ID: 1083758382

View in Genome Browser
Species Human (GRCh38)
Location 11:64803153-64803175
Sequence CCTGCCGGCCCGCCCGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 6, 3: 52, 4: 466}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083758382_1083758390 -3 Left 1083758382 11:64803153-64803175 CCGGCGCCGGGCGGGCCGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 466
Right 1083758390 11:64803173-64803195 AGGCGGGCGGGCGCGAGCTGCGG 0: 1
1: 0
2: 2
3: 46
4: 306
1083758382_1083758392 8 Left 1083758382 11:64803153-64803175 CCGGCGCCGGGCGGGCCGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 466
Right 1083758392 11:64803184-64803206 CGCGAGCTGCGGAGCCGGCGCGG 0: 1
1: 0
2: 3
3: 18
4: 152
1083758382_1083758393 9 Left 1083758382 11:64803153-64803175 CCGGCGCCGGGCGGGCCGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 466
Right 1083758393 11:64803185-64803207 GCGAGCTGCGGAGCCGGCGCGGG 0: 1
1: 0
2: 2
3: 32
4: 215
1083758382_1083758394 10 Left 1083758382 11:64803153-64803175 CCGGCGCCGGGCGGGCCGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 466
Right 1083758394 11:64803186-64803208 CGAGCTGCGGAGCCGGCGCGGGG 0: 1
1: 0
2: 1
3: 24
4: 168
1083758382_1083758400 23 Left 1083758382 11:64803153-64803175 CCGGCGCCGGGCGGGCCGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 466
Right 1083758400 11:64803199-64803221 CGGCGCGGGGCGGCGCGGGGCGG 0: 4
1: 14
2: 210
3: 527
4: 1862
1083758382_1083758397 19 Left 1083758382 11:64803153-64803175 CCGGCGCCGGGCGGGCCGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 466
Right 1083758397 11:64803195-64803217 GAGCCGGCGCGGGGCGGCGCGGG 0: 1
1: 0
2: 13
3: 134
4: 1010
1083758382_1083758398 20 Left 1083758382 11:64803153-64803175 CCGGCGCCGGGCGGGCCGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 466
Right 1083758398 11:64803196-64803218 AGCCGGCGCGGGGCGGCGCGGGG 0: 1
1: 0
2: 12
3: 111
4: 888
1083758382_1083758396 18 Left 1083758382 11:64803153-64803175 CCGGCGCCGGGCGGGCCGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 466
Right 1083758396 11:64803194-64803216 GGAGCCGGCGCGGGGCGGCGCGG 0: 1
1: 0
2: 17
3: 180
4: 985
1083758382_1083758402 25 Left 1083758382 11:64803153-64803175 CCGGCGCCGGGCGGGCCGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 466
Right 1083758402 11:64803201-64803223 GCGCGGGGCGGCGCGGGGCGGGG 0: 2
1: 22
2: 263
3: 726
4: 2461
1083758382_1083758403 28 Left 1083758382 11:64803153-64803175 CCGGCGCCGGGCGGGCCGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 466
Right 1083758403 11:64803204-64803226 CGGGGCGGCGCGGGGCGGGGCGG 0: 3
1: 138
2: 269
3: 858
4: 3242
1083758382_1083758401 24 Left 1083758382 11:64803153-64803175 CCGGCGCCGGGCGGGCCGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 466
Right 1083758401 11:64803200-64803222 GGCGCGGGGCGGCGCGGGGCGGG 0: 3
1: 16
2: 273
3: 730
4: 2674
1083758382_1083758404 29 Left 1083758382 11:64803153-64803175 CCGGCGCCGGGCGGGCCGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 466
Right 1083758404 11:64803205-64803227 GGGGCGGCGCGGGGCGGGGCGGG 0: 4
1: 183
2: 357
3: 1217
4: 4200
1083758382_1083758395 13 Left 1083758382 11:64803153-64803175 CCGGCGCCGGGCGGGCCGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 466
Right 1083758395 11:64803189-64803211 GCTGCGGAGCCGGCGCGGGGCGG 0: 1
1: 0
2: 2
3: 60
4: 514
1083758382_1083758391 3 Left 1083758382 11:64803153-64803175 CCGGCGCCGGGCGGGCCGGCAGG 0: 1
1: 0
2: 6
3: 52
4: 466
Right 1083758391 11:64803179-64803201 GCGGGCGCGAGCTGCGGAGCCGG 0: 1
1: 1
2: 2
3: 35
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083758382 Original CRISPR CCTGCCGGCCCGCCCGGCGC CGG (reversed) Exonic
900134078 1:1106871-1106893 CCTGCCGGCACCCCCGGCCCTGG + Intronic
900164034 1:1237622-1237644 CCTGCCTGCCCGGCCGGCCCTGG - Intergenic
900204357 1:1425805-1425827 GCTGCAGCCCCGCCCGGCACAGG + Intergenic
900207004 1:1435905-1435927 CCCGCCCGCCCGTCCGGAGCAGG - Intronic
901448075 1:9320073-9320095 CCTGGCGGCCTGCCCTGAGCAGG - Intronic
901540094 1:9910103-9910125 CCTGCCGGCCCGGCCGGGTCGGG - Exonic
901676470 1:10888737-10888759 CCTGCCCCACCCCCCGGCGCGGG + Intergenic
902072180 1:13749499-13749521 CCGGCCCGCCCGCCCGGCCCCGG + Intronic
902509524 1:16958633-16958655 GCTGCAGGGCCGCCTGGCGCTGG + Exonic
902585781 1:17438099-17438121 CCCGGCGGCCGGGCCGGCGCAGG - Intronic
903184335 1:21620706-21620728 CCTGCCGGCTGGCCCGGCTCGGG + Intronic
903438415 1:23369275-23369297 CCTGAAGGCCCGCCCGGATCAGG - Exonic
903624598 1:24721622-24721644 CCGGCCGGCCCCACCGGCCCTGG + Intergenic
903652737 1:24931312-24931334 ACTGCCTGCCCGCCCGGCTCCGG + Intronic
905038057 1:34929988-34930010 CCCGACCGCCCGCCCGCCGCCGG - Intergenic
905887982 1:41501958-41501980 CCCGCCTGCCCGCCCGCCCCAGG + Intergenic
905912119 1:41662288-41662310 GCTGGCGGCCCACGCGGCGCGGG + Intronic
906027089 1:42682792-42682814 CCCGCCGGCTCGCCCAGCTCCGG - Intronic
906637204 1:47417277-47417299 GGTGCCTGCCCGCGCGGCGCAGG - Exonic
907920122 1:58904036-58904058 CCTCCCGGCCCGCCAGGCTGAGG + Intergenic
910034777 1:82777044-82777066 CCAGCCGGCCCTGCCGGCCCCGG - Intergenic
