ID: 1083748038

View in Genome Browser
Species Human (GRCh38)
Location 11:64745877-64745899
Sequence CCTAGTCTAGGCCCTCATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083748038_1083748045 20 Left 1083748038 11:64745877-64745899 CCATAATGAGGGCCTAGACTAGG No data
Right 1083748045 11:64745920-64745942 CCGTAACACTCCCCCGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083748038 Original CRISPR CCTAGTCTAGGCCCTCATTA TGG (reversed) Intergenic
No off target data available for this crispr