ID: 1083752148

View in Genome Browser
Species Human (GRCh38)
Location 11:64766682-64766704
Sequence GTGTCTGGGGAGAGGTTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083752148_1083752157 28 Left 1083752148 11:64766682-64766704 CCCACGAACCTCTCCCCAGACAC 0: 1
1: 0
2: 2
3: 11
4: 167
Right 1083752157 11:64766733-64766755 CAAGATGCCCCTCCACCCCCTGG 0: 1
1: 1
2: 0
3: 25
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083752148 Original CRISPR GTGTCTGGGGAGAGGTTCGT GGG (reversed) Intronic
900520780 1:3104614-3104636 GGGTCTGGGGAGAGGGCCGCTGG - Intronic
900664374 1:3804544-3804566 GGGTCTGGGGAGGGGTGTGTGGG + Intergenic
903065476 1:20697006-20697028 CTGTTTGGGGAGAGGCTCGATGG - Intronic
903421630 1:23221710-23221732 GTGTCTGGGGACAGGTGTCTGGG + Intergenic
904732368 1:32604361-32604383 GTGTCTGGGGAAAGGTTTGTGGG - Exonic
905777609 1:40679287-40679309 GTGCCTGGGGAGGGGATGGTGGG - Intergenic
909016531 1:70385890-70385912 GTGTCTAGGGAGAGGCTGGTAGG - Intergenic
910213792 1:84821296-84821318 GTGTATGGGGAGAGGGTGTTTGG - Intronic
910996010 1:93105176-93105198 CTGTTTGGGGGGAGGTTAGTGGG + Intronic
911839685 1:102664861-102664883 GTGTCTGGTTAGAGGTTCATTGG + Intergenic
914198516 1:145463978-145464000 GTTTCTGGGGAGAAGTTGTTGGG - Intergenic
914477624 1:148037107-148037129 GTTTCTGGGGAGAAGTTGTTGGG - Intergenic
914511106 1:148332858-148332880 GTTTCTGGGGAGAAGTTGTTGGG - Intergenic
920218762 1:204379948-204379970 GTGTGTGGGGAGATCTTCCTGGG + Intergenic
920439072 1:205966556-205966578 GTGTCTGTTGAGAGGCTCGGAGG - Intergenic
920495072 1:206448732-206448754 GTGGCGGGGGAGAGGTTCAAAGG - Intronic
924165428 1:241276960-241276982 GTCTCTGGGCAGAGGTACGAAGG - Intronic
1063944289 10:11162156-11162178 GTGCCAGGAGAGAGGTTGGTGGG + Intronic
1064148665 10:12844745-12844767 GTCTCTGGTGAGAGATTCATGGG - Intergenic
1070416149 10:76191441-76191463 GTGTTTGGGGAAAGGTTAGAAGG - Intronic
1073482497 10:103795493-103795515 TTGTCTGGGGAGAGAGTCTTTGG + Intronic
1074955074 10:118380732-118380754 GTGTTTGAGGAAAGGTTGGTGGG - Intergenic
1076632523 10:131859498-131859520 GAGTCTGGGGAGAGGTATGCAGG + Intergenic
1077375706 11:2204264-2204286 GTGGCTGGGGAGTGGTGGGTGGG + Intergenic
1077747908 11:4928037-4928059 GCGTGTGGGGAGAGGGTCGAGGG + Intronic
1083752148 11:64766682-64766704 GTGTCTGGGGAGAGGTTCGTGGG - Intronic
1090574831 11:128089381-128089403 TAGTTTGGGGAGAGGTTCCTAGG - Intergenic
1098018358 12:66130258-66130280 CAGTCTGGGGAGAGGGTCGGGGG - Intronic
1101882345 12:108634074-108634096 CTTTCTGGGGAGAAGTTCTTCGG + Intergenic
1102489227 12:113278906-113278928 GCGTCTGAGGAGAGGTTCAGAGG + Intronic
