAGGTGGAGG + Intronic
1181395331 22:22617386-22617408 AGCCTACTGTGTCATGATGGTGG - Intergenic
1181560294 22:23696090-23696112 ACCCTGATGGGTGGTGGTGCTGG + Intronic
1181630840 22:24150489-24150511 AGCCGGCCTGCTGATGGTGGTGG - Intronic
1181636274 22:24176297-24176319 AGCCTCCTGGGGGCTGGTGCTGG - Intronic
1182079354 22:27518196-27518218 AGCTGGCTGGGTCCTGGTGGAGG + Intergenic
1183080339 22:35451960-35451982 ATCCTGCAGGGTGATGGGGTGGG + Intergenic
1183131455 22:35840527-35840549 AGCCTGCTGGGAGGGGGTGGGGG - Intronic
1183242423 22:36667945-36667967 TGCTTGCTGTTTGATGGTGGTGG - Intronic
1183457904 22:37932699-37932721 GGCCTGCTGGGTGGGGCTGGGGG + Intronic
1184122389 22:42460555-42460577 AGTTGGCTGGGAGATGGTGGCGG + Intergenic
1184150748 22:42636965-42636987 AGCTTTCTGGATGAGGGTGGTGG - Intronic
1184277304 22:43417074-43417096 AGACTGCTGGGGGGTGGCGGTGG + Intronic
1184549585 22:45197367-45197389 AGTCTGCAGGGTGAGGATGGTGG - Intronic
1184671207 22:46013086-46013108 GGCCTCCTGGGTGATGAGGGCGG - Intergenic
1184926905 22:47648747-47648769 AGCCATCAGGGTGTTGGTGGAGG + Intergenic
1184947465 22:47813701-47813723 TGGCTGCGGGGTGAGGGTGGTGG + Intergenic
1185100118 22:48835880-48835902 AGCCGGATGGGTGGTGGTGCTGG - Intronic
1203249933 22_KI270733v1_random:108484-108506 AGCCCATTGGGTGATGATGGGGG + Intergenic
950210093 3:11116881-11116903 ATCCTGGTGGGAGATGGAGGTGG - Intergenic
951606285 3:24438674-24438696 AGCCTGCTGGGGGATGCTCCTGG + Intronic
951692736 3:25414010-25414032 AAACTTCTGGGTGGTGGTGGTGG - Intronic
952428070 3:33195404-33195426 AAACTGCTGGGGGATGGAGGTGG + Intronic
953031704 3:39184067-39184089 TGCCTGCTCGGTGACTGTGGTGG + Exonic
954314446 3:49793609-49793631 AGCCTGAGAGGTGATGGTTGGGG + Exonic
954361933 3:50126684-50126706 AGCTGGCTTGGTGATGGGGGTGG - Intergenic
954513139 3:51145810-51145832 AGACTGATGGGTGGAGGTGGTGG + Intronic
955792674 3:62604771-62604793 AGGCAGCTGGGTGATGGAGATGG - Intronic
956728251 3:72174484-72174506 TGGCAGCTGGGTGGTGGTGGGGG - Intergenic
960786030 3:121373523-121373545 AGCCTTCTGGGTGGATGTGGAGG - Intronic
961049408 3:123733949-123733971 GGCCTGCAGGGTGATGGAGCTGG + Exonic
961513722 3:127420143-127420165 GGGCTGCAGGGAGATGGTGGGGG - Intergenic
962210117 3:133470867-133470889 ACCCAGCTTGGTGATGGTAGCGG + Intronic
963930934 3:151003736-151003758 ATCCAGCTGGCAGATGGTGGTGG + Intergenic
963981252 3:151539661-151539683 AACCAGCTGGGTGTTGGAGGTGG - Intergenic
964844373 3:161029915-161029937 AGGCTGTAGGGTGGTGGTGGTGG - Intronic
965115100 3:164478220-164478242 AGCCTGCAGTGTGATGGGGGTGG - Intergenic
966939269 3:184735173-184735195 AACCAGCTGGCGGATGGTGGTGG - Intergenic
967158859 3:186717944-186717966 TGGGTGGTGGGTGATGGTGGTGG - Intronic
967158880 3:186718004-186718026 TGGGTGGTGGGTGATGGTGGTGG - Intronic
967158893 3:186718047-186718069 TGGGTGGTGGGTGATGGTGGTGG - Intronic
967158957 3:186718229-186718251 TGGGTGGTGGGTGATGGTGGTGG - Intronic
