ID: 1083755675

View in Genome Browser
Species Human (GRCh38)
Location 11:64790421-64790443
Sequence TGTCCACCTGGATCACCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 305}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083755665_1083755675 25 Left 1083755665 11:64790373-64790395 CCCTGCCCCCAGGGCACTCACGT 0: 1
1: 0
2: 3
3: 16
4: 272
Right 1083755675 11:64790421-64790443 TGTCCACCTGGATCACCTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 305
1083755669_1083755675 18 Left 1083755669 11:64790380-64790402 CCCAGGGCACTCACGTTCAAAGC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1083755675 11:64790421-64790443 TGTCCACCTGGATCACCTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 305
1083755670_1083755675 17 Left 1083755670 11:64790381-64790403 CCAGGGCACTCACGTTCAAAGCT 0: 1
1: 0
2: 0
3: 9
4: 64
Right 1083755675 11:64790421-64790443 TGTCCACCTGGATCACCTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 305
1083755667_1083755675 20 Left 1083755667 11:64790378-64790400 CCCCCAGGGCACTCACGTTCAAA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1083755675 11:64790421-64790443 TGTCCACCTGGATCACCTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 305
1083755668_1083755675 19 Left 1083755668 11:64790379-64790401 CCCCAGGGCACTCACGTTCAAAG 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1083755675 11:64790421-64790443 TGTCCACCTGGATCACCTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 305
1083755666_1083755675 24 Left 1083755666 11:64790374-64790396 CCTGCCCCCAGGGCACTCACGTT 0: 1
1: 0
2: 1
3: 16
4: 207
Right 1083755675 11:64790421-64790443 TGTCCACCTGGATCACCTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083755675 Original CRISPR TGTCCACCTGGATCACCTGC TGG Exonic
900296740 1:1955675-1955697 TGGCAGCCTGGCTCACCTGCGGG + Exonic
902298814 1:15486870-15486892 TGCCCACATAGACCACCTGCGGG + Intronic
903457012 1:23494591-23494613 TGTGCATCTGAATCACCTGGAGG + Intergenic
903585908 1:24415271-24415293 TGCCCTCCTGGAACACCTGTCGG - Intronic
903626027 1:24730706-24730728 GGTCCACCTGGCTCACTTGCTGG - Intergenic
905634291 1:39539055-39539077 TGGACTCCTGCATCACCTGCAGG - Intergenic
906083373 1:43108625-43108647 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
906321950 1:44822654-44822676 TGTACATCTGTATCACCTGTGGG + Exonic
906876122 1:49541378-49541400 TGCCCACCTGGAACTCATGCTGG - Intronic
907831752 1:58070918-58070940 TCTCCACCTGGATCACTCTCAGG - Intronic
908266218 1:62381882-62381904 TGTCCACCAGAATCACTTACGGG - Intergenic
908847788 1:68342671-68342693 TGTTGACCTGGGTCACCTGAAGG + Intergenic
908879085 1:68710399-68710421 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
911087718 1:93993025-93993047 TGCTCACCTGGAACACCTGATGG - Exonic
911788343 1:101979823-101979845 TGTGCACCTGGAAAAGCTGCAGG + Intronic
912206105 1:107510975-107510997 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
912968733 1:114260525-114260547 TCCCCACCTGGGTGACCTGCAGG + Intergenic
913454572 1:119018237-119018259 TGTACATCTAGATCACCTGAAGG + Intergenic
915144245 1:153785492-153785514 AGTCCACCTGGATCTCAGGCTGG - Intergenic