911039365 1:93579635-93579657 CCTGCCTGCCCGCCCTTGGCAGG - Intronic
911259611 1:95669890-95669912 CCGGCCGGCCCTGCCGGCTCCGG - Intergenic
912819387 1:112854776-112854798 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
913144599 1:115976748-115976770 TCTTCAGGGCCGCCCGGCGCAGG + Intronic
914171842 1:145232914-145232936 TCTGCCCGCCCGCCCCGCGCGGG + Intergenic
916940062 1:169668152-169668174 CCGGCCGGCCCCACCGGCCCTGG + Intronic
917964003 1:180167111-180167133 CCTGCCAGCCTGCCCAGTGCAGG + Intronic
919091889 1:192987008-192987030 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
919174459 1:194001939-194001961 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
920309993 1:205043316-205043338 GCTGGCGGCCCGGCCGGCCCCGG + Exonic
921396398 1:214673409-214673431 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
921903852 1:220475932-220475954 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
921983687 1:221285921-221285943 CCGGCCGGCCCTGCCGGCCCGGG - Intergenic
922648755 1:227318601-227318623 CCGGCCGGCGCGCCCAGCGGAGG + Intergenic
922730495 1:227946785-227946807 CCGGCCAGCCCGCCGCGCGCTGG + Intronic
922730843 1:227948093-227948115 CCGGCCGCCGCTCCCGGCGCGGG + Intergenic
922855782 1:228773803-228773825 CCAGCCGGCCCTGCCGGCCCGGG + Intergenic
923193459 1:231642168-231642190 CCGGCCGGCCCCGCCGGCCCCGG - Intronic
923573803 1:235140391-235140413 CCTGCAGGCCCTGCCGGCCCCGG + Intronic
1063929807 10:11017899-11017921 GCAGCCGGCCGCCCCGGCGCTGG + Intronic
1064230737 10:13528330-13528352 CCTGCCTGCCAGCCCGGCGGAGG + Intronic
1065367868 10:24952706-24952728 CCCGCCGGCGGGCCCGGGGCGGG - Intergenic
1065752177 10:28897039-28897061 CCGGCCGGCCCCACCGGCCCGGG - Intergenic
1066022782 10:31319595-31319617 CCCGGCCGCCCGCCCTGCGCCGG - Intronic
1067363179 10:45600840-45600862 CCTGCCGGCCCTGCCGCCCCGGG + Intergenic
1067406719 10:46030352-46030374 CCTGCCTGCCCGCCGGGCCCGGG - Intronic
1069018945 10:63465143-63465165 CCCACCTGCCCGCGCGGCGCCGG + Intronic
1069636069 10:69925751-69925773 CCTCCCGGCCCTCCCGGTCCAGG + Intronic
1069748989 10:70733820-70733842 CCTGCCTGCCTTCCCGGGGCAGG + Intronic
1069766129 10:70861741-70861763 CCGGCCGGCCCTGCCGGCCCCGG + Intronic
1070609992 10:77926567-77926589 CCTGCCCGCCCGCCGGCCTCGGG - Intergenic
1070954204 10:80454072-80454094 CCTCCCGGCCCGCGCGGCACCGG - Intergenic
1071603335 10:86969544-86969566 CCTGTCAGCCCCCCCGGGGCTGG + Intronic
1072784012 10:98268282-98268304 ACTCCAGGCCCGCCCGGGGCGGG - Intergenic
1073064622 10:100750672-100750694 CCCGCCGGCTTTCCCGGCGCAGG + Exonic
1074095043 10:110304567-110304589 CTCGGCGGCCCGGCCGGCGCTGG - Intronic
1074399084 10:113126892-113126914 CCTGCCCGCCCGCCCGCCGCCGG - Intronic
1075031930 10:119029711-119029733 CCTGCCCGCCGGCCTGCCGCGGG - Exonic
1075255608 10:120923922-120923944 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
1075375415 10:121974800-121974822 CCTCCCCCCGCGCCCGGCGCAGG + Intronic
1075485406 10:122818615-122818637 TCCGCCCGCCCGCCAGGCGCAGG - Intergenic
1075699833 10:124462051-124462073 CCTGCCGCCCCGCCCCCTGCCGG - Intronic
1076497610 10:130907220-130907242 CCTGCAGGCCCTCCTGGGGCCGG + Intergenic
1076659724 10:132047676-132047698 CCTCCCGTCCCGCCCCCCGCAGG + Intergenic
1076792874 10:132786091-132786113 CCCGCCCGCCCGCCCCGCGCCGG - Intergenic
1076834676 10:133015023-133015045 CCTGCAGGCCAGGCCGGCTCCGG + Intergenic
1076874040 10:133207304-133207326 CCTGCAGGCCGGCACGCCGCTGG + Exonic
1076920083 10:133446598-133446620 CCTCCCTGCCAGCCCGGCGTGGG - Intergenic
1077223432 11:1427284-1427306 CCTGCTGCCTCGCCCGGCCCAGG + Intronic
1077328362 11:1973298-1973320 CCCGCCTGCCAGCCCGGCCCTGG - Intronic
1077606671 11:3617031-3617053 CCTGCCGGCCCGGCTGGAACGGG + Intergenic
1077764580 11:5144512-5144534 CCGGCCGGCCCCACCGGCCCTGG + Intergenic
1078795809 11:14591159-14591181 CCGGCCGGCCCTGCCGGCCCTGG + Intronic
1078821996 11:14891941-14891963 CCTGGCGGCCCTCCCTGCCCGGG + Intronic
1079190988 11:18276356-18276378 CCGGCCGGCCCCACCGGCCCTGG - Intergenic
1079731767 11:23942541-23942563 CCGGCCGGCCCTGCCGGCCCTGG - Intergenic
1080496924 11:32829841-32829863 ACTGCCCGCCCGCTCGCCGCAGG + Intergenic
1082272105 11:50183370-50183392 CCAGCCGGCCCTGCCGGCCCTGG + Intergenic
1083457246 11:62787238-62787260 CCAGCCGCCCCGCCCGCCGGTGG + Exonic
1083758382 11:64803153-64803175 CCTGCCGGCCCGCCCGGCGCCGG - Exonic
1083862576 11:65430295-65430317 GCTGCCTGCCCGCCTGGCGCTGG + Intergenic
1083902998 11:65652693-65652715 CCTGGCCGCCCCCCCGGAGCCGG + Intergenic
1083922112 11:65786756-65786778 CCAGCCGGCCCGGCCCCCGCGGG - Intergenic
1084008688 11:66336101-66336123 CCCGCCTGCCTGCCCGCCGCTGG + Exonic
1084024755 11:66440996-66441018 CCGGCCGGCCCCACCGGCCCCGG - Intronic
1084210447 11:67619134-67619156 CCAGCCGGCCCTGCCGGCCCCGG + Intergenic
1085096018 11:73761117-73761139 CCTGCGGCCCCGCCGGCCGCTGG + Exonic
1085941114 11:81207692-81207714 CCGGCCGGCCCTGCCGGCCCAGG + Intergenic
1089666851 11:120025996-120026018 CCGGCCGGCCCTGCCGGCCCGGG + Intergenic
1090229209 11:125089594-125089616 CCGGCCGGCCCTTCCGGCCCCGG + Intronic
1091122022 11:133064754-133064776 ACTGCCGGCCCGCCCCGCGCCGG - Intronic
