ID: 1083750373

View in Genome Browser
Species Human (GRCh38)
Location 11:64757788-64757810
Sequence CACCCACTTGGCACCCTGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 5, 3: 13, 4: 286}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083750365_1083750373 4 Left 1083750365 11:64757761-64757783 CCCCAGCTTCATCCTCACCTGTG 0: 1
1: 2
2: 5
3: 38
4: 463
Right 1083750373 11:64757788-64757810 CACCCACTTGGCACCCTGGCTGG 0: 1
1: 0
2: 5
3: 13
4: 286
1083750358_1083750373 27 Left 1083750358 11:64757738-64757760 CCCCTTCTCTGGGCTCCCCTGAC 0: 1
1: 0
2: 8
3: 68
4: 533
Right 1083750373 11:64757788-64757810 CACCCACTTGGCACCCTGGCTGG 0: 1
1: 0
2: 5
3: 13
4: 286
1083750362_1083750373 11 Left 1083750362 11:64757754-64757776 CCCTGACCCCCAGCTTCATCCTC 0: 1
1: 0
2: 4
3: 67
4: 670
Right 1083750373 11:64757788-64757810 CACCCACTTGGCACCCTGGCTGG 0: 1
1: 0
2: 5
3: 13
4: 286
1083750359_1083750373 26 Left 1083750359 11:64757739-64757761 CCCTTCTCTGGGCTCCCCTGACC 0: 1
1: 0
2: 2
3: 66
4: 499
Right 1083750373 11:64757788-64757810 CACCCACTTGGCACCCTGGCTGG 0: 1
1: 0
2: 5
3: 13
4: 286
1083750361_1083750373 12 Left 1083750361 11:64757753-64757775 CCCCTGACCCCCAGCTTCATCCT 0: 1
1: 0
2: 6
3: 59
4: 725
Right 1083750373 11:64757788-64757810 CACCCACTTGGCACCCTGGCTGG 0: 1
1: 0
2: 5
3: 13
4: 286
1083750360_1083750373 25 Left 1083750360 11:64757740-64757762 CCTTCTCTGGGCTCCCCTGACCC 0: 1
1: 0
2: 6
3: 67
4: 619
Right 1083750373 11:64757788-64757810 CACCCACTTGGCACCCTGGCTGG 0: 1
1: 0
2: 5
3: 13
4: 286
1083750357_1083750373 30 Left 1083750357 11:64757735-64757757 CCTCCCCTTCTCTGGGCTCCCCT 0: 1
1: 0
2: 8
3: 131
4: 1442
Right 1083750373 11:64757788-64757810 CACCCACTTGGCACCCTGGCTGG 0: 1
1: 0
2: 5
3: 13
4: 286
1083750363_1083750373 10 Left 1083750363 11:64757755-64757777 CCTGACCCCCAGCTTCATCCTCA 0: 1
1: 0
2: 8
3: 60
4: 651
Right 1083750373 11:64757788-64757810 CACCCACTTGGCACCCTGGCTGG 0: 1
1: 0
2: 5
3: 13
4: 286
1083750364_1083750373 5 Left 1083750364 11:64757760-64757782 CCCCCAGCTTCATCCTCACCTGT 0: 1
1: 0
2: 2
3: 68
4: 755
Right 1083750373 11:64757788-64757810 CACCCACTTGGCACCCTGGCTGG 0: 1
1: 0
2: 5
3: 13
4: 286
1083750366_1083750373 3 Left 1083750366 11:64757762-64757784 CCCAGCTTCATCCTCACCTGTGT 0: 1
1: 0
2: 2
3: 30
4: 260
Right 1083750373 11:64757788-64757810 CACCCACTTGGCACCCTGGCTGG 0: 1
1: 0
2: 5
3: 13
4: 286
1083750367_1083750373 2 Left 1083750367 11:64757763-64757785 CCAGCTTCATCCTCACCTGTGTG 0: 1
1: 0
2: 1
3: 32
4: 314
Right 1083750373 11:64757788-64757810 CACCCACTTGGCACCCTGGCTGG 0: 1
1: 0
2: 5
3: 13
4: 286
1083750368_1083750373 -8 Left 1083750368 11:64757773-64757795 CCTCACCTGTGTGTCCACCCACT 0: 1
1: 0
2: 0
3: 28
4: 279
Right 1083750373 11:64757788-64757810 CACCCACTTGGCACCCTGGCTGG 0: 1
1: 0
2: 5
3: 13
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083750373 Original CRISPR CACCCACTTGGCACCCTGGC TGG Exonic
901002296 1:6154826-6154848 CCGCCACTTGGCACCCAGGACGG + Exonic
901163654 1:7199226-7199248 CACCCGCTGGGCATCCTGCCTGG + Intronic