915537853 1:156548341-156548363 TGCCAACCTGGATCTCCTCCCGG + Exonic
915593184 1:156882025-156882047 TGGTCACCTGGCTCACCTGCTGG + Intergenic
917051681 1:170931855-170931877 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
917310045 1:173669526-173669548 GGACCTCCTGGATCACCTGGCGG - Intronic
920502056 1:206491678-206491700 ACTCCTCCTGGAACACCTGCAGG - Exonic
920504600 1:206507338-206507360 TCTTCACCTGGAGCAGCTGCAGG - Intergenic
921221590 1:212977723-212977745 TGTGCACCAGCATCACCTGGAGG + Intronic
921817514 1:219580494-219580516 TGTGCATATGGATCACCTGGAGG - Intergenic
922572430 1:226642040-226642062 GGTCCACCTCGATCATCTTCTGG + Exonic
922668850 1:227494140-227494162 GGTCCACCTGCTCCACCTGCAGG - Intergenic
922670748 1:227507162-227507184 GGTCCACCTGCTCCACCTGCAGG + Intergenic
923842160 1:237684665-237684687 TCTCCAACTGAATGACCTGCGGG - Intronic
923930103 1:238684946-238684968 TGCCCACCTGGAACTCCAGCTGG + Intergenic
924152391 1:241142203-241142225 TGTGCACCTGGAAAACCTGTAGG - Intronic
1064219903 10:13431594-13431616 TGTGCTCCAGGATCACCTGGAGG + Intergenic
1068495011 10:57776415-57776437 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1068554981 10:58448571-58448593 AGCCCACCGGGATCTCCTGCTGG + Intergenic
1068779325 10:60902711-60902733 TTTCCATCTTCATCACCTGCAGG + Intronic
1068932907 10:62609910-62609932 AAGCCACCTGGATGACCTGCAGG - Intronic
1069287872 10:66739218-66739240 TGTCCATCAGAATCACCTGGAGG + Intronic
1069837801 10:71319924-71319946 CGTGCTCCTGGGTCACCTGCGGG - Intronic
1070824277 10:79381730-79381752 TGCTCACCTGAGTCACCTGCGGG - Intergenic
1071387977 10:85141444-85141466 TGCCCACCTGGAACTCCAGCTGG - Intergenic
1074153678 10:110780873-110780895 TCTCCAGCTGGCTCAACTGCAGG + Exonic
1075981241 10:126741893-126741915 TCTCCACCAGTATCACATGCAGG - Intergenic
1076816007 10:132914928-132914950 TCCCCACCTGAATCACATGCAGG + Intronic
1077246823 11:1543797-1543819 TGACCCCCAGGGTCACCTGCAGG + Intergenic
1077374043 11:2197372-2197394 TGGCCACCTGGACACCCTGCAGG - Intergenic
1077487955 11:2847760-2847782 GGTCCAGCTGCGTCACCTGCGGG - Exonic
1077563388 11:3280445-3280467 TATGCACCAGCATCACCTGCAGG - Intergenic
1077569280 11:3326260-3326282 TATGCACCAGCATCACCTGCAGG - Intergenic
1077798098 11:5512040-5512062 TCTGCACCAGGATCACCTGGAGG - Intronic
1078795796 11:14591107-14591129 TGCCCACCTGGAACTCCAGCTGG - Intronic
1079513421 11:21238021-21238043 TGTCCACTTGGATCCCTTACAGG + Intronic
1079540346 11:21565425-21565447 TTTGCACCAGAATCACCTGCAGG + Intronic
1083755675 11:64790421-64790443 TGTCCACCTGGATCACCTGCTGG + Exonic
1084152009 11:67292025-67292047 TCTCCACATGCACCACCTGCCGG - Exonic
1084399469 11:68935283-68935305 GGTCCACCTGAAACACCAGCCGG - Exonic
1084587487 11:70071055-70071077 TGTCCTCCTGGATCTCTTTCTGG + Intergenic
1086669323 11:89527937-89527959 TGTCCACCTGGAAAAGCTGCAGG + Intergenic
1086669769 11:89532225-89532247 TGTGCACCTGGAAAAACTGCAGG + Intergenic
1086729834 11:90235273-90235295 TGTCCACCTGGAGTTCCAGCTGG - Intergenic
1087480449 11:98693514-98693536 TGTGCACCTGGAAAATCTGCAGG + Intergenic