967234144 3:187367950-187367972 AGCCTGCTGGGAGATGTGGAGGG - Intergenic
968442872 4:633446-633468 AGCCTGCTGGGGGCTGGCCGAGG - Intronic
968643245 4:1725610-1725632 AGGCTGCTGGGTGATCCTGGAGG - Intronic
968649099 4:1753394-1753416 TGCCTGCTGGGGGCTGGGGGTGG + Intergenic
969339760 4:6532769-6532791 GGCCATGTGGGTGATGGTGGTGG - Intronic
969879120 4:10158267-10158289 GGCCTGGTGGGTGGGGGTGGGGG - Intergenic
973829230 4:54741851-54741873 AGATTTCTGGGTGGTGGTGGTGG + Intergenic
975834476 4:78407750-78407772 GTCCTGCTGGGTGAAGGTGCTGG - Exonic
979652527 4:123152118-123152140 GGCCTGTTGGGGGATGGGGGTGG + Intronic
980071975 4:128253216-128253238 ATATTGTTGGGTGATGGTGGTGG - Intergenic
981044146 4:140251087-140251109 TTGCTGCTGGCTGATGGTGGAGG + Intergenic
981687701 4:147473221-147473243 TTCCTCTTGGGTGATGGTGGTGG - Intergenic
981894929 4:149787166-149787188 GGCCTGTTGGGGGATGGGGGTGG + Intergenic
982090204 4:151873812-151873834 AGCTTCCTGGGTGTTGCTGGTGG - Intergenic
983584672 4:169342203-169342225 ATCCTTTTGGGTGATGGGGGTGG + Intergenic
984825123 4:183917245-183917267 AGCCACCAGGGTGATTGTGGTGG + Intronic
985451999 4:190067657-190067679 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985452984 4:190070954-190070976 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985453973 4:190074247-190074269 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985454961 4:190077540-190077562 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985455950 4:190080840-190080862 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985456933 4:190084134-190084156 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985457920 4:190087427-190087449 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985458909 4:190090727-190090749 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985463161 4:190173492-190173514 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985663920 5:1172090-1172112 AGGCTGCTGGGGGATGGGGTGGG - Intergenic
985996670 5:3600756-3600778 AGCTGGCTGGGTGGCGGTGGGGG + Intronic
986301616 5:6482364-6482386 AGCTTGCTGGGGGGTGGAGGTGG - Intronic
986548231 5:8923574-8923596 ACCCTGCTGAGGGATGGAGGAGG - Intergenic
986895572 5:12362444-12362466 AGGCTGCTGAGTGGTGGTGGTGG + Intergenic
987291405 5:16511899-16511921 GGCCTGCTGGGAGGTGATGGGGG - Intronic
987311865 5:16688790-16688812 AGTCTGCAGGGTTATGCTGGAGG - Intronic
987738365 5:21873785-21873807 GGCCTGTTGGGGGAGGGTGGGGG - Intronic
988121166 5:26964784-26964806 GGCCTGTTGGGGGGTGGTGGGGG - Intronic
988155889 5:27448401-27448423 AGCCCTCTGGGTGATTATGGAGG + Intergenic
988548314 5:32177530-32177552 AACCTGCAGGGTCCTGGTGGGGG - Intergenic
988628798 5:32906797-32906819 AGCCTAATGGGGAATGGTGGTGG + Intergenic
989195560 5:38713170-38713192 CTCCTGTTGGGTGATGGTGCTGG + Intergenic
989961972 5:50427048-50427070 TGACTGGTGAGTGATGGTGGTGG - Intronic