901326865 1:8371870-8371892 CACCCACTTGGCCCCTGGGTCGG - Intronic
902127403 1:14227436-14227458 CACTCACCTGGCTCCTTGGCTGG + Intergenic
903010654 1:20327882-20327904 CACCAACATGGCATCCTGGCAGG - Exonic
903299321 1:22367051-22367073 CTCGCTCTTGTCACCCTGGCTGG + Intergenic
903901656 1:26650659-26650681 CACCCTCTTGTCCCCCAGGCTGG - Intergenic
904357067 1:29947185-29947207 CAGCCATTTGCCACCCTGCCCGG + Intergenic
904815570 1:33194500-33194522 CACACACTCGTCACCCAGGCTGG - Intergenic
905664524 1:39754826-39754848 CTCCCTCTTGTCACCCAGGCTGG - Intronic
906515763 1:46437984-46438006 AAAGCACTTGGCACGCTGGCTGG + Intergenic
907139919 1:52177177-52177199 CTCCCTCTTGTCACCCAGGCTGG + Intronic
907353077 1:53849389-53849411 CACTCACTGGGCACCCAGTCTGG + Intergenic
908111739 1:60904748-60904770 CACCCTCTAGCCAGCCTGGCTGG - Intronic
909011408 1:70339345-70339367 CTCCCTCTTGTCACCCAGGCTGG + Intronic
913531998 1:119740253-119740275 CACCCACCAGGCACCAAGGCAGG + Intronic
914701123 1:150135290-150135312 CTCACACTTGTCACCCAGGCTGG + Intronic
916159047 1:161890583-161890605 CACCTACCTGGCGGCCTGGCTGG - Intronic
917329700 1:173868555-173868577 CACCCCCTTGGCCCCCGGCCGGG + Intronic
918139338 1:181707347-181707369 CTCCCACCTGGCATCCTAGCTGG - Intronic
918598813 1:186327809-186327831 CTCGCTCTTGTCACCCTGGCTGG + Intronic
920538788 1:206761442-206761464 GGCCTCCTTGGCACCCTGGCTGG - Intergenic
921637487 1:217513259-217513281 CTCCCTCTTGTCACCCAGGCTGG - Intronic
921674279 1:217960857-217960879 CTCCCTCTTGTCACCCAGGCTGG - Intergenic
922729134 1:227940930-227940952 CAGCCACCTGCCACCCTGCCCGG + Intronic
923228611 1:231962829-231962851 CACCCACCTGGCTGCCTGGGTGG + Intronic
923265101 1:232306582-232306604 CTCCCACTTGGCAGCCAGGCGGG + Intergenic
923667773 1:236014050-236014072 CACCCACTTGCCACCAAGGAAGG + Intronic
923975288 1:239255820-239255842 CACCCACCCGGAACCCAGGCTGG + Intergenic
1063467478 10:6256526-6256548 CATGCACATGGCAGCCTGGCTGG - Intergenic
1067348813 10:45457147-45457169 CAGCCATGTGCCACCCTGGCCGG - Exonic
1067749372 10:48960017-48960039 CACCAAGCTGGCACCCAGGCAGG - Intronic
1069898527 10:71694125-71694147 CACCCACTTCTCTCTCTGGCAGG + Intronic
1070463823 10:76698161-76698183 CACCCACTGGGCACCCTGGATGG + Intergenic
1072111664 10:92326915-92326937 AACTTACTTGGCACCATGGCTGG - Intronic
1072531657 10:96325020-96325042 CACCCACCTGAAAGCCTGGCAGG + Intronic
1073452635 10:103618780-103618802 CACCCCCTGGGCTCCTTGGCTGG + Intronic
1074656687 10:115597600-115597622 CACACTCTTGTCACCCAGGCTGG + Intronic
1076054192 10:127357886-127357908 CAGGCACCTGGCACCATGGCAGG - Intronic
1076573331 10:131446954-131446976 CAGGCACTTGCCACCCTGCCTGG - Intergenic
1077459905 11:2703849-2703871 CAGCAACTTGGGAACCTGGCTGG - Intronic
1078001740 11:7502201-7502223 AACACACTTGACATCCTGGCAGG + Intronic
1081807017 11:45896378-45896400 CTCCCACCTGGCACCCTGACTGG + Intronic
1083004303 11:59327070-59327092 CACTCTCTTGTCACCCAGGCTGG - Intergenic
1083141125 11:60722702-60722724 CACCCTCATGTCACCCAGGCTGG - Intergenic
1083750373 11:64757788-64757810 CACCCACTTGGCACCCTGGCTGG + Exonic