1103028952 12:117596487-117596509 ATGTCTGGGTAGGTGTTCGTTGG - Intronic
1108149085 13:47512712-47512734 GTCTCTGGGCTGAGGTTCCTGGG + Intergenic
1112683874 13:101800023-101800045 GTGTCTGTGGAGAAGTAGGTAGG - Intronic
1113872073 13:113565604-113565626 GGGTCTGGGAGGAGGGTCGTTGG - Intergenic
1115631104 14:35246244-35246266 TTATTTGGGGAGATGTTCGTTGG + Intronic
1124884695 15:33674325-33674347 GTGTTTAGGGAGAGGCTCTTTGG - Intronic
1126099462 15:45110991-45111013 CTGTCTGGGGAGGGGTTTCTGGG + Intronic
1126104065 15:45136046-45136068 CTGTCTGGGGAGGGGTTTCTGGG - Intronic
1131119061 15:89812060-89812082 GTGGGTGGGGAGAGGCTCCTTGG + Intronic
1135871431 16:26155020-26155042 GGGTCTGGGGAGAGGGTTGTGGG - Intergenic
1136415070 16:30097905-30097927 GGGTCTGAGGATAGGTTCTTTGG - Intergenic
1137718438 16:50613001-50613023 GGGGCTGGGGAGAGGTCCATGGG + Intronic
1140613598 16:76632865-76632887 GAGTCTGTGGAGGGGTTAGTAGG + Intronic
1141833484 16:86523024-86523046 GTATCTGGGGTGAGGTATGTCGG + Intergenic
1143478690 17:7217053-7217075 GTTTGTGGGGAGGGGTTAGTAGG - Intronic
1144203125 17:12959045-12959067 GTGTCTGGGATGAGTTTCTTTGG + Intronic
1144336597 17:14276975-14276997 GTGCCTGGGGTGAGATTCTTTGG - Intergenic
1144429886 17:15181571-15181593 GTGTCTGGTGAGTAGTACGTGGG - Intergenic
1144577647 17:16439130-16439152 GTCTCTGGGGAGATGTTCCCGGG + Intergenic
1144949733 17:18987516-18987538 GTGTCTGGGCAGAAGAGCGTTGG + Intronic
1146041734 17:29461483-29461505 GTGTCAGGGCTGAGGTTTGTTGG - Intronic
1146789377 17:35742865-35742887 GAGTCTGGGGGAAGGGTCGTGGG + Exonic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1155151715 18:23128339-23128361 GAATCTTGGGAGAGGCTCGTGGG + Intergenic
1157181880 18:45505546-45505568 GTTTCTGGGGTGAGGTATGTGGG - Intronic
1158969832 18:62656185-62656207 GGGTCTGGGGGGAGGTGTGTGGG - Intergenic
1160513590 18:79466366-79466388 GTATCTGGGGAGAGGGTTGGCGG - Intronic
1161328693 19:3676004-3676026 CTGTGTGGGGAGAGCTTGGTCGG - Intronic
1161381910 19:3970059-3970081 GTGTCTGGAGAGAGTTTTGCGGG - Intronic
1162525561 19:11204172-11204194 GGGTCTGGGGAGGGGGTCCTGGG + Intronic
1163783197 19:19261241-19261263 GTCTCTGGGGAGGGGAACGTGGG + Intronic
1164526797 19:29018938-29018960 GTGTCTGAGGAAAGGTGCCTGGG + Intergenic
1165101289 19:33440126-33440148 GCATCTGGGGAGAGGTTCAGAGG - Intronic
1166971079 19:46568322-46568344 CTGCCTGGGGAGAGGCTCATGGG - Intronic
1167150045 19:47703070-47703092 CTAGCTGGGGAGAGGTTCGGGGG - Exonic
1168167008 19:54555526-54555548 GTGTCTGGAAAGATGTTTGTGGG - Intergenic
925183516 2:1831920-1831942 GTGTCTGAGGAGAGCCGCGTAGG - Intronic
927260390 2:21082466-21082488 GTGTGTGGGGAGGGGATTGTTGG - Intergenic
