ID: 1083748154

View in Genome Browser
Species Human (GRCh38)
Location 11:64746277-64746299
Sequence GTCCCACGGCGGGACGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083748154_1083748166 5 Left 1083748154 11:64746277-64746299 CCATCACCGTCCCGCCGTGGGAC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1083748166 11:64746305-64746327 TGCCGAGGGTGGAGGATAAGGGG 0: 1
1: 0
2: 0
3: 42
4: 423
1083748154_1083748161 -6 Left 1083748154 11:64746277-64746299 CCATCACCGTCCCGCCGTGGGAC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1083748161 11:64746294-64746316 TGGGACGCACCTGCCGAGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 105
1083748154_1083748165 4 Left 1083748154 11:64746277-64746299 CCATCACCGTCCCGCCGTGGGAC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1083748165 11:64746304-64746326 CTGCCGAGGGTGGAGGATAAGGG 0: 1
1: 0
2: 0
3: 23
4: 833
1083748154_1083748158 -10 Left 1083748154 11:64746277-64746299 CCATCACCGTCCCGCCGTGGGAC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1083748158 11:64746290-64746312 GCCGTGGGACGCACCTGCCGAGG 0: 1
1: 0
2: 5
3: 14
4: 92
1083748154_1083748160 -9 Left 1083748154 11:64746277-64746299 CCATCACCGTCCCGCCGTGGGAC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1083748160 11:64746291-64746313 CCGTGGGACGCACCTGCCGAGGG 0: 1
1: 0
2: 0
3: 8
4: 56
1083748154_1083748169 17 Left 1083748154 11:64746277-64746299 CCATCACCGTCCCGCCGTGGGAC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1083748169 11:64746317-64746339 AGGATAAGGGGGTGACTGCGCGG 0: 1
1: 0
2: 0
3: 12
4: 148
1083748154_1083748167 6 Left 1083748154 11:64746277-64746299 CCATCACCGTCCCGCCGTGGGAC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1083748167 11:64746306-64746328 GCCGAGGGTGGAGGATAAGGGGG 0: 1
1: 0
2: 2
3: 107
4: 3269
1083748154_1083748162 -3 Left 1083748154 11:64746277-64746299 CCATCACCGTCCCGCCGTGGGAC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1083748162 11:64746297-64746319 GACGCACCTGCCGAGGGTGGAGG 0: 1
1: 0
2: 1
3: 10
4: 127
1083748154_1083748164 3 Left 1083748154 11:64746277-64746299 CCATCACCGTCCCGCCGTGGGAC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1083748164 11:64746303-64746325 CCTGCCGAGGGTGGAGGATAAGG 0: 1
1: 0
2: 1
3: 15
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083748154 Original CRISPR GTCCCACGGCGGGACGGTGA TGG (reversed) Intergenic
900358844 1:2278318-2278340 GTCTCACAGCAGGACAGTGAAGG - Intronic
915427758 1:155841639-155841661 GTCCCTTGGTGGGACGCTGATGG - Intronic
924464320 1:244286235-244286257 GTTACACGGAGGGACGGTGATGG + Intergenic
1067480980 10:46597501-46597523 GTCCCACAGCTAGAAGGTGATGG + Intergenic
1067613772 10:47744321-47744343 GTCCCACAGCTAGAAGGTGATGG - Intergenic
1067711231 10:48652830-48652852 GTCCCACAGAGGGACAGTCAAGG + Intronic
1069750843 10:70744137-70744159 CTCCCACTGCAGGACTGTGAAGG + Exonic
1076760550 10:132603950-132603972 GGCGCAGGGCGGGACGGAGAGGG - Intronic
1076760561 10:132603982-132604004 GGCACAGGGCGGGACGGAGAGGG - Intronic
1077177363 11:1196887-1196909 GCCCCACGGAGAGCCGGTGAAGG + Intronic
1083748154 11:64746277-64746299 GTCCCACGGCGGGACGGTGATGG - Intergenic
1091301916 11:134513395-134513417 GCTCCAGGGCAGGACGGTGAGGG + Intergenic
1100605593 12:96149680-96149702 GTCCCACGGCGGGGTGGTGGGGG - Intergenic
1100678647 12:96894714-96894736 TTCCCATGGCAGGAGGGTGATGG - Intergenic