1087807249 11:102568625-102568647 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1089809422 11:121119445-121119467 TGTCCACCTGGATTTCAAGCAGG + Intronic
1091260379 11:134229419-134229441 TGTCCACCGGGATACCCTACAGG + Intronic
1091282906 11:134391968-134391990 GGTCCCCGTGGAGCACCTGCCGG - Exonic
1091617124 12:2057994-2058016 AGTCTGCCTGGATCTCCTGCTGG + Intronic
1092073437 12:5652800-5652822 TGTCAACCTTGATCTCCTGGTGG + Intronic
1092108689 12:5944147-5944169 TGTCACCCTGGCTCAGCTGCTGG - Intronic
1092682896 12:11007375-11007397 ATTCCACCTGGATGACCTTCTGG - Intronic
1092688503 12:11078989-11079011 ATTCCACCTGGATGACCTCCTGG - Intronic
1094667280 12:32533267-32533289 TGTGCACTTGAATCACCTACTGG - Intronic
1094822195 12:34234852-34234874 TGACCACATGCATCACCTGGGGG - Intergenic
1095292415 12:40490858-40490880 TGGACACCTGGACCATCTGCTGG + Exonic
1095775408 12:46004363-46004385 TGGCCACCTGGACCACCTCAAGG - Intergenic
1096233269 12:49909426-49909448 TCTCCACCTGGATGTCCTACAGG - Intergenic
1096263549 12:50107177-50107199 TGTCCCCCTGGACCACCTCCTGG - Intronic
1097444020 12:59646703-59646725 TGTGCACCTGGAAAAGCTGCAGG + Intronic
1098652758 12:72993621-72993643 TGTTGACCTTGATCACCTGGAGG + Intergenic
1099459487 12:82905128-82905150 TTTCCACCTGGGTGATCTGCCGG + Intronic
1100166640 12:91924205-91924227 TGCCCACCTGGAACTCCAGCTGG + Intergenic
1100392628 12:94157223-94157245 AATCCACCTGCAGCACCTGCTGG - Intronic
1100861459 12:98811290-98811312 TGTCCCCCTGGGTCCCCTTCAGG - Intronic
1101961261 12:109252093-109252115 TCTCCACCTGGATCACTCGCTGG - Exonic
1102164402 12:110795033-110795055 TGGCCAACTGGGTCACCAGCTGG + Intergenic
1102178904 12:110896854-110896876 TGTGCACCAGGATCACCGGGAGG + Intronic
1102429390 12:112870033-112870055 TGCCCATCTTGCTCACCTGCTGG - Exonic
1103486628 12:121287481-121287503 AGGCCACCTGGATCTCCTCCTGG - Intronic
1104456134 12:128913863-128913885 TGTCCAGCTGGATAAACTGGAGG + Intronic
1105678841 13:22705249-22705271 TGTCCACCAGGATCCACTGCTGG + Intergenic
1106220426 13:27742258-27742280 GCTCCAGCTGCATCACCTGCAGG + Intergenic
1108934782 13:55870691-55870713 TGCACACCTGGCTCAGCTGCAGG - Intergenic
1112135682 13:96575332-96575354 TGTCTACCTTGCTCACCTACTGG + Intronic
1112778675 13:102873337-102873359 GGTCCACCATGATTACCTGCTGG - Exonic
1113419152 13:110156419-110156441 TGTCCACATGGGCCTCCTGCGGG + Intronic
1114247871 14:20931845-20931867 TTTCCATTTGGATCACCTGGGGG + Intergenic
1114687091 14:24543581-24543603 GTTCCACCTGGCTCACCAGCCGG - Intergenic
1116542297 14:46113063-46113085 TGTGCACCTGGAAGAGCTGCAGG + Intergenic
1117641918 14:57809102-57809124 TGACCACATGGATCACTTGGAGG - Intronic
1119300347 14:73566649-73566671 TGCCCACCTGGAACTCCAGCTGG + Intergenic
1119829421 14:77687987-77688009 TCTCCACCTGGATACCCTACAGG + Intronic
1120389543 14:83888485-83888507 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
1121258834 14:92551979-92552001 TGTCCACCTGCACCTCCTTCAGG - Intronic
1122221118 14:100239544-100239566 TCTGCACCAGGATCACCTCCTGG - Exonic
1122662807 14:103309375-103309397 TCTCCCTCTGGACCACCTGCTGG - Intergenic
1123408693 15:20040798-20040820 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