927432661 2:23040244-23040266 GGGTCTGGGGAGAGGAGCCTGGG + Intergenic
928024024 2:27725109-27725131 GTGCCTGGGGAGAGGAATGTGGG + Intergenic
930271285 2:49260549-49260571 GTTTCTGTGGAGAGGTAGGTAGG + Intergenic
932266808 2:70374617-70374639 GTGTCTGGTGAGAGCTTTCTGGG - Intergenic
932640105 2:73437243-73437265 GTATCTGGGGGCAGGTTCATTGG + Intronic
933707441 2:85302580-85302602 ATCTCTGGGGAGAGGTGGGTGGG - Exonic
935254635 2:101298764-101298786 GTTTCTGGGGAGAGGCGCTTCGG + Intronic
938058859 2:128236658-128236680 GTGTCTGGGGAGAGGGCCTGGGG + Intergenic
938196035 2:129329228-129329250 GTGACTGGGGAGAGGTGGGGTGG + Intergenic
940770528 2:157834934-157834956 GTGTCTGGCGAGGGCTTCTTAGG - Intronic
942717525 2:178910388-178910410 GTGGCTGGAGAGAGTTTTGTTGG + Intronic
943390130 2:187256056-187256078 GTGCCTGGTGAGAGGTGCTTGGG + Intergenic
946429420 2:219616780-219616802 GTGTCTGGGGAGAGGGTGTGTGG + Intergenic
947425193 2:229977066-229977088 GTCTCTGGTTAGAGGTTAGTTGG + Intronic
947737924 2:232467313-232467335 GGGTCTGGGCAGAGGTTTCTTGG - Intergenic
948864241 2:240767410-240767432 GTGCCTGGAGAGAGGTTGGAGGG - Intronic
1173455241 20:43196427-43196449 GTGTGTGGGGAGGGGTTGGGAGG - Intergenic
1174401420 20:50278012-50278034 GAGGGTGGGGAGAGGGTCGTGGG + Intergenic
1175166461 20:57047855-57047877 GTGTCTGGTGACAAGTTTGTTGG + Intergenic
1175409146 20:58754518-58754540 CTGTAGGGGGAGAGGTTGGTGGG + Intergenic
1176822313 21:13668837-13668859 GTAGCTGGGGGGAGGTTTGTGGG - Intergenic
1178304679 21:31481570-31481592 GAGCCTGGGGAGAGGATCATGGG - Intronic
1178576098 21:33792972-33792994 GGGTCTGGGGGGAGGTACTTAGG - Intronic
1180839840 22:18954189-18954211 GTGTCTCAGGAGAGGTTCCGGGG - Intergenic
1181062055 22:20286290-20286312 GTGTCTCAGGAGAGGTTCCGGGG + Intergenic
1181269775 22:21652343-21652365 GTGTCTGAGGAGGGGATCCTGGG + Intronic
1181835573 22:25605138-25605160 CTGTCTGTGAAGAGGTTCTTTGG + Intronic
950529249 3:13543616-13543638 GTGTCTGGGGAGAGGAGTGGGGG - Intergenic
951774981 3:26300321-26300343 GTGTCTGGCAAAAGGTTCGTGGG - Intergenic
953010523 3:39021266-39021288 GTCTCTAGGTAGAGGTTAGTTGG + Intergenic
954128919 3:48549824-48549846 GTGTGGGGGGAGAGGTTGCTGGG - Intronic
964629549 3:158795328-158795350 GTGTCTGGGTAGAGGTATGTGGG - Intronic
967860634 3:194148777-194148799 GTGTCTGGGTAGAGATGCGGGGG - Intergenic
969555497 4:7906067-7906089 CTGTTTGGAGAGAGGTTCTTGGG - Intronic
969585809 4:8090945-8090967 GTGTCCGCGGAGAGGCTGGTTGG - Intronic
972580110 4:40387598-40387620 GTGTATGGGGAGGGGTATGTGGG + Intergenic
978544061 4:109851541-109851563 GTGTCCACGGGGAGGTTCGTAGG - Exonic
980053971 4:128062156-128062178 GTGTCTGGGGACAGGTGCTGGGG - Intronic