1202811340 11_KI270721v1_random:28477-28499 CCCGCCTGCCAGCCCGGCCCTGG - Intergenic
1091402253 12:188337-188359 CCTGCCGGCCCCGCCGGCCCGGG - Intergenic
1091888099 12:4031321-4031343 CTAGCCGGGCCGCCGGGCGCGGG - Intergenic
1092101699 12:5889110-5889132 CCAGCCGGCCCGCCGGCCGTGGG - Intronic
1092143713 12:6200732-6200754 GCGGCCGTCCCGCCCGGCTCTGG - Intronic
1092336665 12:7639937-7639959 CCGGCCGGCCCTGCCGGCCCGGG + Intergenic
1092350533 12:7752336-7752358 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1092472949 12:8794821-8794843 CCAGCCGGCCCTGCCGGCCCCGG + Intergenic
1093381557 12:18500244-18500266 CCGGCCGGCCCTGCCGGCCCGGG + Intronic
1093583264 12:20807617-20807639 CCGGCCGGCCAGCGCTGCGCTGG - Intergenic
1093958723 12:25250675-25250697 CCGCCGGCCCCGCCCGGCGCCGG + Intronic
1094338623 12:29386503-29386525 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1094536155 12:31324437-31324459 CCCGCCCGCACGCCCGGAGCGGG + Intronic
1094564972 12:31590984-31591006 CCTGCCTCCTCGCTCGGCGCGGG + Exonic
1094718207 12:33034194-33034216 CCGGCCGGCCCTGCCGGCTCCGG - Intergenic
1095465328 12:42483404-42483426 CCTGCAGCCCCTCGCGGCGCCGG + Intronic
1095533965 12:43224420-43224442 CCAGCCGGCCCCACCGGCCCCGG + Intergenic
1098168233 12:67719495-67719517 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1100211899 12:92406781-92406803 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1100600634 12:96109002-96109024 CCGGCCGGCCCCACCGGCCCCGG + Intergenic
1101640395 12:106582627-106582649 CCGGCCTGCCAGCACGGCGCGGG + Intronic
1101904570 12:108815021-108815043 CCTGGCGGGGCGCCCGGCACAGG + Intronic
1102008949 12:109606411-109606433 CCTGCCGCCCCGCCACCCGCAGG - Intergenic
1102310647 12:111842204-111842226 CCGGCGGGGCTGCCCGGCGCGGG + Intronic
1102679984 12:114684734-114684756 CCGCCCGGCTCGCCCGGGGCGGG - Intergenic
1103146160 12:118597438-118597460 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1103325294 12:120116486-120116508 CCCGCCCGCCCGCCCCGCACGGG + Intronic
1103668531 12:122592122-122592144 CCGGCCGGCCCTGCCGGCCCCGG + Intronic
1103853280 12:123947058-123947080 CCTGCCAGCCCTGCCGGCCCCGG + Intronic
1103932312 12:124457308-124457330 CCTGCAGGCCCTCCCCACGCTGG + Intronic
1104259053 12:127166122-127166144 CGGGCCGCCCCGCCCCGCGCTGG - Intergenic
1105557354 13:21459402-21459424 CCCGCCAGCCCGCCCGCCGCGGG + Intergenic
1106303909 13:28494318-28494340 CCTGCCAGGCTGCCCGGGGCTGG - Intronic
1106422621 13:29595902-29595924 GCAGCCCGCCCGCCCGCCGCGGG - Intergenic
1107307414 13:39037827-39037849 CCTGCCGGGCCGCCTGCTGCCGG - Exonic
1109563170 13:64077757-64077779 CCGGCCGGCCCCACCGGCCCCGG - Intergenic
1110368852 13:74718489-74718511 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
1110751407 13:79119883-79119905 CCAGCCGGCCCTGCCGGCCCGGG - Intergenic
1110792408 13:79600421-79600443 CCGGCCGGCCCTGCCGGCCCTGG - Intergenic
1111841427 13:93455048-93455070 CCGGCCGGCCCTGCCGGCTCCGG - Intronic
1111975963 13:94967803-94967825 GCTCCCGGCCGCCCCGGCGCCGG - Intergenic
1112494804 13:99896155-99896177 CCTGCTCGCCCGCCCGCCGCGGG + Exonic
1112518630 13:100077613-100077635 CCAGCCGGCCCTGCCGGCCCCGG + Intergenic
1113835458 13:113325877-113325899 CCTGGCGGCCCGCCCGCCCCAGG + Intronic
1113841276 13:113363123-113363145 CCTGACCGCCCGCCCGCCTCGGG - Intronic
1113885579 13:113656935-113656957 TCTGCCGCCCCGCCTGGCCCAGG + Intronic
1114559629 14:23580694-23580716 CCAGCTGGCCCCGCCGGCGCTGG + Intergenic
1115664758 14:35534502-35534524 CCTTCCCGCCCGCCCGTCCCCGG - Exonic
1117699193 14:58396209-58396231 CCTGCCTGCCCGGGCGCCGCGGG - Intronic
1117912569 14:60649198-60649220 CCTGCCGGGGCGCACGGCCCAGG + Exonic
1118030452 14:61812979-61813001 CCTGGCGGCGCGCCCCGCGAGGG + Intergenic
1118220865 14:63853449-63853471 CCCGCCGGTCCGCCCGGCTCGGG + Intronic
1119731946 14:76956664-76956686 CCTGCCCCCTCGCCCGCCGCGGG + Intergenic
1120704782 14:87735015-87735037 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1120844150 14:89111745-89111767 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
1120996035 14:90419472-90419494 CCTGCAGGCCCGCCTGGAGCAGG - Intergenic
1122316403 14:100828157-100828179 CATCCAGGCCCGCCGGGCGCGGG + Intergenic
1122399452 14:101458392-101458414 CCCGCCGGCCCGCCCGCCTGGGG - Intergenic
1124114871 15:26831442-26831464 CCAGCCGGCCCTGCCGGCCCCGG - Intronic
1124203763 15:27699921-27699943 CCTGCCTGCCTGCCAGGAGCCGG + Intergenic
1125535800 15:40440845-40440867 TCAGCCGCCCCGCCCTGCGCTGG - Intronic
1125736895 15:41933246-41933268 CCTGCCTGCCTGCCGGGCACAGG + Intronic
1126128062 15:45314190-45314212 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
1126767035 15:52019570-52019592 CCTGCCCGCCCGCTCGGGCCTGG + Intronic
1128987343 15:72231014-72231036 CCTGCCTGCGTGCCCGGGGCCGG + Exonic
1129777513 15:78246400-78246422 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1130132849 15:81158720-81158742 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
1130363058 15:83208041-83208063 CACTCCCGCCCGCCCGGCGCGGG - Intergenic
1131343123 15:91621465-91621487 CCTGCCTGCCCACCAGGCTCAGG - Intergenic
1132320068 15:100919293-100919315 CCTCCCCGCCCGCCCGCCTCAGG + Exonic