1123518024 15:21047508-21047530 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
1124577770 15:30924882-30924904 TGTCCACCTGGATTACAGCCCGG + Intronic
1125519371 15:40339604-40339626 GGTCCTCCTGGATCTCCTGTGGG + Exonic
1126663293 15:51052951-51052973 TGCTCACCAGGATCACATGCTGG + Intergenic
1126684469 15:51235278-51235300 TGTGCAGCAGAATCACCTGCAGG + Intronic
1128457633 15:67841194-67841216 TGTCTGCCTGGCTCCCCTGCTGG - Intergenic
1130380518 15:83368193-83368215 TGTCCATCAACATCACCTGCAGG - Intergenic
1130896258 15:88172689-88172711 TGGCCACGTGCCTCACCTGCTGG - Intronic
1133045726 16:3087350-3087372 TGTCCAGCTGTTTCCCCTGCTGG - Intergenic
1133303742 16:4797800-4797822 TGTGCACGTGGCTCACCTCCAGG + Exonic
1135019053 16:18948278-18948300 TGCCCACTTGAATCACCTGCGGG + Intergenic
1136684054 16:31983859-31983881 TGTCTTCCTGGACCACCTCCAGG + Intergenic
1136784680 16:32927411-32927433 TGTCTTCCTGGACCACCTCCAGG + Intergenic
1136885103 16:33926395-33926417 TGTCTTCCTGGACCACCTCCAGG - Intergenic
1136928443 16:34396664-34396686 TGTGCACCAGGATCACCTAGAGG - Intergenic
1136976131 16:35015140-35015162 TGTGCACCAGGATCACCTAGAGG + Intergenic
1139062103 16:63264352-63264374 TGTCCACCTGGATATCCAGTTGG + Intergenic
1139475156 16:67199380-67199402 GGTCCAGCTGGATGAGCTGCGGG - Exonic
1140632934 16:76875487-76875509 TCTCCAACTGGATTATCTGCAGG - Intergenic
1203087338 16_KI270728v1_random:1191417-1191439 TGTCTTCCTGGACCACCTCCAGG + Intergenic
1143411291 17:6711021-6711043 TCTCCACCTGGATTCCCTCCTGG - Intronic
1144386339 17:14751950-14751972 TCTCCACTTGGCTCCCCTGCTGG + Intergenic
1145023794 17:19452686-19452708 TGTTCACCTGGGAGACCTGCTGG - Intergenic
1148947610 17:51278206-51278228 TGTGCACGTGAATCACCTGGGGG + Intronic
1149141502 17:53437560-53437582 TGCACACCTGGATCCCCTACTGG - Intergenic
1151350337 17:73528100-73528122 GTTCCACCTGGATAACCAGCTGG - Intronic
1152413057 17:80139883-80139905 TTTGCACCTGGGTCACTTGCAGG - Intronic
1152829971 17:82491137-82491159 GGTCAGCCTGGATCACCAGCGGG - Intergenic
1154105004 18:11515217-11515239 TGTCCACATGGATCATGGGCAGG - Intergenic
1154178324 18:12105459-12105481 TGTGCACCTGGAAAAGCTGCAGG - Intronic
1154178597 18:12109014-12109036 TGTGCACCTGGAAAAGCTGCAGG - Intronic
1155111482 18:22719724-22719746 TGTGCATCAGAATCACCTGCAGG - Intergenic
1156027679 18:32674276-32674298 TGTCAACATAGATCACATGCAGG + Exonic
1156863630 18:41865802-41865824 TGCCCACCTGGAACTCCAGCTGG - Intergenic
1156912663 18:42429028-42429050 TGACCACCTAGATCACCAGGGGG + Intergenic
1157309602 18:46542397-46542419 TGTGCAACAGGATCACCTGGGGG - Intronic
1157688140 18:49659482-49659504 TGTTAACCTTGATCACCTGGCGG + Intergenic
1158015036 18:52774251-52774273 TGTGCACCAGAATCACCTGAAGG - Intronic
1160679954 19:408016-408038 TCTCGATCTGGATCACGTGCCGG + Exonic
1161327489 19:3670729-3670751 GGGCCACCTGGATGCCCTGCAGG + Intronic
1161554464 19:4932819-4932841 TGACCACCTGGCCCACCTCCAGG - Exonic
1161959754 19:7516767-7516789 TGGACCCCTGGATCACCTCCAGG - Intronic
1162497846 19:11033418-11033440 TGCCGGCCTGGATCACCTTCTGG - Exonic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1166231042 19:41425995-41426017 TGCCCTGCTGGCTCACCTGCGGG - Exonic