990059751 5:51632921-51632943 AGCCTGCGGTGTGATGTTTGGGG - Intergenic
990248797 5:53891729-53891751 AGCCTGCGAGGTGGTTGTGGTGG + Intronic
990772746 5:59268188-59268210 AGCATCCTGGGTGATGGCTGAGG - Intronic
992188654 5:74268404-74268426 ACCCTAGTGTGTGATGGTGGGGG + Intergenic
993725006 5:91356837-91356859 ATCCTTCTTGGTGATGGTGATGG - Intergenic
995049566 5:107687484-107687506 CCACTGCTGGGTGATGGTGGAGG - Intergenic
995939751 5:117567439-117567461 GGCCTGTTGGGTGATGGAGTTGG + Intergenic
997361832 5:133300127-133300149 AGCCTCAAGGGTGTTGGTGGAGG + Intronic
997517342 5:134499911-134499933 GGCCTGTCGGGGGATGGTGGAGG - Intergenic
998449371 5:142222556-142222578 AGCCTTCTGGCTGATGGAGCTGG + Intergenic
999262955 5:150248871-150248893 AGCCTGCTTGTTGATGGAGGAGG - Intronic
999778720 5:154831649-154831671 AGCATGAAGGGTGCTGGTGGAGG - Intronic
1001263846 5:170257352-170257374 ATCCTGCTAGGAGTTGGTGGGGG + Intronic
1001579803 5:172790841-172790863 ATCCTGCTAGGTGTTGGTGCTGG - Intergenic
1001845236 5:174916384-174916406 CCCCTGCTGGGGGATGGGGGAGG - Intergenic
1001859603 5:175042245-175042267 AGCCTGCTGGGTGTATGTGCGGG - Intergenic
1002456440 5:179347825-179347847 ACCCTGGTGGGTGACAGTGGGGG - Intergenic
1002864269 6:1107439-1107461 AGGCTGCTGGGGGATGGGGATGG + Intergenic
1003081323 6:3024005-3024027 AGCCTGCTGAGCGAGGGTGGAGG - Intergenic
1003625270 6:7735684-7735706 ATTCTGCTGGGTGATAATGGAGG - Intronic
1003790523 6:9541754-9541776 ATCCCCCTGGGTCATGGTGGCGG + Intergenic
1003946872 6:11084114-11084136 AGAATGCTGTGTGATGGTGGAGG + Intergenic
1004649769 6:17598255-17598277 AGCCTTGTGGGTGGGGGTGGGGG - Intergenic
1006523773 6:34587386-34587408 AGCCAGCTGGATGTTTGTGGTGG - Exonic
1006943093 6:37765848-37765870 TGCTTCCTGGGGGATGGTGGAGG + Intergenic
1008675359 6:53812803-53812825 AGTCTGCTAGGTGAGGGAGGTGG + Intronic
1008974376 6:57407777-57407799 GGCTTGCTGGATGATGATGGTGG + Intronic
1009163266 6:60309296-60309318 GGCTTGCTGGGTGATGATGGTGG + Intergenic
1011241612 6:85277468-85277490 AGCATGGTGGGTGGAGGTGGGGG - Intergenic
1011503303 6:88014053-88014075 AGACTTCTTGGTGGTGGTGGTGG - Intergenic
1011751618 6:90460276-90460298 GGACTGCGGGGTGAGGGTGGGGG + Intergenic
1011775394 6:90724880-90724902 ATCCTGGCAGGTGATGGTGGTGG + Intergenic
1012371143 6:98508785-98508807 ATCATGCTGGGTTTTGGTGGAGG - Intergenic
1014848935 6:126315973-126315995 AGTCAGCTGGGTGATGGAGGGGG + Intergenic
1015900703 6:138062757-138062779 AGACAGCTGTGTGATGGAGGAGG - Intergenic
1016713976 6:147203652-147203674 GGCCTGCTGGGCCAGGGTGGGGG + Intergenic
1016839472 6:148511880-148511902 AGTTTGCTGGTTGGTGGTGGTGG - Intronic
1018077869 6:160232396-160232418 AGCTTGCTGAGAGATAGTGGGGG - Intronic
1018375024 6:163202140-163202162 CGGCTGCTGGGAGAAGGTGGGGG + Intronic
1019517070 7:1444822-1444844 GGCCTGCTGGGTCCTGGAGGCGG + Exonic
1019792080 7:3021561-3021583 GGCCTGCTGGGTGGTGGGGTTGG + Intronic