1083763912 11:64833184-64833206 CACACACCTGGGACCGTGGCTGG + Intronic
1084118627 11:67056363-67056385 CAGCCACCTGACACCGTGGCTGG - Intergenic
1084559536 11:69895164-69895186 CACCAACAGGGCTCCCTGGCTGG - Intergenic
1084601317 11:70147452-70147474 CACGCACTGAGCACCATGGCTGG - Intronic
1084882943 11:72184952-72184974 ATCTCACTTGGCACCCAGGCTGG - Intergenic
1084894364 11:72254677-72254699 TCCCCCCTTGGCACCCTGGCCGG + Intergenic
1087990984 11:104745022-104745044 CTCCCTCTTGTCACCCAGGCTGG + Intergenic
1089658664 11:119971277-119971299 CACACACATGGCACACAGGCAGG + Intergenic
1091754247 12:3041309-3041331 CACCTAACAGGCACCCTGGCTGG - Intergenic
1092100896 12:5883006-5883028 GGCTCACTTGGAACCCTGGCAGG - Intronic
1092878221 12:12867165-12867187 CTCCCTCTTGTCACCCAGGCTGG + Intergenic
1094569266 12:31627490-31627512 CTCCCTCTTGTCACCCAGGCTGG - Intergenic
1095241069 12:39859550-39859572 CTCCCTCTTGTCACCCAGGCTGG + Intronic
1095497300 12:42798388-42798410 CTCGCTCTTGTCACCCTGGCTGG + Intergenic
1096149331 12:49298611-49298633 CACCCACTTCTCATCGTGGCTGG - Exonic
1096266886 12:50130584-50130606 CACCCGATTGGCACCATTGCTGG + Exonic
1096395545 12:51263351-51263373 TTCCCACTTGTCACCCAGGCTGG - Intronic
1097711578 12:62923429-62923451 CTCCCTCTTGGCCCCCAGGCTGG + Intronic
1100349338 12:93764048-93764070 CATCATCTTGGGACCCTGGCTGG - Intronic
1101581566 12:106046733-106046755 CACCCACCTGGGACTCTGCCTGG - Intergenic
1102416517 12:112767401-112767423 CATCCACTTGCTTCCCTGGCGGG - Intronic
1103146175 12:118597491-118597513 CACCCACCTGGAACTCTAGCTGG + Intergenic
1103350743 12:120281851-120281873 CTCCCTCTTGTCACCCAGGCTGG - Intergenic
1103961087 12:124609724-124609746 CACCCACGTGGCTTCCTGGCAGG + Intergenic
1104292063 12:127479349-127479371 CAGCCTCTTGGCTCCCTGGGGGG + Intergenic
1104430255 12:128710455-128710477 CACCCAATCTGCACCCAGGCTGG - Intergenic
1104842091 12:131830209-131830231 CACCCACCTGCCCCCCTGCCCGG + Intronic
1105792885 13:23819977-23819999 CTCCCTCTTGTCACCCAGGCTGG - Intronic
1106639907 13:31573110-31573132 CACATACCTGGCACCTTGGCGGG - Intergenic
1107127006 13:36856829-36856851 TACCCTCTTGTCACCCAGGCTGG + Intronic
1108802828 13:54120498-54120520 CTCCCTCTTGTCACCCAGGCTGG - Intergenic
1110133108 13:72031268-72031290 CACCCTGTTGCCACCCAGGCTGG - Intergenic
1110664797 13:78104175-78104197 CAGCCACTTGGCCCCCTTGAAGG - Intergenic
1112487612 13:99834235-99834257 CACTGGCTTGGCACCTTGGCAGG - Intronic
1113661442 13:112108605-112108627 GAACCACTGGGCACCCTGGAGGG - Intergenic
1114703776 14:24705555-24705577 CACATGCTTGGCACCTTGGCAGG - Intergenic
1115606447 14:35007161-35007183 CACACTCTTGTCACCCAGGCTGG - Intronic
1117347734 14:54850340-54850362 CTCCCTCTTGTCACCCAGGCTGG + Intronic
1118201134 14:63674325-63674347 CTCCCTCTTGTCACCCAGGCTGG - Intergenic
1119408131 14:74411375-74411397 CACCCACTTGGGGCCATGTCTGG + Intronic
1119683805 14:76614024-76614046 CACCCTCTTGCCTCCTTGGCTGG + Intergenic
1124065426 15:26338906-26338928 CTCACACTTGTCACCCAGGCTGG - Intergenic