1167492061 19:49798742-49798764 TGCCCACCTGGCACACCTGCTGG - Intronic
925391846 2:3500586-3500608 TGTCCACCAGGATCGCAGGCAGG + Intronic
926001793 2:9339226-9339248 TCTCCACCAGCCTCACCTGCTGG - Intronic
926051196 2:9745968-9745990 TGACCACGTGGATCACGTCCCGG + Intergenic
926776956 2:16432361-16432383 TGACCAACTGGATCAGATGCTGG + Intergenic
927079083 2:19610029-19610051 TGTGTATCTGGATCACCTACAGG + Intergenic
927417194 2:22891627-22891649 TGGCCACCTTGCTGACCTGCAGG - Intergenic
928388092 2:30886412-30886434 TGCCCACCTGGAGCAGCTGCTGG + Intergenic
928701566 2:33903827-33903849 TGCCCACCTGGAACTCGTGCTGG + Intergenic
930486646 2:52018665-52018687 TGTCCACCATGATCATCTACAGG + Intergenic
932278496 2:70469638-70469660 TGTGCATCAGGATCACCTGCAGG - Intronic
932474168 2:71991064-71991086 TATGCACCTGGGTCACCTTCTGG - Intergenic
936501595 2:113070949-113070971 TGCCCATCTGCATCACCTGGGGG - Intronic
938672213 2:133597325-133597347 CATCCATCAGGATCACCTGCAGG - Intergenic
939548217 2:143580459-143580481 TTTCCACCTCGATGACTTGCCGG + Intronic
939552254 2:143629346-143629368 AATCCAACTGGGTCACCTGCAGG + Intronic
940505387 2:154546910-154546932 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
941131112 2:161651342-161651364 TCTCCACCTGGCTCACCCTCCGG + Intronic
943108729 2:183579808-183579830 TGATTACATGGATCACCTGCCGG - Intergenic
943164695 2:184306065-184306087 TGTCCCCCTGGAACATCTCCAGG + Intergenic
943835132 2:192508013-192508035 TGCCCACCTGGAACTCCAGCTGG - Intergenic
945900709 2:215534373-215534395 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
947974655 2:234355294-234355316 TTTCCACCTGGATGAGCTGCAGG + Intergenic
948259977 2:236596512-236596534 TGCCAACCTGGCTCACCTCCTGG - Intergenic
1169488431 20:6052493-6052515 CGGCCACCTGGAGCAGCTGCAGG - Exonic
1169785454 20:9354851-9354873 TGTGCATTTGGATCACCTGGGGG - Intronic
1170008492 20:11694819-11694841 TGTCCATCAGAATCACCTGGAGG + Intergenic
1171196596 20:23204782-23204804 TGTCCTTCTAGACCACCTGCGGG + Intergenic
1172195513 20:33089114-33089136 TGTCCCTCTGGGTTACCTGCAGG - Intronic
1173563136 20:44020559-44020581 TGTCTTGCTGGATCCCCTGCTGG - Intronic
1173907197 20:46637875-46637897 TGTCCCCCTGAATCACCTCCTGG - Intronic
1175182221 20:57156668-57156690 TGGCTGCCTGGACCACCTGCAGG - Intergenic
1175805586 20:61826772-61826794 TGCCCACCTTGCTCACCTGGTGG + Intronic
1177187077 21:17808566-17808588 TGTGCACCTGGAAAAGCTGCAGG + Intronic
1177871778 21:26581764-26581786 TGTGCATCAGAATCACCTGCAGG + Intergenic
1178356454 21:31913605-31913627 TCTCCACCTGGATAATCTGTGGG - Intronic
1179328346 21:40373291-40373313 TGACCACCTATAACACCTGCTGG - Intronic
1180048390 21:45320265-45320287 AGTGCACCTGGGCCACCTGCAGG - Intergenic
1183000232 22:34850841-34850863 AGTCCACCTGGAGCACAGGCTGG + Intergenic
1184431616 22:44444478-44444500 GCTCCACCTTGGTCACCTGCAGG + Intergenic
1185376160 22:50483512-50483534 ACTCCACCTGGATCCCCTGTAGG + Exonic
950695906 3:14701095-14701117 AGGCCACCTGGAGCATCTGCTGG - Intronic
950767180 3:15281509-15281531 TGGCCACCTGGTTCTTCTGCTGG - Intronic