1020624181 7:10557844-10557866 TGCCTGCTGGGTGATGGGGAAGG - Intergenic
1022926286 7:35058725-35058747 AGCATGCTGGGTGACTGTGCGGG - Intergenic
1022980301 7:35599115-35599137 AGCCTGTTAGGTGATTTTGGGGG - Intergenic
1023039601 7:36160659-36160681 TGACTGCTGGGAGGTGGTGGGGG + Intronic
1023991459 7:45131213-45131235 AGGTCGATGGGTGATGGTGGAGG + Intergenic
1024193956 7:47040629-47040651 TTCCTGGTGGGTGGTGGTGGGGG - Intergenic
1024208239 7:47182024-47182046 AAGCTGCTGGGGCATGGTGGGGG - Intergenic
1024623946 7:51188347-51188369 GGCCTGCTGGGTACTGCTGGAGG - Intronic
1024896326 7:54266013-54266035 AGACTGCTGTGTGGGGGTGGTGG - Intergenic
1024934362 7:54698021-54698043 AGCCTCCTGGGAGATGGGGAGGG + Intergenic
1025020223 7:55474734-55474756 AGCCTCCTGTGGGAAGGTGGTGG + Intronic
1025152663 7:56572220-56572242 AGGCTGGAGGGTGGTGGTGGGGG - Intergenic
1025790490 7:64683102-64683124 AGCTTGCTGAGAGGTGGTGGAGG - Intronic
1026283926 7:68946479-68946501 GGCCTGTTGGGGGATGGTAGGGG + Intergenic
1026889755 7:73974999-73975021 GGCCTGCTGGGGGTTGGAGGTGG - Intergenic
1027228212 7:76258141-76258163 AGCCTGGTGGCAGAGGGTGGGGG - Intronic
1027265995 7:76495583-76495605 GGCCTCCTGGGGGCTGGTGGTGG + Intronic
1027317369 7:76993700-76993722 GGCCTCCTGGGGGCTGGTGGTGG + Intergenic
1028420327 7:90625701-90625723 AGCATGCTGGGGGATGGGTGAGG - Intronic
1028988133 7:97023766-97023788 AGCACGCTGGGTGGGGGTGGGGG - Intronic
1029126130 7:98296215-98296237 GCCATGCTGGGTGATCGTGGGGG + Intronic
1029401536 7:100350032-100350054 ACCCTGCTGGGGGATGGTAGTGG + Intronic
1029653348 7:101908733-101908755 GGCCTGGTGGGGGATGCTGGTGG + Intronic
1030115876 7:106062013-106062035 AGGCTGCTGAGTGATTGTGGAGG - Intergenic
1030398261 7:109015880-109015902 AGCCTGCTGGGGGAGGATGGTGG - Intergenic
1031369394 7:120946545-120946567 TGGCTGCTGGGTGTTGGTGGTGG - Intergenic
1031646140 7:124228488-124228510 AGGCTGGTGGGGGGTGGTGGGGG + Intergenic
1032540591 7:132699764-132699786 AGGCTGATGGGAGAGGGTGGTGG + Intronic
1032845806 7:135750489-135750511 AGCCTGCGAGGTGAAGGTTGTGG + Intergenic
1033670285 7:143485937-143485959 AGCCTGCTGGGTGGCTATGGTGG - Intergenic
1036509293 8:9385763-9385785 ATCCTGTTGGGTGTGGGTGGAGG + Intergenic
1036514283 8:9429419-9429441 AACCTTCTGGGTGAAGGGGGTGG + Intergenic
1036592497 8:10181702-10181724 AACTTGCTGGGTCATGATGGAGG + Intronic
1037565938 8:20118569-20118591 AGCCTGATCGGTGATTGTGTTGG + Intergenic
1037623072 8:20584060-20584082 AGTCACCTGGGAGATGGTGGAGG + Intergenic
1037986172 8:23291940-23291962 AGCCTGCTGGGGCAGAGTGGAGG + Intronic
1038401633 8:27288459-27288481 AGAATGCTGTGTGATGGCGGAGG + Intronic
1038418454 8:27415243-27415265 ATCCAGCTGGGTGGTGGTGGTGG + Intronic
1038467004 8:27773452-27773474 AGCCTGCTGGTGGAGGGCGGTGG + Intronic
1038515861 8:28187238-28187260 ATCCAGGTGGGAGATGGTGGTGG - Intronic
1038589287 8:28821578-28821600 AACCCACTGGGTGGTGGTGGTGG - Intronic