984758509 4:183344759-183344781 CTGACTGGGGTGAGGTTAGTTGG - Intergenic
986270062 5:6222262-6222284 GTCTCTGGTTAGAGGTTAGTTGG - Intergenic
987183237 5:15387789-15387811 GGGTCTGGTGGGAGGTTCTTGGG - Intergenic
989570341 5:42940310-42940332 GTGTCTGGAGAGTGGATCTTGGG - Intergenic
991159945 5:63487161-63487183 GGGTCTGGTGAGAGGTGCTTGGG + Intergenic
998152597 5:139765677-139765699 GCGGCTGGGGAGAGGGTCGAGGG + Intergenic
998252499 5:140562344-140562366 GTGCCTGGGGTGAGGTGAGTTGG - Exonic
999244420 5:150146245-150146267 GTATTTGGGGAGAGGGTGGTTGG - Intronic
999383692 5:151139583-151139605 GTGTCAGGGCAGAGGGTCATGGG + Intronic
1001437809 5:171714284-171714306 GAGTCAGGGGAGTGGTTGGTGGG - Intergenic
1002460064 5:179368922-179368944 GTGCCTGGGGAGAGGTGCACGGG - Intergenic
1003510890 6:6779509-6779531 GTGTCGGGGGAGTGGTTGGGGGG - Intergenic
1004250875 6:14022206-14022228 GTCTCTGGGTAGAGGTTCCCGGG + Intergenic
1004542158 6:16561381-16561403 GTATCTGTGGAGAGGTGGGTGGG - Intronic
1005414704 6:25587394-25587416 GTGTCTGGACAGAGGCTTGTGGG + Intronic
1005982173 6:30844724-30844746 GTGTCTGGGGTGTGGAACGTGGG + Intergenic
1006261314 6:32873940-32873962 CTGTCTGGGGCGAGGTTGGAGGG - Intergenic
1006303485 6:33206267-33206289 GTGTCTGTGGAGAGGTTTGTGGG + Intronic
1006379632 6:33690049-33690071 GTGTTTGTGGTGAGCTTCGTGGG + Exonic
1007079340 6:39087633-39087655 GTGTCTGGGGAAAGGTTTTGGGG - Exonic
1007115626 6:39341190-39341212 GTGGCTGGGGAGAGGGTGGAAGG - Intronic
1007581679 6:42963721-42963743 GTGCCTGGGCAGAGGCTTGTGGG - Exonic
1007628921 6:43262075-43262097 GTGTGTGGGGAGAGGTCCTGTGG + Intronic
1015849992 6:137561752-137561774 ATGTCTGGGGACAGTTTGGTGGG + Intergenic
1016621445 6:146113859-146113881 CTGTTTGGGGAGAGGTTCTTTGG + Intronic
1017728102 6:157289895-157289917 GTGGCTGCTGAGAGGGTCGTGGG - Exonic
1020637289 7:10712516-10712538 GAGTCGGGAGAGAGGTGCGTTGG - Intergenic
1022942795 7:35255825-35255847 GTGTCTGGGGAGAGACAGGTTGG - Intergenic
1023960391 7:44921686-44921708 ATGTGTGGGGAGAGATTGGTGGG + Intergenic
1025908703 7:65810232-65810254 GTGCCTGGTGAGAGGTGTGTGGG - Intergenic
1026785744 7:73300672-73300694 CTGTCTGAGGAGAGGTTGGGCGG + Intergenic
1027108321 7:75419264-75419286 CTGTCTGAGGAGAGGTTGGGTGG - Intronic
1027878547 7:83802305-83802327 GTGTCTGGGGACAGGGTTGGGGG + Intergenic
1028424976 7:90676429-90676451 GTTGCTGGGGAGAGGTTGGGTGG + Intronic
1033591358 7:142811431-142811453 ATGGCTGGGAAGAGGTTCGATGG - Intergenic
1034335364 7:150319735-150319757 GGGTCAGGGGAGAGGTTGGTAGG - Intronic
1034352890 7:150428745-150428767 GTGTCTGTGGAGAGTGTGGTTGG - Intergenic