1125736719 15:41932279-41932301 CACTCACGTGGAGCCCTGGCGGG - Intronic
1126296450 15:47142298-47142320 TTTCCACTAGGCACCCTGGCAGG - Intergenic
1127090074 15:55457895-55457917 CACCCAGTTGGGCCCCAGGCTGG - Intronic
1127356758 15:58208072-58208094 CCCCCAATTGGCTCCCTGACTGG + Intronic
1127768106 15:62207619-62207641 CCCGCACTTGGCGCGCTGGCCGG + Intergenic
1128793295 15:70448577-70448599 CACCCACCTGGGCCCCTGTCAGG - Intergenic
1129334466 15:74843929-74843951 CACCCACTCGGCAGCCTCGAGGG + Exonic
1129395696 15:75244676-75244698 CAGCCACATGCCACCATGGCTGG - Intergenic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1130276428 15:82478691-82478713 CTCCCTCTTGTCCCCCTGGCTGG - Intergenic
1130468796 15:84206086-84206108 CTCCCTCTTGTCCCCCTGGCTGG - Intergenic
1130476286 15:84320637-84320659 CTCCCTCTTGTCCCCCTGGCTGG - Intergenic
1130495479 15:84467493-84467515 CTCCCTCTTGTCCCCCTGGCTGG + Intergenic
1130591090 15:85210685-85210707 CTCCCTCTTGTCCCCCTGGCTGG - Intergenic
1130884695 15:88083248-88083270 CTCCCTCTTGTCACCCAGGCTGG + Intronic
1133767155 16:8846073-8846095 CAGCCACTTGGGAACCTGTCAGG - Intronic
1134298787 16:12971073-12971095 CACCCACCTGGGATCCTGGCAGG + Intronic
1134787880 16:16961516-16961538 AACCCACTTAGCATCATGGCGGG + Intergenic
1135690040 16:24529008-24529030 CTCCCTCTGGGCACCCAGGCTGG + Intergenic
1137257683 16:46790275-46790297 CCCCCACTGTGCAGCCTGGCTGG - Intronic
1137588121 16:49676655-49676677 CAACCACTTGACACCCTAGATGG + Intronic
1137648580 16:50097880-50097902 CACACTCTTGTCACCCAGGCTGG - Intronic
1137721172 16:50628353-50628375 CACCCACATGCCTGCCTGGCTGG + Intronic
1139671737 16:68497054-68497076 CACTCACTTAGCTCCCTGGAGGG + Intergenic
1140071772 16:71656778-71656800 CTCCCTCTTGTCACCCAGGCTGG + Intronic
1140374073 16:74430898-74430920 CTCCCTCTTGTCACCCAGGCTGG + Intergenic
1140479150 16:75253227-75253249 CACCCACTCCTCAGCCTGGCTGG + Intronic
1140870591 16:79102887-79102909 CACGCACATGCAACCCTGGCTGG + Intronic
1141394353 16:83691558-83691580 CACCCACCTGGCACTTTGGGAGG + Intronic
1141714898 16:85721231-85721253 CACGTACTTGGCACCCTGCCTGG + Intronic
1141832154 16:86515853-86515875 CACTCACTTGGCGCCCTGGCTGG + Intergenic
1143181551 17:4987159-4987181 CTCCCGCTCCGCACCCTGGCAGG - Intronic
1143184110 17:5000305-5000327 CACACACTTGGCATCCTGGCTGG - Exonic
1143378382 17:6480504-6480526 CACACACCTGGCACCCTGCTGGG + Intronic
1143863297 17:9906532-9906554 CTCACACTTGTCACCCAGGCTGG - Intergenic
1145413821 17:22695820-22695842 AACCCTCTGGGCACCCAGGCTGG + Intergenic
1146968939 17:37056681-37056703 CACCCAGTGGGCGCCTTGGCTGG + Exonic
1148124643 17:45230505-45230527 AACCCACTTGGCTCCCTAGGAGG - Intronic
1148781898 17:50127068-50127090 CTCCCTCTTGTCACCCAGGCTGG - Intronic
1149823883 17:59809027-59809049 CTCCCTCTTGTCACCCAGGCTGG + Intronic
1150656549 17:67043534-67043556 CACCCGCCTGGCCCCCAGGCTGG - Intergenic
1152839795 17:82559850-82559872 CACCCACTTGGCCCTCTTCCAGG - Intronic
1152863907 17:82710966-82710988 AAACCACTTGGCAACCCGGCTGG - Intergenic
1153806384 18:8711898-8711920 CACAGTCTTGGCAGCCTGGCAGG - Intronic
