ID: 1083747816

View in Genome Browser
Species Human (GRCh38)
Location 11:64745129-64745151
Sequence GGCGTCCGCGGTTGGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 216}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083747816_1083747839 14 Left 1083747816 11:64745129-64745151 CCCCTCCCCCAACCGCGGACGCC 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1083747839 11:64745166-64745188 CCTGCCTGGGTGTCGGGCGGAGG 0: 1
1: 0
2: 0
3: 27
4: 376
1083747816_1083747827 0 Left 1083747816 11:64745129-64745151 CCCCTCCCCCAACCGCGGACGCC 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1083747827 11:64745152-64745174 CCAGTGCCCCCCGCCCTGCCTGG 0: 1
1: 0
2: 6
3: 89
4: 1011
1083747816_1083747836 11 Left 1083747816 11:64745129-64745151 CCCCTCCCCCAACCGCGGACGCC 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1083747836 11:64745163-64745185 CGCCCTGCCTGGGTGTCGGGCGG 0: 1
1: 0
2: 0
3: 24
4: 200
1083747816_1083747831 7 Left 1083747816 11:64745129-64745151 CCCCTCCCCCAACCGCGGACGCC 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1083747831 11:64745159-64745181 CCCCCGCCCTGCCTGGGTGTCGG 0: 1
1: 1
2: 0
3: 27
4: 367
1083747816_1083747841 21 Left 1083747816 11:64745129-64745151 CCCCTCCCCCAACCGCGGACGCC 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1083747841 11:64745173-64745195 GGGTGTCGGGCGGAGGAAGCCGG 0: 1
1: 0
2: 1
3: 26
4: 307
1083747816_1083747833 8 Left 1083747816 11:64745129-64745151 CCCCTCCCCCAACCGCGGACGCC 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1083747833 11:64745160-64745182 CCCCGCCCTGCCTGGGTGTCGGG 0: 1
1: 1
2: 6
3: 40
4: 343
1083747816_1083747843 25 Left 1083747816 11:64745129-64745151 CCCCTCCCCCAACCGCGGACGCC 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1083747843 11:64745177-64745199 GTCGGGCGGAGGAAGCCGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 364
1083747816_1083747842 22 Left 1083747816 11:64745129-64745151 CCCCTCCCCCAACCGCGGACGCC 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1083747842 11:64745174-64745196 GGTGTCGGGCGGAGGAAGCCGGG 0: 1
1: 0
2: 0
3: 13
4: 194
1083747816_1083747845 27 Left 1083747816 11:64745129-64745151 CCCCTCCCCCAACCGCGGACGCC 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1083747845 11:64745179-64745201 CGGGCGGAGGAAGCCGGGAGGGG 0: 1
1: 0
2: 1
3: 32
4: 418
1083747816_1083747828 1 Left 1083747816 11:64745129-64745151 CCCCTCCCCCAACCGCGGACGCC 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1083747828 11:64745153-64745175 CAGTGCCCCCCGCCCTGCCTGGG 0: 1
1: 0
2: 2
3: 43
4: 372
1083747816_1083747844 26 Left 1083747816 11:64745129-64745151 CCCCTCCCCCAACCGCGGACGCC 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1083747844 11:64745178-64745200 TCGGGCGGAGGAAGCCGGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083747816 Original CRISPR GGCGTCCGCGGTTGGGGGAG GGG (reversed) Intronic