1034443790 7:151101488-151101510 GTGGCTGGGAAGAGGCTGGTGGG + Intronic
1035169824 7:157010981-157011003 GTGTCTCGGGAGCGGGTCTTGGG - Intergenic
1035529865 8:342762-342784 GTGTCTGGTGAGGGGTGGGTGGG + Intergenic
1035702744 8:1649018-1649040 ATGTCTGGGGAGAGGTCCGGAGG + Intronic
1040568215 8:48585706-48585728 GTTTCTGGGGAGATGTTGGAGGG + Intergenic
1041605391 8:59777199-59777221 GTCTCTGGTTAGAGGTTAGTTGG - Intergenic
1043159916 8:76833631-76833653 GTGTCAGGGGAGAGGGTATTGGG - Intronic
1044255324 8:90053494-90053516 GTGTTTGGTGAGAGGTGGGTGGG - Intergenic
1046062786 8:109158850-109158872 GTGTGTGGGGAGGGGTGTGTGGG - Intergenic
1046514777 8:115244220-115244242 GTGTCTGGAGAGAGAGTCATTGG + Intergenic
1049414940 8:142490845-142490867 GGGTCTGGGGTGGGGTTCGTGGG + Intronic
1050220755 9:3386993-3387015 GTGACTGGGGAGAGGAACCTGGG - Intronic
1052249774 9:26384159-26384181 GTGTCTCAGGAAAGGTTCATGGG + Intergenic
1053011791 9:34637783-34637805 GTGGCGGGGGAGCGCTTCGTGGG - Intronic
1056043188 9:82688755-82688777 GTGTGTGGGGTGTGGTTCTTTGG - Intergenic
1056537028 9:87537386-87537408 GTGTATGGGGAGATGTTTCTGGG + Intronic
1056753901 9:89370825-89370847 GTGTCTGGGGTGCGGTGTGTCGG + Intronic
1056754276 9:89372372-89372394 GTGTCTGGGGTGTGGTGTGTCGG + Intronic
1057410319 9:94811780-94811802 TTGTCTGGGGAGAACTTCTTAGG + Intronic
1059740340 9:117143910-117143932 GTGTCTGGAGATAGGATCTTTGG - Intronic
1061716337 9:132520793-132520815 GTGTCTGGGGAGGGGCTCCTGGG - Intronic
1187146323 X:16640487-16640509 GTGTCTGGCGAGTGCTTTGTGGG + Intronic
1187661906 X:21556820-21556842 GTAGCTGGGTAGAGGTTTGTGGG + Intronic
1188612640 X:32118781-32118803 GGTTGTGGGGAGAGGTGCGTGGG + Intronic
1189350741 X:40273747-40273769 TTGTCTGCGGAGAGCTTCCTTGG + Intergenic
1190117728 X:47637113-47637135 GTCTGTGGGGAGAGGGTGGTCGG + Exonic
1192681631 X:73259189-73259211 GTGACTGGGCAGATGTTCGGTGG - Intergenic
1196438452 X:115695384-115695406 GTGTTTGGGCAGAGGTAGGTGGG - Intergenic
1197807942 X:130415464-130415486 TTGTCTGTGGAGGGGTTCGGGGG + Intergenic
1197962063 X:132017787-132017809 GTTTCTTGGGAGAGATTCTTTGG - Intergenic
1198443667 X:136689748-136689770 GTGTCTGGGGAAAGGTTTTGAGG - Intronic
1198695354 X:139331216-139331238 GTGTCTGGGAAGGGGGTTGTGGG + Intergenic
1200234200 X:154460304-154460326 GTGACTGGGGAGGTGTTCGTGGG + Exonic
1201707800 Y:16956030-16956052 GGGTCTGGGGAGGGGTGTGTAGG - Intergenic
1202273787 Y:23095477-23095499 ATGTCTGTGGGGAGGTTAGTGGG + Intergenic
1202292239 Y:23325200-23325222 ATGTCTGTGGGGAGGTTAGTGGG - Intergenic
1202426783 Y:24729222-24729244 ATGTCTGTGGGGAGGTTAGTGGG + Intergenic
1202444008 Y:24940872-24940894 ATGTCTGTGGGGAGGTTAGTGGG - Intergenic