1038718035 8:30009362-30009384 AGGCTGTGGGGTGGTGGTGGTGG - Intergenic
1038740510 8:30212749-30212771 AGGCTGGAGTGTGATGGTGGAGG - Intergenic
1039243396 8:35581457-35581479 CTGCTGCAGGGTGATGGTGGAGG + Intronic
1040102336 8:43516713-43516735 ACCATGGTGGGTGAGGGTGGAGG + Intergenic
1040830526 8:51671676-51671698 AGCCTGCTGGGAGCTGGTCTGGG - Intronic
1041768416 8:61445338-61445360 AGCCTAGTGGGTCATGGGGGTGG + Intronic
1041960726 8:63612347-63612369 AACATTCTTGGTGATGGTGGTGG + Intergenic
1042713724 8:71748069-71748091 AGCCTGGTTGGTGATTGGGGAGG - Intergenic
1042726933 8:71888918-71888940 AGTGGGCTGGGTGATGGTGGGGG - Intronic
1042851292 8:73218692-73218714 AGCCTATTGGGGGAGGGTGGGGG - Intergenic
1043020194 8:74990695-74990717 AGACTGGCGGGTGAGGGTGGAGG - Intronic
1043052807 8:75404358-75404380 GGCCAGCAGGGTGAGGGTGGGGG - Intergenic
1043950006 8:86298543-86298565 CGCCTTCTGGGTGATGATGGAGG - Intronic
1044620504 8:94186819-94186841 AGGCTGCAGGGTGCTGCTGGAGG - Intronic
1044791576 8:95852793-95852815 ATGCTGCTGGGTGAGGGTGAGGG - Intergenic
1046572309 8:115981621-115981643 GGCCTGTCGGGTGATGGGGGTGG + Intergenic
1047295451 8:123566806-123566828 AGCCTCCTGGAGGGTGGTGGGGG + Intergenic
1047960348 8:130007223-130007245 ACCCTGCTGGGAGAGGGCGGTGG - Intronic
1048310428 8:133318359-133318381 AGCCTTATGGGTGGTGGTGGTGG - Intergenic
1048872400 8:138810447-138810469 AGCCTGCCGGGGGTGGGTGGAGG + Intronic
1049002890 8:139837500-139837522 AGCCTTCAGGGGGCTGGTGGGGG - Intronic
1049304348 8:141892481-141892503 GGGTTGCTGGGTGTTGGTGGTGG + Intergenic
1049331127 8:142053918-142053940 ATCCTGCTGGTTGATGATGTTGG + Intergenic
1049501565 8:142970434-142970456 AGCAGGCTGGGTGATAGGGGTGG - Intergenic
1049600057 8:143503564-143503586 AGCCGGCTGGGTGCTGGGGGAGG - Intronic
1049600069 8:143503596-143503618 AGCCGGCTGGGTGCTGGGGGAGG - Intronic
1049600097 8:143503692-143503714 AGCCGGCTGGGTGCTGGGGGAGG - Intronic
1049600131 8:143503790-143503812 AGCCAGCTGGGTGCTGGAGGAGG - Intronic
1049689224 8:143951479-143951501 AGCCTGGTGTGTGGAGGTGGGGG - Intronic
1050626048 9:7504552-7504574 AGGCTGTTGGGTGATCGTTGGGG + Intergenic
1051946684 9:22577758-22577780 AGCCTGTTGGGGGATGGTGTTGG + Intergenic
1053721464 9:40951117-40951139 GCCCAGCTGGGGGATGGTGGGGG + Intergenic
1054344532 9:63901051-63901073 GCCCAGCTGGGGGATGGTGGGGG - Intergenic
1055822505 9:80284132-80284154 AGCCTGCTGGGTCAAGGTGCTGG + Intergenic
1055979052 9:81983643-81983665 AGACTTCTGGGTGACGGTGTAGG + Intergenic
1056858625 9:90158779-90158801 CGCCTGCTAGGGGATGGAGGTGG - Intergenic
1057189713 9:93079880-93079902 GCCCTGCTGGGTGTAGGTGGAGG - Intronic
1057293603 9:93822664-93822686 AGCCAGCTGGGAAATGTTGGGGG - Intergenic
1057376715 9:94531031-94531053 GGCCTGTTGGGTGATGGAGTAGG + Intergenic
1057514770 9:95711882-95711904 AGCCTGGTGGGTGGAGGTTGTGG - Intergenic