1132482302 16:172730-172752 CCCGCCGCCCGGCCCCGCGCAGG + Intergenic
1132483150 16:176534-176556 CCCGCCGCCCGGCCCCGCGCAGG + Intergenic
1132527776 16:426061-426083 CCGTCCGGCCCGCCCGGCTCCGG - Exonic
1132586040 16:706077-706099 CCTCCCCGCCCGCCGCGCGCCGG - Intronic
1132611992 16:821824-821846 CCTGCCGACCAGCCAGGAGCTGG + Intergenic
1132692754 16:1188925-1188947 CCTCCTGGCCCGCCAGGGGCTGG + Intronic
1132695918 16:1201959-1201981 TGTGCCTGCCTGCCCGGCGCTGG - Exonic
1132742345 16:1421097-1421119 CCTGCCCGCCTGCCCTGGGCTGG + Intergenic
1132789586 16:1678257-1678279 CGTTCCCGCCCGCCCAGCGCAGG - Exonic
1132875611 16:2135656-2135678 CGCGCCCGCCCGCCTGGCGCTGG - Exonic
1132936275 16:2482904-2482926 GCTTCCGGCCCTCCCGCCGCTGG - Intronic
1133020531 16:2964920-2964942 ACGGGCGGCCCGCCCCGCGCGGG - Exonic
1133346159 16:5071930-5071952 CATGCCGGGCCGCCCGCCCCCGG - Exonic
1134519375 16:14911697-14911719 CGCGCCCGCCCGCCTGGCGCTGG + Intronic
1134554558 16:15154531-15154553 CGCGCCCGCCCGCCTGGCGCTGG - Intergenic
1134554634 16:15154800-15154822 CCGTCCGCCCCGCGCGGCGCGGG - Intergenic
1134707045 16:16310352-16310374 CGCGCCCGCCCGCCTGGCGCTGG + Intergenic
1134960495 16:18401772-18401794 CGCGCCCGCCCGCCTGGCGCTGG - Intergenic
1135262136 16:20989903-20989925 CCGGCCGGCCCTGCCGGCCCCGG - Intronic
1136003557 16:27313828-27313850 CCGCCCGGCGCGCCCGGCCCGGG - Intronic
1136535021 16:30894112-30894134 CCTGCCGCCGCGCCCCGCCCCGG + Exonic
1136927520 16:34388609-34388631 CCAGCCCGCCCGCCCGTCCCTGG - Intergenic
1136977054 16:35023197-35023219 CCAGCCCGCCCGCCCGTCCCTGG + Exonic
1137738498 16:50742349-50742371 CCCGCGGGCCCGGCCGGCTCGGG - Intronic
1138450781 16:57092580-57092602 GCCGCCCGCCCGCCCGGCCCGGG + Exonic
1138693614 16:58791031-58791053 CCTGCCAGCCCTGCCGCCGCGGG - Intergenic
1139475238 16:67199615-67199637 CCTGCCCTCCCGCCCTCCGCAGG - Intronic
1139597718 16:67968134-67968156 CCGGCCGGGCCGCCCGGCTTGGG - Intronic
1141418975 16:83899402-83899424 ACTGCTGGGCCGCCTGGCGCGGG + Exonic
1142250327 16:88989038-88989060 CCTGCGGGCCCGCTGGGAGCTGG + Intergenic
1142261868 16:89046689-89046711 CCTGCCGGCCTGCCTGGCAAGGG - Intergenic
1142412472 16:89923578-89923600 CCGGCCGCCCGGCGCGGCGCTGG - Intronic
1142417189 16:89949134-89949156 GAGGGCGGCCCGCCCGGCGCAGG + Intronic
1142764183 17:2056483-2056505 CAGGCCGGCCCGCCCGGACCAGG - Intronic
1142860021 17:2755717-2755739 CATGGCGGGCCGCCGGGCGCCGG + Intergenic
1143030349 17:3964085-3964107 CCTGCCTCCCCACCCGGCTCTGG - Intronic
1143552731 17:7640978-7641000 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
1143731931 17:8886394-8886416 CCTGCTGGCTCTCCCGGGGCAGG + Intronic
1145979835 17:29005027-29005049 CCTGCCTTCCTGCCCGGCCCTGG - Intronic
1146057705 17:29589457-29589479 CCTGCTGCCCGGCCCGGCTCCGG + Exonic
1146339656 17:32007832-32007854 GCCGCCGGCCCGCCCCGCGCCGG + Intergenic
1147431805 17:40375932-40375954 CCTGCCGGCCCTGCTGGCCCCGG + Intergenic
1147989811 17:44325709-44325731 CGTCCCAGCCCGCCCGGCCCGGG - Intergenic
1147997519 17:44368921-44368943 CCAGCCGGCCCTGCCGGCCCCGG + Intergenic
1148016860 17:44528072-44528094 CCTGCCGGCCCTGCCGGCCCGGG + Intergenic
1149993961 17:61397308-61397330 CCTCGCGGGCCGCCCGGGGCTGG - Intergenic
1150124661 17:62628234-62628256 GCTCCCGGACCACCCGGCGCCGG + Intronic
1150772269 17:68051970-68051992 CCGGCCGGCCCTGCCGGCCCAGG + Intergenic
1150778266 17:68099380-68099402 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
1150786762 17:68169620-68169642 CCGGCCGGCCCTGCCGGCACTGG - Intergenic
1152114753 17:78378725-78378747 CCTGCCTGGCCGCCCAGGGCTGG + Exonic
1152750038 17:82058459-82058481 CCTGCTGGCCAGCCTGGCCCCGG - Intronic
1152781479 17:82229025-82229047 TCTGCCGGTCCGCTCCGCGCCGG - Intronic
1152801903 17:82334444-82334466 CCTGCCACCCCGCCAGGCGCCGG - Intergenic
1154303887 18:13217447-13217469 CCTCCGGGCCCGCCCCCCGCAGG + Intergenic
1156036612 18:32772109-32772131 CCCGCCGGCCCGCCCGCCCGGGG + Exonic
1156502236 18:37567031-37567053 CCTGCCCGCTCGCCCGCCGGAGG + Intergenic
1156863645 18:41865855-41865877 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
1157529323 18:48408760-48408782 CCTGCGGGCCCGAGCGGGGCGGG - Intronic
1158697276 18:59714355-59714377 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1159230783 18:65605352-65605374 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
1160703822 19:519890-519912 CCTCCAGCCCCGCCCGGCCCAGG + Intergenic
1160706176 19:531370-531392 CCCGCGGCCCCGCCCCGCGCCGG + Intergenic
1160817142 19:1041447-1041469 GCTGCCTGCCCACCCGGCCCTGG - Intronic
1160823174 19:1067611-1067633 CCTGCCGTCCCGCCCGGTAGGGG - Intronic
1160991699 19:1862905-1862927 CCTGCCGGCCGGCGCGGCGGCGG + Intronic
1161065895 19:2237071-2237093 CCTCCAGGCCCGCCCAGCGCGGG - Intronic
1161069013 19:2251261-2251283 CCTGTCGGACCCCGCGGCGCTGG + Exonic
1161210333 19:3062358-3062380 CCTCCCCGCGCGCCCGGCCCCGG + Intronic
1161219865 19:3113580-3113602 CCTGCCTGCTCGCCGGGGGCAGG + Intronic
1161238074 19:3207763-3207785 CCTGCAGGGCCGCCCGCGGCGGG - Exonic
1161265393 19:3361233-3361255 CCTGCCGCCCCGCCCCTCTCGGG - Intronic