1154494143 18:14943667-14943689 AACCCACTGTGCACCCAGGCCGG - Intergenic
1156465881 18:37347667-37347689 CTGCCCCTGGGCACCCTGGCAGG + Intronic
1158551485 18:58439823-58439845 CTCTCACTTGTCACCCAGGCTGG + Intergenic
1158633708 18:59138458-59138480 AACTCACCTGGCACCGTGGCAGG - Intergenic
1159043399 18:63345910-63345932 CTCCCTCTTGTCACCCAGGCTGG - Intronic
1159342055 18:67147775-67147797 CTCCCTCTTGTCACCCAGGCTGG + Intergenic
1159347483 18:67225776-67225798 CTCCCTCTTGTCACCCAGGCCGG + Intergenic
1159702419 18:71645452-71645474 CATCCAATTGGCACAGTGGCTGG - Intergenic
1159779628 18:72646025-72646047 CACAGGCTTGGCACCCAGGCTGG + Intergenic
1160565701 18:79785544-79785566 CCCCCACCAGGCTCCCTGGCAGG - Intergenic
1161648784 19:5471281-5471303 CTCCCTCTTGTCACCCAGGCTGG - Intergenic
1162299143 19:9834561-9834583 CACCCACTGGTCACCCAGGATGG + Intergenic
1163312199 19:16521377-16521399 CACACACTTGTCACTCAGGCGGG + Intronic
1163769226 19:19180610-19180632 CGCCCGCTTGGCAGCCAGGCAGG - Intronic
1164066093 19:21718529-21718551 CTCACTCTTGTCACCCTGGCTGG - Intergenic
1166003402 19:39891688-39891710 CACCTACGTGGCAGCCTGTCAGG - Exonic
1166382398 19:42361905-42361927 CATCCACCTGTCACCCAGGCTGG - Intronic
1166920916 19:46228641-46228663 CACCCTCTAGGCACCATGGCTGG - Intergenic
925551585 2:5081689-5081711 TTCCCAGTTGGCACCCTGGGAGG + Intergenic
928365200 2:30695224-30695246 CACCCAACTGCTACCCTGGCAGG - Intergenic
929000817 2:37345190-37345212 CCCCCACTCGGGACCCTGGAGGG + Intronic
929184454 2:39079028-39079050 CTCCCTCTTGTCACCCAGGCTGG - Intronic
933939978 2:87236858-87236880 CTCGCACTTGTCACCCAGGCTGG - Intergenic
935468373 2:103426390-103426412 CTCCCTCTTGTCACCCAGGCTGG - Intergenic
936091733 2:109505928-109505950 CCTCCACTTGGCAAGCTGGCTGG - Intergenic
936353162 2:111728917-111728939 CTCGCACTTGTCACCCAGGCTGG + Intergenic
937901337 2:127021696-127021718 CACGCTCTTGTCACCCAGGCTGG + Intergenic
937917417 2:127106015-127106037 CACGCTCTGGGCACCCTGGGAGG + Intronic
938962877 2:136358815-136358837 CACCCAGTGGGCAGTCTGGCTGG + Intergenic
940287885 2:152050249-152050271 CATCCTTTTGGCACACTGGCTGG + Intronic
944036717 2:195303149-195303171 CTCCCTCTTGTCACCCAGGCTGG - Intergenic
944087186 2:195863004-195863026 CTCACTCTTGTCACCCTGGCTGG - Intronic
945314002 2:208350883-208350905 CTCCCACTCATCACCCTGGCAGG + Exonic
946030937 2:216704583-216704605 CTCCCTCTTGTCACCCAGGCTGG + Intergenic
948580432 2:238984098-238984120 CACGCTCTTGTCACCCAGGCTGG + Intergenic
948965441 2:241376132-241376154 CACACATTTGGCACCCTGGTTGG + Intronic
1170760035 20:19240987-19241009 CTCCCACTTGTGAACCTGGCTGG + Intronic
1171207932 20:23295617-23295639 CACCCAGTTAGCTCCCTGGAGGG + Intergenic
1172066857 20:32227490-32227512 CACCCAGGTGTCACCCAGGCTGG - Intronic
1172208615 20:33181997-33182019 CACCCACTTGCCAGGCTGCCTGG + Intergenic
1172845619 20:37928324-37928346 CACCCACTTGCCACCTTGAGCGG - Intronic
1173247812 20:41348414-41348436 GAGCCACCTGCCACCCTGGCAGG - Intronic
1173416359 20:42859724-42859746 CAGGCACCTGGCACCATGGCCGG + Intronic