1059350305 9:113659556-113659578 CATCTGCTGGGGGATGGTGGTGG + Intergenic
1059900740 9:118922162-118922184 ATGCTGCTGGGGGATGGGGGTGG + Intergenic
1060222839 9:121773588-121773610 TGGCAGCTGGGTGAGGGTGGAGG - Intronic
1060503531 9:124180965-124180987 GGGCTGCTGGGTGGTGATGGGGG + Intergenic
1060567451 9:124605887-124605909 AGCCAGATGGGAGATAGTGGTGG - Intronic
1060917939 9:127402537-127402559 AGCCTGCGGGGGGTGGGTGGAGG - Exonic
1061074009 9:128329792-128329814 AGCCTGCTGTGTGAAGCTGAAGG - Intronic
1061231396 9:129317950-129317972 AGTCTCCTGGGGGCTGGTGGAGG - Intergenic
1061298769 9:129692342-129692364 ACTCTGGTGGGGGATGGTGGGGG - Intronic
1061829844 9:133284721-133284743 TGACTGGTGAGTGATGGTGGTGG + Intergenic
1061866989 9:133497331-133497353 AGCCGGCTGGGGGCTGGGGGTGG + Intergenic
1061902834 9:133681576-133681598 AGCCTGCTGGGTGCTGGATTGGG - Intronic
1061985350 9:134127277-134127299 AGCATGCTGGGTGGGGGTGGGGG + Intergenic
1062170018 9:135129528-135129550 AGCCTCCGTGGGGATGGTGGTGG + Intergenic
1203770870 EBV:49502-49524 AGCCTGCTGGACGGGGGTGGCGG - Intergenic
1203453726 Un_GL000219v1:145029-145051 GCCCAGCTGGGAGATGGTGGGGG - Intergenic
1203466329 Un_GL000220v1:91745-91767 AGCCCATTGGGTGATGATGGGGG + Intergenic
1185928352 X:4172222-4172244 AAACTCCTGGGTCATGGTGGTGG + Intergenic
1187278534 X:17837728-17837750 AGCCTGCTGGGTTAAGTTGGGGG + Exonic
1187340890 X:18420518-18420540 AGCCTGACAGGTGATGATGGTGG + Intergenic
1187390274 X:18882196-18882218 AGCCTCCTGGGTCATGGTCATGG - Intergenic
1189013602 X:37072185-37072207 GGGCTGCTGGGTGATGGGTGAGG - Intergenic
1189312081 X:40026249-40026271 GGCCTGCTGGGTGGTGGAGCTGG + Intergenic
1190444062 X:50505423-50505445 AGCCTGGTGGTTGAGAGTGGAGG + Intergenic
1190537117 X:51440528-51440550 CTCCTGCTGGGGGATGGGGGAGG - Intergenic
1191033988 X:56005832-56005854 AGGCTGGTGTGTGGTGGTGGAGG + Intergenic
1191108942 X:56789941-56789963 AGCCTGGAGTGTGTTGGTGGGGG + Intergenic
1191788918 X:64947346-64947368 ATTCTGCTGGTTGATGGTGATGG + Intronic
1191863283 X:65683427-65683449 AGCCTGGGTGGTGGTGGTGGTGG - Intronic
1191863284 X:65683430-65683452 AGCAGCCTGGGTGGTGGTGGTGG - Intronic
1192152419 X:68720441-68720463 AGCCTGCCGGGAGATGGTGCAGG + Intronic
1193370159 X:80686256-80686278 AGCCTGTTGGGGGTTGGGGGAGG + Intronic
1195294909 X:103466425-103466447 AGCGTGAGGGGTGGTGGTGGTGG + Intergenic
1195989193 X:110665872-110665894 GGCATGCAGGGTGGTGGTGGGGG + Intergenic
1197516093 X:127431434-127431456 GGCCTGTTGGGAGGTGGTGGGGG - Intergenic
1198600927 X:138283267-138283289 AGGCGGCTGGGAGGTGGTGGAGG + Intergenic
1199710790 X:150467711-150467733 AGGCAGCTGAGTGGTGGTGGAGG + Intronic
1200058930 X:153475384-153475406 AGCCTGCTGCGGGGTGGGGGTGG - Intronic
1200085233 X:153600946-153600968 AGCAAGCTGGGTGATGGAAGTGG - Intergenic
1200146808 X:153930571-153930593 AGCCTGGAGGGTGATGGGAGAGG - Intronic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic