ID: 1083748045

View in Genome Browser
Species Human (GRCh38)
Location 11:64745920-64745942
Sequence CCGTAACACTCCCCCGACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083748038_1083748045 20 Left 1083748038 11:64745877-64745899 CCATAATGAGGGCCTAGACTAGG No data
Right 1083748045 11:64745920-64745942 CCGTAACACTCCCCCGACTTTGG No data
1083748036_1083748045 22 Left 1083748036 11:64745875-64745897 CCCCATAATGAGGGCCTAGACTA No data
Right 1083748045 11:64745920-64745942 CCGTAACACTCCCCCGACTTTGG No data
1083748041_1083748045 8 Left 1083748041 11:64745889-64745911 CCTAGACTAGGCGGTCTGCGAGT No data
Right 1083748045 11:64745920-64745942 CCGTAACACTCCCCCGACTTTGG No data
1083748037_1083748045 21 Left 1083748037 11:64745876-64745898 CCCATAATGAGGGCCTAGACTAG No data
Right 1083748045 11:64745920-64745942 CCGTAACACTCCCCCGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083748045 Original CRISPR CCGTAACACTCCCCCGACTT TGG Intergenic
No off target data available for this crispr