1173437842 20:43048558-43048580 CACCCCCTTGGCCCACTGCCTGG - Intronic
1174410304 20:50330773-50330795 CAGCAACTTCCCACCCTGGCTGG - Intergenic
1181084892 22:20435388-20435410 CAAACACTTCGCACCCTGGGGGG - Intronic
1181569504 22:23760477-23760499 CATCCACCTGGTGCCCTGGCTGG + Intergenic
1181990583 22:26833815-26833837 CCACCTCTTGCCACCCTGGCTGG - Intergenic
1182821309 22:33218870-33218892 CAGCCACCTGGCATCCAGGCAGG + Intronic
1182923347 22:34100256-34100278 CACCCACATGGAACTCTGCCAGG - Intergenic
1183285523 22:36960118-36960140 CACACACATTGCAGCCTGGCCGG - Intergenic
1184165401 22:42724312-42724334 CTCCCTCCTAGCACCCTGGCAGG + Intergenic
1184253120 22:43272084-43272106 TACCCACTTGGCAGCCTGGACGG + Intronic
1184355229 22:43975202-43975224 CACCCACAGGGCACCATGCCAGG - Intronic
1184388702 22:44190803-44190825 CACCCCCTGGCCATCCTGGCTGG - Intronic
1184471303 22:44697829-44697851 CTCCCACTTGGCAGCCTTGTGGG + Intronic
1184878577 22:47290884-47290906 CCCCCACCAGGCAGCCTGGCTGG - Intergenic
1185371612 22:50463475-50463497 GACCCACTCGGGGCCCTGGCAGG + Intronic
949345232 3:3070610-3070632 CTCACTCTTGTCACCCTGGCTGG + Intronic
949581982 3:5397644-5397666 CTCACACTTGTCACCCAGGCTGG + Intergenic
950294744 3:11819273-11819295 AACACACTTGGCACAGTGGCTGG - Intronic
953743687 3:45557310-45557332 CTCCCTCTTGTCACCCAGGCTGG + Intronic
953967531 3:47321196-47321218 CTCACTCTTGGCACCCAGGCTGG + Intronic
954462092 3:50633079-50633101 CTCCCACTGGTCACCATGGCAGG - Intronic
954514995 3:51166078-51166100 CTCACACTTGTCACCCAGGCTGG + Intronic
956609053 3:71103498-71103520 CACTCCCCTGGCACCCTGCCCGG - Intronic
956770356 3:72520669-72520691 CTCCTACCTGGAACCCTGGCAGG + Intergenic
957964891 3:87309785-87309807 GACTCACCTGGCATCCTGGCAGG - Intergenic
959588700 3:108052237-108052259 CAGCCACTTGTTACACTGGCTGG + Intronic
960346415 3:116538796-116538818 CCCCCATTAAGCACCCTGGCTGG - Intronic
960971124 3:123141004-123141026 AACCCACTTGCCACCCTGGCAGG + Intronic
961442035 3:126958982-126959004 CAGCCTCTTGGCTTCCTGGCAGG + Intronic
961630574 3:128295697-128295719 CACCTGCTTGGGACTCTGGCAGG - Intronic
961786774 3:129352270-129352292 TACCCTCCTGGCATCCTGGCAGG + Intergenic
963791802 3:149590614-149590636 CTCCCTCTTGTCACCCAGGCTGG - Intronic
966780826 3:183582740-183582762 CTCCCTCTTGTCACCCAGGCTGG + Intergenic
968739950 4:2322422-2322444 CACCCACTGGTGAGCCTGGCAGG + Intronic
968758582 4:2429199-2429221 CAGCCACATAGCACCTTGGCAGG + Intronic
968818104 4:2832137-2832159 TGCCCAGCTGGCACCCTGGCTGG + Intronic
969465392 4:7353335-7353357 GTCCCACTTGGCACCAAGGCTGG - Intronic
974147682 4:57967240-57967262 CACCCACCTGGAACCCGCGCTGG - Intergenic
974147976 4:57969481-57969503 AACTCACTTGTCACCCAGGCTGG + Intergenic
976319756 4:83700246-83700268 CACCCAGCTGTCACCCAGGCTGG + Intergenic
978870884 4:113576061-113576083 CTCCCTCTTGTCACCCAGGCTGG + Intronic
981027403 4:140090905-140090927 CACGCACTTGCCACCATGCCTGG - Intronic
982354232 4:154449131-154449153 CTGCCCCTTCGCACCCTGGCTGG + Intronic
984171700 4:176367953-176367975 CACCCATTTGGCTCCCTGCTAGG - Intergenic