1108705665 13:52983420-52983442 GTGCCACGGGGGGGCGGGGAGGG - Intergenic
1113542874 13:111122555-111122577 GTCTCAAGGCGAGGCGGTGAGGG + Intronic
1123450551 15:20357061-20357083 GTCCCACGGGAGGCCCGTGATGG + Intergenic
1124619743 15:31266896-31266918 GTCCCACGACTGGAGGGGGAGGG - Intergenic
1129220616 15:74129730-74129752 GTGAGACGGCGGGGCGGTGAGGG + Exonic
1129761551 15:78131664-78131686 GTCGCACGGCGTGAGGGTGCGGG + Intronic
1130178997 15:81606441-81606463 TTCCCATGGCGGGTGGGTGAGGG - Intergenic
1131471744 15:92703798-92703820 GACCCACAGCGGGAGAGTGATGG - Intronic
1132602943 16:782009-782031 GTCCCAGGGCAGGAAGGTGCTGG + Exonic
1136110115 16:28059387-28059409 GTCCCAGGGCTGGGTGGTGACGG - Intronic
1136588371 16:31202234-31202256 GCCCCACGGCGGGAAGGGAAGGG - Intronic
1137559395 16:49493101-49493123 GTGCCACGGCTGGAGGGTGCGGG - Intronic
1142222640 16:88863197-88863219 GTCCCACGGGGAGACGCGGAGGG + Intergenic
1142222652 16:88863233-88863255 GTCCCACGGGGAGACGCGGAGGG + Intergenic
1142495951 17:306377-306399 GTCACACGGCGGGCCAGTGCTGG - Intronic
1148183174 17:45620887-45620909 GCCCCACTGCGGGGAGGTGAGGG + Intergenic
1148265676 17:46224804-46224826 GCCCCACTGCGGGGAGGTGAGGG - Intronic
1152510067 17:80780763-80780785 GCCCCCCGGGGGGAGGGTGAGGG - Intronic
1152576120 17:81141747-81141769 GTCCCAAGGTGGGGTGGTGAGGG + Intronic
1157493782 18:48141161-48141183 GTCCCACAGCAGGAAGGAGAAGG - Intronic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1168629816 19:57947810-57947832 GGCGCACGGCGGGAGAGTGAGGG + Intergenic
925912507 2:8582940-8582962 GTCCCACAGAGGGAAGGTGGTGG - Intergenic
928199698 2:29239754-29239776 GTCCCACGGCGTGTCTGTGCTGG - Exonic
928447791 2:31348297-31348319 GACCCACGGGGGGACTGAGATGG - Exonic
928998714 2:37324803-37324825 GCCCCAGGACGGGACGGGGAGGG - Intronic
938571611 2:132566877-132566899 GTCCCACAGCAGGACGCTGAAGG - Intronic
1172219516 20:33263906-33263928 GTACCATGGCGGGGCGGTGGGGG - Intergenic
1181163916 22:20973557-20973579 GTCCCAAGGTGGGAGGGTGAGGG + Intronic
1183742993 22:39678670-39678692 AGCCCAGGGCGGGAAGGTGATGG + Intronic
950364379 3:12472674-12472696 GTCCCACGGTGTCATGGTGAGGG - Intergenic
953447247 3:42979107-42979129 GCACCAAGGCTGGACGGTGAGGG - Intronic
961652959 3:128426455-128426477 GTCCCGCGGCGGGCCGAGGAGGG - Intergenic
985574938 5:669648-669670 GTCACTCGGCGGGAGGGGGATGG + Intronic
985639681 5:1057861-1057883 GGGCCAGGGCGGGAAGGTGAGGG - Intronic
997416165 5:133730469-133730491 GTCCCACAGCTGCACGATGATGG + Intergenic
997530858 5:134580334-134580356 GGCCCAGGGCGGGCCGGTGTTGG + Exonic
1004994504 6:21175987-21176009 GTCCCACAGCTGGTAGGTGACGG - Intronic
1009622441 6:66094805-66094827 GTCCCGCGGCGGGGCAGTGTCGG + Intergenic
1039484462 8:37899796-37899818 GTCGCACGGCGGGAAGGAGCTGG + Intergenic
1042137263 8:65644493-65644515 TTCCCAGGACAGGACGGTGAAGG + Intergenic
1049554642 8:143275827-143275849 GTGGCACGGAGGGACGGGGACGG - Intronic
1049732531 8:144185843-144185865 GAACCACGGGGGGGCGGTGAGGG + Intronic
1059247554 9:112861681-112861703 GGCCCACAGCGGCACGGAGAGGG - Intronic
1060939491 9:127535417-127535439 GTCCCACCGAGGGACAGTTAAGG + Intronic
1061449613 9:130661090-130661112 GCCCCACGGAGGGACATTGAAGG - Intergenic
1185535518 X:858493-858515 GTCCCAAGGTGGGGAGGTGAAGG - Intergenic
1192260519 X:69503895-69503917 GTCCTCGGGCAGGACGGTGAGGG + Intergenic
1193257471 X:79367076-79367098 GTCCCAGGGCGGGATGGGGGAGG - Intronic