1161307846 19:3577496-3577518 CCTACCGGCCCCACCGTCGCTGG + Intronic
1161343294 19:3754160-3754182 CCCGCCTGCCCGCCCGGCCCCGG + Intronic
1161407995 19:4101185-4101207 CCTGCCGGCCCCCGGGGCTCTGG + Intronic
1161610427 19:5238967-5238989 CCTGGCGGCCCGCTCGCCGCAGG - Exonic
1161699164 19:5785511-5785533 CCTGCCCGCCCACCCGCCGCAGG - Exonic
1161723360 19:5915478-5915500 CCTGCCGGTCCACCAGGCGGAGG + Exonic
1161802655 19:6424589-6424611 CCGCCGGGCCCGCCAGGCGCGGG - Exonic
1162486086 19:10961260-10961282 GCTGCCGGCGCGCCCTGTGCGGG + Intronic
1162759630 19:12881044-12881066 CCTGCCGTCCCGCCAGCCTCCGG + Exonic
1163027046 19:14518478-14518500 CCCGCCCGCCCCCGCGGCGCCGG + Intronic
1164992103 19:32692053-32692075 CCCGCCGTCGCGCCCGCCGCCGG + Exonic
1165329732 19:35134777-35134799 CCTGCTGGCACGCTCGGCCCTGG + Exonic
1165415540 19:35691321-35691343 CCGGCCGGCCCCGCCGGCCCCGG - Intergenic
1165767805 19:38361870-38361892 CAGGCCTGCCCGCCCGCCGCCGG - Intronic
1167145933 19:47680884-47680906 GCGGCCGGCCCGGCGGGCGCTGG - Exonic
1167391221 19:49196476-49196498 CCGGACGGCCCGACTGGCGCGGG - Exonic
1167501449 19:49851019-49851041 CCTGCGGGCCTCTCCGGCGCGGG - Intronic
1168078492 19:53992934-53992956 CCTGCCCGTGCGCCCGCCGCCGG - Exonic
1168247041 19:55117601-55117623 CCCGCCCGCCCGCCCGCCCCGGG + Intergenic
1168337653 19:55605584-55605606 CCTGCCCGCCCGCCCGGAAGCGG - Intronic
925537823 2:4935576-4935598 CCGGCCGGCCCTGCCGGCTCCGG - Intergenic
926090103 2:10043907-10043929 GCCGCCGCCCCGCCCGGCTCCGG - Intronic
926166889 2:10526603-10526625 CCTGCCTGCCCGCCTGCTGCGGG + Intergenic
926301907 2:11610928-11610950 CGTGCGGGCCCGGCTGGCGCTGG + Exonic
926444542 2:12926772-12926794 CCGACCGGCCCTACCGGCGCCGG - Intergenic
927591367 2:24360579-24360601 GCTGACGGCCCGCCCGCTGCCGG + Exonic
927645105 2:24872608-24872630 CCTGGAGGCCCGCCAGTCGCTGG - Exonic
927900418 2:26814568-26814590 CCGGCCGGCCCTGCCGGCGCCGG + Intergenic
927942198 2:27111730-27111752 CCGGCCGGCCCCGCCGGCCCCGG - Intronic
928511995 2:32010731-32010753 CCAGCCCGGCCGCCCGCCGCCGG + Intronic
929070044 2:38020610-38020632 CCAGCCGGCCCTGCCGGCCCAGG + Intronic
930485492 2:52006897-52006919 CCGGCCGGCCCTGCCGGTGCCGG + Intergenic
931517219 2:63056959-63056981 CATCCCGCCCCGCCCTGCGCTGG + Exonic
931708677 2:64969102-64969124 CCGGCCAGCCCTGCCGGCGCCGG + Intergenic
932440371 2:71731085-71731107 CCCGCAGGGGCGCCCGGCGCCGG - Intergenic
933487271 2:82938707-82938729 CCGGCCGGCCCTGCCGGCCCGGG - Intergenic
933684728 2:85133746-85133768 TCCGCCGGCCGCCCCGGCGCTGG - Exonic
934085117 2:88503236-88503258 CCGGCCGGCCCCTCCGGCCCGGG + Intergenic
934754698 2:96816874-96816896 GCTGCTGGCCAGCCTGGCGCAGG + Exonic
935046884 2:99490325-99490347 CCTGCCCGCCCGTCCTGCTCCGG + Intergenic
935371829 2:102355800-102355822 CCTGCCCAGCCGCGCGGCGCGGG - Intronic
935896869 2:107747601-107747623 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
937181126 2:119997081-119997103 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
937596834 2:123683871-123683893 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
937950936 2:127387648-127387670 CCCGCCACCCCGCCCGGCCCGGG - Intronic
938401013 2:130991543-130991565 CCGGCCGGCCCTGCCGGCCCCGG + Intronic
938817630 2:134919649-134919671 CCTGCCGCCCCACCCCCCGCGGG + Intronic
938931215 2:136088285-136088307 CCAGCCGGCCCTGCCGGCCCGGG - Intergenic
939053231 2:137331870-137331892 CCGGCCGGCCCCGCCGGCCCCGG - Intronic
939229742 2:139410438-139410460 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
939738793 2:145881162-145881184 TCTGCCGGCCCCGCCGGCCCGGG - Intergenic
939898925 2:147827038-147827060 AGTGCCGGCCCACCTGGCGCTGG + Intergenic
941309234 2:163909620-163909642 CCTGCCGGCCCTACCGGCCCCGG + Intergenic
941712138 2:168725160-168725182 CCGGCCGGCCCTGCCGGCCCTGG - Intronic
942452448 2:176116647-176116669 CCGGCCGGCCGGCCAGGCTCTGG + Exonic
942459047 2:176157144-176157166 CCGGCCGCCCAGCCCGGCGCGGG - Intronic
942867273 2:180691485-180691507 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
943680359 2:190761217-190761239 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
945225826 2:207530329-207530351 GCTGCCGCCCCGGCCGCCGCTGG - Intronic
945431578 2:209771744-209771766 CCGGCCGTGCAGCCCGGCGCGGG + Intergenic
946329148 2:219000090-219000112 CCTGCAGGCCTGCCCGGCACTGG + Intergenic
948449128 2:238058116-238058138 CCAGCCGGCCCCGCCGGCCCCGG - Intronic
948605875 2:239134425-239134447 CCTGCTGGCCCGCCGTGCCCTGG + Exonic
1168812938 20:718004-718026 CCTGCCTCCACGCCCAGCGCTGG - Intergenic
1168955707 20:1832819-1832841 CCTGCAGGGCCACCCGGAGCTGG + Intergenic
1169129681 20:3159659-3159681 CCTCCCGGCCGGCCCAGAGCTGG - Intronic
1169266874 20:4172377-4172399 CCTCCCCGCCCGCCCCGTGCAGG + Intronic
1170806864 20:19639892-19639914 CCAGCCGGCCCTGCCGGCCCAGG - Intronic
1170898376 20:20436879-20436901 CCTGGCCGCCCGCCCGTGGCAGG - Intronic
1170930890 20:20768615-20768637 ACTGCCGGCCCGCCCGCGCCAGG + Intergenic
1171361518 20:24589611-24589633 CCCTCGGGCCTGCCCGGCGCAGG - Intronic
1172118536 20:32584927-32584949 GCCGCCGGGCCGCCCGGTGCCGG + Intronic
1172703024 20:36863966-36863988 CCTGCCCGGACGCCGGGCGCAGG - Intergenic