952771263 3:37003200-37003222 TGTCCACTTGGCTCCACTGCTGG + Intronic
953412373 3:42697664-42697686 GCTCCACCTGGCTCACCTGGGGG + Exonic
954081477 3:48214594-48214616 TGTGCATCAGAATCACCTGCAGG + Intergenic
954745706 3:52786443-52786465 TGCCCACCTGGGGCAGCTGCAGG - Intronic
955833199 3:63026421-63026443 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
956135098 3:66090501-66090523 TGTGCATATGGATCACCTGGGGG - Intergenic
956664680 3:71631344-71631366 TATTCACCTGGATATCCTGCAGG + Intergenic
956999570 3:74869536-74869558 TTTGCAGCTGGATCACCTGTGGG + Intergenic
957074061 3:75587844-75587866 TGCCCACCTGGAACTCCAGCTGG - Intergenic
957114791 3:76011306-76011328 AGTCCACCTGAATCACGGGCTGG - Intronic
957866845 3:86036557-86036579 TGTCCACCTGAAGGACCTCCAGG + Intronic
958469433 3:94498886-94498908 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
959323314 3:104906182-104906204 TGTCCACCTGGAACTCGTGATGG - Intergenic
959422712 3:106148672-106148694 TGCCCACCTGGAACTCCAGCTGG - Intergenic
959803007 3:110517704-110517726 TTTAAAACTGGATCACCTGCTGG + Intergenic
960029637 3:113044341-113044363 TGCACACCAGGAACACCTGCTGG + Intergenic
963554636 3:146772391-146772413 TGGCCACCTGGAACTCGTGCTGG - Intergenic
964439053 3:156685892-156685914 TCTACACCTTGATCAGCTGCAGG - Intronic
966905806 3:184525397-184525419 AGTCCCCGAGGATCACCTGCGGG - Intronic
968177360 3:196562581-196562603 TGTACATCAGGATCACCTGGAGG - Intronic
968613058 4:1565747-1565769 TGTCCCCATGGGGCACCTGCGGG - Intergenic
969154986 4:5202408-5202430 TGTGCACCTGGAAAAGCTGCAGG - Intronic
969298902 4:6285690-6285712 TGTACACCTGGGTCATCTGAAGG + Intronic
969365870 4:6694064-6694086 TGCCGGCCTGGCTCACCTGCAGG - Exonic
970032521 4:11692818-11692840 AGTCCCAGTGGATCACCTGCTGG + Intergenic
971209615 4:24603109-24603131 TGTTTACCTGGAACAACTGCAGG - Intergenic
976461151 4:85314311-85314333 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
976813657 4:89122637-89122659 TGTCCACCTGGAGTACTAGCTGG - Intergenic
976842248 4:89445327-89445349 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
978809062 4:112830852-112830874 TGCCCACCTGGAACCCGTGCTGG - Intronic
980168099 4:129252609-129252631 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
980463895 4:133150446-133150468 TCTCCACCTGGAACAGCTCCAGG - Exonic
981503062 4:145473217-145473239 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
982038498 4:151371036-151371058 TGTGCACCAGAATCACCTGGAGG - Intergenic
985779893 5:1865018-1865040 CCTCCACCTGGAGAACCTGCAGG + Intergenic
985798657 5:1985878-1985900 AGTCCACCTGGAGCATCTGCTGG - Intergenic
986044648 5:4025359-4025381 TGTGCACCAGGATCACCTGCAGG + Intergenic
986533241 5:8760758-8760780 TGTGCACCTGGAAAAACTGCAGG + Intergenic
987003827 5:13688898-13688920 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
987218572 5:15765774-15765796 TCTCTGCCTGGATCACCTTCGGG + Intronic
987978812 5:25053207-25053229 TGGCCACCTGGATCTCCTGTGGG - Intergenic
988579753 5:32458667-32458689 TGTACACCTGGAAAAGCTGCAGG - Intergenic
989817195 5:45750783-45750805 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