985640701 5:1062231-1062253 GCCCCACCTGGCCCCCTGGCAGG + Intronic
987193371 5:15500816-15500838 ACCCCATTTGGCACCCTGTCTGG + Intronic
997512137 5:134461077-134461099 CTCCCACCTGGCACCATAGCAGG + Intergenic
997605269 5:135170716-135170738 CACCCACTTGTCACCCTGCCAGG - Intronic
999518424 5:152324382-152324404 CACCCACTTGGCCCTCTTCCAGG - Intergenic
1001340754 5:170843033-170843055 CTCCCTCTTGTCACCCAGGCTGG + Intergenic
1001787103 5:174423229-174423251 CTCCCAGTAGGCACCCTGGATGG + Intergenic
1001955136 5:175843726-175843748 CACCCACTTGGCTCACAGCCTGG - Intronic
1002913257 6:1507323-1507345 CAGGCACCTGCCACCCTGGCTGG - Intergenic
1003085796 6:3060217-3060239 CACACTCTTGTCACCCAGGCAGG - Intergenic
1003367809 6:5493177-5493199 CTCCCTCTTGTCACCCAGGCTGG - Intronic
1004673089 6:17815935-17815957 CTCCCTCTTGTCACCCAGGCTGG + Intronic
1006134780 6:31888790-31888812 CACCTACTGGGACCCCTGGCGGG + Intronic
1006354718 6:33548283-33548305 CACTCACTTGTCACCCAGGCTGG - Intergenic
1006515248 6:34541937-34541959 CACCCAGCTGGGACACTGGCTGG - Intronic
1007400791 6:41601173-41601195 CACCCACGTGGCACACTGTGTGG + Exonic
1007657110 6:43456972-43456994 CACCCACTCAGCTCCCTAGCTGG + Intergenic
1010544344 6:77131164-77131186 CTCCCTCTTGTCACCCAGGCTGG - Intergenic
1011041777 6:83037263-83037285 AACACACTTGGCAGCCTGGAGGG - Intronic
1011258790 6:85450610-85450632 CATCCAGCTGGCACACTGGCCGG - Intronic
1015895511 6:138012830-138012852 CACCTACTTGGCCCCCTTCCAGG - Intergenic
1016951924 6:149588768-149588790 CAGGCACTTGCCACCCTGCCTGG + Intronic
1017020600 6:150137031-150137053 CACCCTCTGGGCACTCTGGAGGG + Intergenic
1017460547 6:154645843-154645865 CTGCCACTTGGCAGCTTGGCAGG - Intergenic
1017831943 6:158138403-158138425 CTCCCTCTTGTCACCCAGGCTGG - Intronic
1019653326 7:2172592-2172614 CAGCCACTCGCCACCTTGGCCGG + Intronic
1022426022 7:30269567-30269589 CAGCCCCATGGCACCCAGGCTGG + Intergenic
1022518246 7:30989037-30989059 CAAACCCTTGGCACACTGGCTGG + Intronic
1023312876 7:38905821-38905843 CTCCCTCTTGTCACCCAGGCTGG + Intronic
1023559012 7:41452915-41452937 CTCTCACTTGTCACCCAGGCTGG - Intergenic
1026148740 7:67770724-67770746 CAGCCACTTGGGAACATGGCAGG - Intergenic
1029737060 7:102470793-102470815 CTCCCTCTTGTCACCCAGGCTGG + Intronic
1032419166 7:131764241-131764263 CACCCACTGTGCTCCCTGGCTGG - Intergenic
1032595728 7:133237876-133237898 CACCCAGCTGTCACCCAGGCTGG - Intergenic
1033223863 7:139545652-139545674 CACACACTGGGCTCCCAGGCAGG - Intergenic
1033280940 7:140005968-140005990 CAGCCACTGGCCACCCTGCCTGG - Intronic
1034050385 7:147977898-147977920 CCACCACTTGGCTCACTGGCAGG - Exonic
1035112211 7:156492436-156492458 CACCCACTTGACACACTGCTGGG - Intergenic
1035177518 7:157062369-157062391 CTTCCACTTGGCACCCAGGCAGG - Intergenic
1035649759 8:1255790-1255812 CACACACATAGCACCCAGGCAGG - Intergenic
1035649768 8:1255848-1255870 CACACACACGGCACCCAGGCAGG - Intergenic
1035649774 8:1255880-1255902 CACACACATAGCACCCAGGCAGG - Intergenic
1035649804 8:1256058-1256080 CACACACATAGCACCCAGGCAGG - Intergenic