1173868566 20:46328369-46328391 CCTGCCGGCCCGCCCTGGGCTGG + Intergenic
1174053910 20:47785405-47785427 CCGGCCGGGCCGCTGGGCGCAGG + Intronic
1174380710 20:50153730-50153752 GCCGCCGCCGCGCCCGGCGCTGG - Exonic
1175873838 20:62220360-62220382 GCCCCCGCCCCGCCCGGCGCCGG + Intergenic
1176419039 21:6499439-6499461 CCTTCTCGCCCGCCCGGCGCTGG + Intergenic
1177637605 21:23807115-23807137 CCGGCCGGCCCTGCCGGCCCGGG + Intergenic
1178074167 21:29000278-29000300 CCTGCCCGCCCCGCCGGCCCGGG + Intergenic
1178082223 21:29077379-29077401 CCTGCCGGCCCCACCGGCCCCGG - Intergenic
1178843716 21:36157246-36157268 CCTGCCGCCCCGCTCGGCGAGGG - Intronic
1179133511 21:38660360-38660382 CGAGCCGTCCCTCCCGGCGCTGG + Intronic
1179694532 21:43107761-43107783 CCTTCTCGCCCGCCCGGCGCTGG + Intergenic
1179740915 21:43417653-43417675 CCTGCTGGCCCGGCTGGCGGGGG + Exonic
1179876925 21:44273297-44273319 TCTGCCAGCCTGCCCGGCGGAGG - Intergenic
1180741060 22:18053619-18053641 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1181026864 22:20131862-20131884 CCAGCCCGCCCGCCCGACCCCGG + Intronic
1181056975 22:20264921-20264943 CCAGGCGCCCCGCCCGGCCCTGG - Intronic
1181831716 22:25565157-25565179 CCAGCTGCCCCGGCCGGCGCCGG + Intronic
1182260674 22:29071552-29071574 CCCGCCGCCGCGCCGGGCGCAGG + Intergenic
1182546819 22:31081426-31081448 CCAGCCCACCCGTCCGGCGCAGG - Exonic
1182904306 22:33922077-33922099 CCCGGCGGCCCGCCCGGCTGGGG - Intronic
1183452910 22:37906398-37906420 CCCCGCGGCCCGCCCGGCTCCGG - Exonic
1183601663 22:38843756-38843778 CCTGGCGGCCAGCCCGGCGCGGG - Exonic
1183716159 22:39534866-39534888 CCTGCCGTCCCGCCCGTGCCCGG - Intergenic
1183951132 22:41353717-41353739 CCTGCCAGCCAGCCTGGCCCAGG - Intronic
1184155189 22:42662545-42662567 CACCCCGGCCCGCCCGGCCCGGG - Intergenic
1184265448 22:43343568-43343590 CCGGCCGGCTCGCTAGGCGCGGG + Intergenic
1184698065 22:46150657-46150679 CCCGCCCGCCCGCCCGCCCCCGG - Intronic
1185055078 22:48575292-48575314 CCCGCCGGCGCGCCAGGCGGGGG + Intronic
1185079202 22:48700413-48700435 CCTGCCGGCCTGCTCTGCCCCGG - Intronic
1185095730 22:48804998-48805020 CCAGCCCGCCCGCCCTGCCCAGG - Intronic
1185333443 22:50261623-50261645 CCCGCCCGCCCGCCGGCCGCTGG + Exonic
950576549 3:13835485-13835507 CCTGCTGGCCTGCCTGGCTCTGG + Intronic
951951103 3:28200675-28200697 CCAGCCGGCCCTGCCGGCCCCGG - Intergenic
952713306 3:36453443-36453465 CCGGCCGGCCCCACCGGCCCCGG + Intronic
952795232 3:37233101-37233123 CCTGCCGGCCCTGCCGGCCCCGG + Intergenic
955183335 3:56691977-56691999 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
955186413 3:56719031-56719053 CCGGCCGGCCCTGCCGGCCCGGG + Intergenic
957665197 3:83217873-83217895 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
957830033 3:85504938-85504960 CCGGCCGGCCCTGCCGGCCCCGG - Intronic
960925925 3:122795025-122795047 CCTCCCCGCCGGCCCGGCTCGGG + Exonic
961377280 3:126475501-126475523 CCGGCCGCCCCCCCCGGCCCTGG - Exonic
961647140 3:128398624-128398646 CCTGCAGGCCCGGCAGGGGCAGG - Intronic
962600518 3:136987849-136987871 CCGGCCGGCCCTGCCGGCCCCGG - Intronic
962998126 3:140651522-140651544 CCGGCCGGCCCCGCCGGCCCAGG + Intergenic
963116888 3:141738144-141738166 CCTGCCCGCCCCCCTGGCGCTGG + Intergenic
963133299 3:141877195-141877217 CCTCCCGCCCGGCGCGGCGCCGG + Intronic
963744148 3:149109486-149109508 CCTGCCGGCCCCACCAGCCCCGG + Intergenic
966096805 3:176213681-176213703 CCTGCCGGCCCCGCCGCCCCGGG - Intergenic
966182212 3:177197612-177197634 CTCGCCCGCCCGCCCGGCGCAGG - Intergenic
966191030 3:177271990-177272012 CCGGCCGGCCCTGCCGGCCCGGG - Intergenic
966474286 3:180325726-180325748 CCTGCCGGCCTGCACTGCCCGGG - Intergenic
966725450 3:183104008-183104030 CCGGCCGGCCCTGCCGGCCCGGG - Intronic
966933031 3:184687885-184687907 CCTGCCCGCGCGCCCGGGGAGGG - Intergenic
968225225 3:196968847-196968869 CCTCCCGGCCCGCCCTGCGCCGG - Intronic
968433824 4:575201-575223 CCCGCCGGCCCCGCCGGCCCCGG + Intergenic
968642506 4:1721622-1721644 CCTGCCCGCCCGCCCGTTGCCGG - Exonic
968651935 4:1763593-1763615 CCCGCCCGCCCGCCCTGCGGTGG - Intergenic
968659629 4:1793688-1793710 GCTCCCGGGCCGCCTGGCGCCGG - Intronic
968671676 4:1855676-1855698 CCAGCGGCTCCGCCCGGCGCTGG + Intronic
969053416 4:4387582-4387604 CCCCCCGGCCCTCCCGCCGCAGG + Exonic
969295847 4:6270282-6270304 CCTGCTGTCCCGCCCGCGGCGGG - Intronic
969676940 4:8619509-8619531 GCTGCCTGCGCGCCCGGAGCGGG - Exonic
969858625 4:10019101-10019123 CCTGGCTGCGCGCCCGGTGCCGG - Intronic
970649341 4:18159531-18159553 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
970803512 4:20004110-20004132 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
971377129 4:26064241-26064263 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
971905208 4:32716487-32716509 CCGGCCAGCCCTGCCGGCGCCGG - Intergenic
973246594 4:48016754-48016776 CCCGCAGCCCCGCCCGCCGCGGG + Exonic
974892307 4:67896823-67896845 CCGGCCGGCCCTGCCGCCGCTGG - Intergenic
977716616 4:100190432-100190454 CCTCCCGGGCCACCCTGCGCCGG + Exonic
977717361 4:100196782-100196804 CCGGCCGGCCCTGCCGGCTCCGG - Intergenic
979224174 4:118265656-118265678 CCAGCCGGCCCCGCCGGCCCCGG + Intergenic
979688573 4:123538015-123538037 CCAGCCGGCCCTGCCGGCCCCGG + Intergenic