989997279 5:50850539-50850561 TTTCCAGCTCTATCACCTGCAGG + Intergenic
990012260 5:51013660-51013682 TGTGCATCAGAATCACCTGCAGG + Intergenic
991198279 5:63960831-63960853 GGTGCACCTCGATCACCTCCAGG + Exonic
993320959 5:86466995-86467017 TGCCCACCTGGAACTCCAGCTGG + Intergenic
995893463 5:116983794-116983816 TGTCAACCTGGAGCATCTACTGG - Intergenic
997046990 5:130330538-130330560 TGTACACCTGGAAAAGCTGCAGG + Intergenic
997274575 5:132573999-132574021 TGTGCACCTGGAAAAACTGCAGG - Intronic
998518902 5:142782230-142782252 TCTCCACCTGCATGCCCTGCAGG - Intronic
1001251885 5:170152955-170152977 TGCCCACCTGGCCCACATGCTGG + Intergenic
1002198389 5:177513346-177513368 TGCCCACCTGGATGACATCCAGG + Exonic
1005710566 6:28500252-28500274 TGGTCACCTGGAGCAACTGCAGG + Intergenic
1006025249 6:31142684-31142706 TGTCCTGCTCGATGACCTGCAGG - Exonic
1006147271 6:31967126-31967148 TGCTCACCTGGATCATGTGCTGG - Exonic
1006793312 6:36717369-36717391 TGTCCGCCTGGGCCTCCTGCAGG - Exonic
1007107059 6:39290896-39290918 TGTGCACCTGTATGACCTGGAGG - Intergenic
1010081904 6:71873305-71873327 TGTGGAGCTGAATCACCTGCTGG - Intergenic
1013010760 6:106117915-106117937 TCTCCACCCGGACCCCCTGCTGG - Intergenic
1014494755 6:122107457-122107479 TGCCCACTTGGCTTACCTGCAGG - Intergenic
1014769003 6:125440009-125440031 TCTCCACCTGTGTGACCTGCTGG + Intergenic
1016728317 6:147400809-147400831 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1017812551 6:157994534-157994556 TTTTCACCTGGACCACCTGGCGG + Intronic
1018469538 6:164083399-164083421 TGTCCAAGAGGACCACCTGCCGG + Intergenic
1018961808 6:168454858-168454880 TGTGCACCTGTAGCATCTGCTGG - Intronic
1019027822 6:168985934-168985956 CGTTCACCTTGATCACCTGGCGG - Intergenic
1020445510 7:8262573-8262595 TGGCCACGTGGAACACCTGCCGG - Intronic
1022115698 7:27258649-27258671 TGTACATCAGGATCACCTGGGGG - Intergenic
1022482885 7:30755485-30755507 TGTCCACCTGGGCAACCCGCTGG + Exonic
1022843523 7:34188520-34188542 TGTCCCACTGGAAAACCTGCAGG + Intergenic
1024083940 7:45878218-45878240 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1024384805 7:48738980-48739002 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
1024438525 7:49387989-49388011 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1024667309 7:51559646-51559668 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
1025146146 7:56505960-56505982 TGTGCATCTGGATCACTTGGAGG - Intergenic
1025262954 7:57433071-57433093 GGTGCATCTGGATCACTTGCGGG + Intergenic
1028382088 7:90211519-90211541 TATCCGCCTGGCTCCCCTGCGGG - Intronic
1029439392 7:100578679-100578701 TGTCCAGCAGAATGACCTGCAGG + Exonic
1029746232 7:102517196-102517218 TGTGCACCTGAAGCACATGCTGG - Intronic
1029764170 7:102616175-102616197 TGTGCACCTGAAGCACATGCTGG - Intronic
1030320958 7:108166851-108166873 TCTCCAGCTGGAGCACCTGGCGG + Intronic
1031396181 7:121277305-121277327 TCTCCACCTGGATGTCCTACAGG - Intronic
1031849106 7:126842203-126842225 TGTCCTCCTGGATCTACAGCTGG - Intronic
1032366813 7:131307446-131307468 TGTGCACCTGGAAAAGCTGCAGG + Intronic
1035653027 8:1282795-1282817 TGTCCAGATGGTTCACGTGCTGG - Intergenic