1035649851 8:1256321-1256343 CACACACATGGCACCCAGACAGG - Intergenic
1037380879 8:18284014-18284036 CTCTGACTTGGCACCATGGCTGG - Intergenic
1039759357 8:40558119-40558141 CACACCCATGGCAGCCTGGCCGG - Intronic
1040632413 8:49230623-49230645 CCCCCACTTGGCTCTTTGGCTGG + Intergenic
1040884294 8:52242840-52242862 CTCACTCTTGTCACCCTGGCTGG - Intronic
1042449718 8:68930383-68930405 CACACTCTTGTCACCCAGGCTGG - Intergenic
1043034440 8:75178714-75178736 CACCCACTCGGAACCCGTGCTGG + Intergenic
1043300539 8:78725387-78725409 CACCAACTTGGCACTCTTTCTGG - Intronic
1046974088 8:120253892-120253914 CTCGCTCTTGTCACCCTGGCTGG - Intronic
1047747468 8:127855564-127855586 CACCCACTTGTCTCCCTTCCCGG - Intergenic
1048263295 8:132963988-132964010 CAACCACTTGGCACAGTGCCTGG + Intronic
1049157198 8:141074408-141074430 CACCCCCTTGGCCTGCTGGCTGG + Intergenic
1049853073 8:144844677-144844699 CACACTCTTGTCACCCAGGCTGG - Intronic
1049867435 8:144947906-144947928 CTCCCAGTGGGCACCCGGGCAGG - Intronic
1050432407 9:5575046-5575068 CAGCCAATGGGGACCCTGGCAGG + Intergenic
1052293677 9:26873210-26873232 TGCTCACTTGTCACCCTGGCTGG - Intronic
1053387716 9:37707812-37707834 CCCACCCTTGGCTCCCTGGCTGG + Intronic
1053593544 9:39535304-39535326 CTCCCTCTTGTCACCCAGGCTGG - Intergenic
1053851277 9:42290014-42290036 CTCCCTCTTGTCACCCAGGCTGG - Intergenic
1054572761 9:66829973-66829995 CTCCCTCTTGTCACCCAGGCTGG + Intergenic
1055574617 9:77648507-77648529 CCCACACTTGCCTCCCTGGCTGG + Intergenic
1056911886 9:90708474-90708496 CACACAGTTAGCACCCGGGCAGG - Intergenic
1056932440 9:90890202-90890224 CTCCCACTTGGCTCCCAGGTGGG + Intronic
1056942248 9:90965531-90965553 AACCAACTAGGCCCCCTGGCAGG - Intergenic
1057720340 9:97527327-97527349 CACCAACAGGGCAGCCTGGCTGG + Intronic
1057888867 9:98852919-98852941 CCCCCACCTGCCTCCCTGGCAGG + Intergenic
1058718071 9:107739861-107739883 CACCCCCTGGGCACCCAGCCAGG - Intergenic
1058896573 9:109405730-109405752 TACCCACATGGCACCATGCCTGG + Intronic
1059502564 9:114767491-114767513 CTCCCTCTTTGCTCCCTGGCAGG - Intergenic
1060721797 9:125984493-125984515 CACCCACCTGGGACTCTGGAGGG - Intergenic
1060805517 9:126573528-126573550 CTCCCTCTTGTCACCCAGGCTGG + Intergenic
1060985073 9:127815163-127815185 CACCCTCTGGGCTCCCAGGCTGG + Exonic
1061809530 9:133154302-133154324 CACACAGTGGGGACCCTGGCAGG - Intronic
1062070454 9:134552613-134552635 CACCCAGCTGGCACCCAGGGAGG - Intergenic
1203452241 Un_GL000219v1:129867-129889 CAGCCATTTGTCACCCTGGAAGG + Intergenic
1185671366 X:1812675-1812697 CTCCCTCTTGTCACCCAGGCTGG - Intergenic
1187993772 X:24904075-24904097 CAGGCACTTGGCACCATGACTGG + Intronic
1191955317 X:66637748-66637770 CACACACTTAGCACAGTGGCTGG - Intronic
1192393274 X:70753250-70753272 CACTCTCTAGCCACCCTGGCTGG - Intronic
1192806542 X:74514638-74514660 CACCACCTTGGCACCTTGCCAGG - Intronic
1196647681 X:118135223-118135245 CAGGCACTTGCCACCCTGCCTGG + Intergenic
1197213627 X:123848270-123848292 CTCGCACTTGTCACCCAGGCTGG - Intergenic
1201380900 Y:13377680-13377702 CACCCTCTTCTCACCCAGGCTGG - Intronic