980051946 4:128047820-128047842 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
980230266 4:130038804-130038826 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
982422006 4:155208901-155208923 GCTGCCCGCCCGCGCGGCGCGGG + Exonic
983026086 4:162739639-162739661 CCGGCCGGCCCTACCGGCCCCGG + Intergenic
983230672 4:165126199-165126221 CCGGCCGGCCCTGCCGGCCCCGG - Intronic
984265641 4:177495690-177495712 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
984852819 4:184168783-184168805 CCTGCCCGCCGGCCCTGCCCGGG - Intronic
984901737 4:184592007-184592029 CCGGCCGGCCCCACCGGCCCCGG + Intergenic
985087085 4:186324682-186324704 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
985129081 4:186723822-186723844 CCGGCCGCCCAGCTCGGCGCCGG + Exonic
985580573 5:693490-693512 CCCGCCGCCCCACCCGGCCCGGG + Intergenic
986697983 5:10375256-10375278 CCGGCCGGCCCTGCCGGCCCAGG + Intronic
987146263 5:14994067-14994089 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
987476710 5:18399934-18399956 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
987543816 5:19287843-19287865 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
988177250 5:27743560-27743582 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
988384271 5:30540340-30540362 CCTGCCGGCCGGCCCCAGGCAGG - Intergenic
988489144 5:31692231-31692253 CCGGCCGGCCCCACCGGCCCCGG - Intronic
988883575 5:35531725-35531747 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
990345249 5:54865175-54865197 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
991198433 5:63961717-63961739 CATGCCTGCGCGCCCGGCGCGGG + Exonic
992056597 5:72996873-72996895 TCTGCCGGCCCCGCCGGCCCCGG - Intronic
996234209 5:121107276-121107298 CCAGCCGGCCCTGCCGGCCCTGG + Intergenic
996298542 5:121954114-121954136 CCGGCCCACCCGCGCGGCGCTGG - Intergenic
999855297 5:155587013-155587035 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1001159435 5:169300655-169300677 CGTGCGCGCCCGCCTGGCGCTGG - Exonic
1001824707 5:174735590-174735612 CCTTCCGCCCCGCCCGCTGCCGG + Intergenic
1002004648 5:176222286-176222308 CCAGCCGGCCCTGCCGGCCCCGG - Intergenic
1002167854 5:177359231-177359253 CCAGCCGGCCAGCCCGGGGCTGG - Intronic
1002221729 5:177688334-177688356 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
1002466512 5:179411436-179411458 CCTGCCTGCCCTCCCAGAGCTGG - Intergenic
1002714761 5:181220024-181220046 GCTGCCGCCTCACCCGGCGCCGG + Intergenic
1003982479 6:11402843-11402865 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1004216812 6:13711345-13711367 CCGGCCGGCTCGCCCGGCGGCGG - Exonic
1004866068 6:19854688-19854710 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1004906202 6:20239162-20239184 CCGGCCGGCCCCGCCGGCCCCGG + Intergenic
1005605521 6:27473159-27473181 CCAGTGTGCCCGCCCGGCGCCGG - Intergenic
1005707457 6:28469614-28469636 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1006671434 6:35731939-35731961 ACTCCCGCCGCGCCCGGCGCCGG - Intergenic
1008038770 6:46774698-46774720 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
1009396978 6:63211526-63211548 GCTGCCCGCCCGCTCGGCGTCGG + Exonic
1009685324 6:66949314-66949336 CCGGCCGGCCCTGCCGGCCCAGG + Intergenic
1011054662 6:83192997-83193019 CCAGCCCGCCCGCGGGGCGCAGG + Intronic
1011640374 6:89412002-89412024 CCGGCCGGCCGGCCCGGGGACGG + Exonic
1013025734 6:106269667-106269689 CCGGCCGGCCCTGCCGGCCCCGG - Intronic
1015328460 6:131950922-131950944 CCCGCCGGGCAGCGCGGCGCCGG + Exonic
1015572266 6:134633806-134633828 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1017497551 6:154995245-154995267 CCTCCCGCCCCGCCCCGCCCCGG - Intronic
1017581235 6:155867016-155867038 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1017880673 6:158560442-158560464 CCTGCCTGCCCGCCCGGCCGCGG + Intronic
1017880749 6:158560670-158560692 CCTGCGGTCTCGCCCAGCGCCGG + Intronic
1018064251 6:160114762-160114784 CCGGCCGGCCCTGCCGGCCCGGG - Intergenic
1019453090 7:1109753-1109775 CCTTCCCGCCCGCCGGGCCCTGG + Intronic
1019637438 7:2083569-2083591 CCCGACAGCCCGCCCTGCGCTGG - Intronic
1019989496 7:4682070-4682092 CCCGCCGGCCCTCCCGGCACAGG + Intergenic
1020210649 7:6155655-6155677 CCTGCCCGCCTGCCCAGCGTAGG + Intronic
1021274730 7:18636284-18636306 CCTGCCAGCCCCCCCTGCCCTGG + Intronic
1021567379 7:22028782-22028804 CCGGCCGGCCCAGCCGGCCCCGG + Intergenic
1021761290 7:23904972-23904994 CCCGCCGGCCCCACCGGCCCCGG - Intergenic
1023354565 7:39354024-39354046 CCTGCCGGGCCGCCTGGAGCGGG - Intronic
1023881835 7:44325248-44325270 ACTGCGGGCCCGCGCGCCGCCGG - Intronic
1024232353 7:47372205-47372227 CCTGGCTGCCCGCCAGGCGTGGG - Intronic
1024261009 7:47573705-47573727 CCTGCAGGCCTGCCCGGCCAGGG + Intronic
1024394282 7:48848149-48848171 CCTGAGAGCCCGCGCGGCGCTGG - Intergenic
1024834032 7:53495120-53495142 CCGGCCGGCCCTGCCGGCCCTGG + Intergenic
1025032984 7:55572389-55572411 TCTGCCCGCCCGCCCCGCGCGGG - Exonic
1026512327 7:71037693-71037715 CCGGCCGGCCCTGCCGGCCCAGG + Intergenic
1027238022 7:76309698-76309720 CCGGCCGGCCCCGCCGGCCCCGG - Intergenic