1035653071 8:1283026-1283048 TGTCCAGATGGTTCACGTGCTGG - Intergenic
1037001895 8:13729726-13729748 TGTCCACTTGGAAGACCTCCAGG + Intergenic
1040737681 8:50530170-50530192 TGGTCACTTGGAGCACCTGCAGG - Exonic
1041300831 8:56409721-56409743 TGTGCACCAGTATCACCTGCAGG - Intergenic
1041623528 8:59999910-59999932 TGCCCACCTGGAACTCGTGCTGG - Intergenic
1041954613 8:63543614-63543636 TGTCCACCTGGATCTTGGGCTGG + Intergenic
1043028442 8:75101455-75101477 TGTGCATCTGAATCACCTGGAGG - Intergenic
1043438901 8:80259867-80259889 TGGCCACCTTGGGCACCTGCAGG + Intergenic
1043642922 8:82479505-82479527 TGTGCACCAGAATCACCTGGAGG + Intergenic
1044627850 8:94251807-94251829 TGTCCATCTGGTCTACCTGCAGG - Intronic
1046781695 8:118222275-118222297 TGCCCACATGGATGTCCTGCAGG - Intronic
1046826144 8:118694422-118694444 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1047218739 8:122901309-122901331 TGTGCATCTGGATCACCTGGGGG + Intronic
1049930567 9:452296-452318 TGTGCATCAGGATCACCTGGAGG - Intronic
1052056691 9:23914728-23914750 TGTCCACCTGGAACTTGTGCTGG + Intergenic
1053478180 9:38396816-38396838 TGTCCACCTGAGGCCCCTGCTGG - Exonic
1054781362 9:69168941-69168963 TAACCACCCGGTTCACCTGCAGG - Intronic
1055594431 9:77850765-77850787 TGTCCACCTGTAAAAACTGCTGG + Intronic
1057824394 9:98360951-98360973 TGTCCACCTGGTCCAGCTCCAGG + Intronic
1057868454 9:98700118-98700140 TGTCTATCTTGATCACCTGTTGG + Intronic
1058147657 9:101429928-101429950 TTTCCACCTTGATCCTCTGCAGG + Exonic
1058191313 9:101919472-101919494 AGTCCACCTGGAACACAGGCTGG + Intergenic
1058287208 9:103193167-103193189 GGTCCACCTGGATCATGGGCTGG - Intergenic
1060055456 9:120409152-120409174 GGACCTCCTGGATCAGCTGCTGG + Exonic
1060244247 9:121930705-121930727 TGACCACCAGGACCACCTGATGG - Intronic
1061138523 9:128750648-128750670 GCACCACCTGGATAACCTGCCGG + Exonic
1061483798 9:130910166-130910188 TGCCCACCTGGAACTCCAGCTGG - Intronic
1061894442 9:133639872-133639894 GATCCACCTGGATCCCCAGCAGG + Exonic
1061913974 9:133739531-133739553 GGTCCTCCTGGATTCCCTGCTGG - Intronic
1062672481 9:137719738-137719760 TGTGCACGTGCATCACGTGCAGG + Intronic
1185748282 X:2589453-2589475 TGTCCACCTGGAGCAGATTCTGG - Intergenic
1189011392 X:37049001-37049023 TGTGCACCTGGAAAAGCTGCAGG + Intergenic
1189788759 X:44583590-44583612 TGTGCACCTGGAAAACTTGCAGG + Intergenic
1192186736 X:68952206-68952228 CGTCCACCTGGAACTCCAGCTGG - Intergenic
1192633218 X:72792635-72792657 TGTACACCAGGATCAGTTGCAGG + Intronic
1192648491 X:72928166-72928188 TGTACACCAGGATCAGTTGCAGG - Intronic
1194244347 X:91493172-91493194 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1194313208 X:92340265-92340287 TGTGCACCTGGAAAAGCTGCAGG - Intronic
1197717383 X:129719268-129719290 TGTGCACCAGCATCACCTGGAGG + Intergenic
1199193336 X:144997588-144997610 TGTACACCTGGAAAAGCTGCAGG + Intergenic
1199258858 X:145747952-145747974 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1200563326 Y:4734469-4734491 TGTGCACCTGGAAAAGCTGCAGG - Intergenic
1200621473 Y:5454379-5454401 TGTGCACCTGGAAAAGCTGCAGG - Intronic
1201406080 Y:13651932-13651954 TGTCCCACAGGAGCACCTGCCGG + Intergenic