1027579728 7:79977864-79977886 CCGGCCGGCCCTGCCGGCCCTGG - Intergenic
1028070083 7:86440666-86440688 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
1028303304 7:89228989-89229011 CCGGCCGGCCCCGCCGGCACTGG - Intronic
1029628252 7:101733978-101734000 TCTGCCGGCCGGGCCGGCGCAGG + Intergenic
1029903954 7:104071898-104071920 CCAGCCGGCCCCACCGGCCCCGG + Intergenic
1030599995 7:111582204-111582226 CCGGCCGGCCCTGCCGGCCCGGG - Intergenic
1030819326 7:114077104-114077126 CCAGCCGGCCCTGCCGGCCCGGG - Intergenic
1031378785 7:121060069-121060091 CCGGCCGGCCCTGCCGGCCCGGG + Intronic
1032013616 7:128361783-128361805 CCTGCCTGCCCGCCCGGGTGTGG - Intergenic
1032087275 7:128890845-128890867 CCTGCCGCCCCGCCCCGCCCCGG - Intronic
1032248062 7:130230121-130230143 CCGGCCGGCCCTGCCGGCTCTGG + Intergenic
1032561619 7:132898868-132898890 CCGGCCGGCCCTGCCGGCCCCGG - Intronic
1034097897 7:148426507-148426529 CCAGCCGGCCCTGCCGGCCCCGG + Intergenic
1034174568 7:149090645-149090667 CCCGCGGTCCCGCCCGGCCCTGG + Exonic
1034508929 7:151519229-151519251 CCTGCCCGCCCGGCCCGCGGAGG + Intronic
1034618140 7:152436184-152436206 GCGGCCGGCCCTCCCCGCGCCGG - Intergenic
1035022182 7:155806359-155806381 CATGCTGGCCCGCCTGGCGGTGG - Exonic
1035171826 7:157021467-157021489 TCTGCGCGCCCGCCCGGTGCCGG + Intergenic
1035236171 7:157498937-157498959 CCTCCCTCCCTGCCCGGCGCAGG - Intergenic
1036441047 8:8781653-8781675 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1036910378 8:12754060-12754082 CCTGCAGGGCCTCCCGGGGCCGG + Intronic
1037957569 8:23071047-23071069 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1038326666 8:26577412-26577434 CCTCCCGGGCTGCGCGGCGCCGG + Intronic
1042246385 8:66712746-66712768 CCGGCAGGGCCGCCGGGCGCCGG - Intronic
1043073363 8:75665726-75665748 CCGGCCGGCCCTGCCGGCCCTGG - Intergenic
1043129953 8:76447875-76447897 CCCGCCGGCCCTGCCGGCCCCGG - Intergenic
1043346447 8:79303593-79303615 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
1044088482 8:87971258-87971280 CCGGCCGGCCCGCCGGCCCCGGG + Intergenic
1044719778 8:95134058-95134080 CCTCCCGGCCCGTCAGGAGCCGG - Intronic
1044997326 8:97849811-97849833 CCTGCCCGCCTGCCCGCCCCCGG + Intronic
1045582904 8:103499751-103499773 CCTCCCTCCCCGCCCGGCCCCGG + Intergenic
1046094356 8:109539886-109539908 CCTCCCCGCCCGCCCGGCGGAGG - Intronic
1047277504 8:123416882-123416904 CCAGCCGGCCAGCCCCCCGCGGG + Exonic
1047631719 8:126714898-126714920 CCGGCCGGCCCTGCCGGCTCCGG - Intergenic
1047998584 8:130358607-130358629 CCCGCCCGCCCGCCCGCCGCGGG - Intronic
1048789158 8:138084234-138084256 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
1049157694 8:141076786-141076808 CCAGCCGGCCCTGCCGGCCCTGG + Intergenic
1049212219 8:141392063-141392085 CCTGGCGGTCCGGGCGGCGCCGG - Intronic
1049548520 8:143246047-143246069 CCTGCCGCTCCTCCCGCCGCAGG - Intergenic
1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG + Intergenic
1049638859 8:143705397-143705419 CCTCCCTGCCCGCCCGCCTCGGG + Intronic
1049646516 8:143738181-143738203 CCTGCCTGCCCTCCTGGCCCGGG + Intergenic
1049788533 8:144462628-144462650 CCCGCCGGCCTCCTCGGCGCCGG + Intronic
1049801971 8:144522121-144522143 CCTGTCGCCCCGCCCTTCGCGGG + Exonic
1051079708 9:13279711-13279733 CCCGCCGCCCCGCCGGTCGCAGG - Intergenic
1055454396 9:76459330-76459352 CCTGCTCGGCCGCCCGGCGGTGG + Intronic
1055651361 9:78410096-78410118 CCGGCCGGCCCTGCCGGCCCGGG + Intergenic
1057259619 9:93576523-93576545 CCCGCCGGCCCGCGGGGCTCAGG - Exonic
1057294653 9:93828068-93828090 CCTGCCCGCCCGCCCGCCCTGGG - Intergenic
1057313464 9:93955281-93955303 CCCGCCGGCCGGCCGGGCGGAGG + Exonic
1058885820 9:109320635-109320657 CGCGCCGGCCCGGCCAGCGCCGG + Exonic
1059102196 9:111482819-111482841 CAGGCCGCCCCGCCCGCCGCCGG - Intronic
1059123437 9:111662011-111662033 CCTCCCGGCCCGCGCGTCGCCGG - Intronic
1059791165 9:117642989-117643011 CCGGCCGGCCCCGCCGGCCCGGG - Intergenic
1060594244 9:124838973-124838995 CCGGCCGGCCCCACCGGCCCCGG - Intergenic
1060811728 9:126614259-126614281 CCGGCCCGCCCGCACGACGCCGG + Intergenic
1061261296 9:129482372-129482394 CCTGCCGGCCCCCCCGCCCATGG + Intergenic
1061262642 9:129488563-129488585 CCTGGCGGGCGGCCCGGGGCAGG - Intergenic
1061330674 9:129890358-129890380 CCTGCCCTCCCGCCCAGCCCGGG - Exonic
1061961750 9:133992283-133992305 CCCGCGGGCCCGACCGGCTCAGG + Exonic
1062269939 9:135703760-135703782 CCTGCCGGCTCGTCTGGAGCAGG - Intronic
1062279070 9:135743984-135744006 CCTGCCTGCCTGCCTGGTGCTGG + Intronic
1062363696 9:136199120-136199142 CCTCCCACCCCGGCCGGCGCGGG + Intronic
1062462013 9:136666061-136666083 GCCGCCCGCCCGCCCGCCGCCGG - Intronic
1062475139 9:136722976-136722998 CCTGCCTTCCCTGCCGGCGCTGG + Exonic
1062607291 9:137353943-137353965 CCTTCCGGCCGGCTCTGCGCTGG + Intronic
1062610416 9:137371032-137371054 CCTGCCGGGCGGCCCCGCTCGGG + Intronic
1185943969 X:4353673-4353695 CCTCCCAGCCCGCCCAGCCCAGG - Intergenic
1186152613 X:6690769-6690791 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1190758597 X:53422134-53422156 CCCGCCGGACCGGCCGGAGCCGG - Intronic
1195138190 X:101931821-101931843 CCTGCCTGCCCGCCTGCCGGTGG - Intronic
1196827294 X:119751091-119751113 CCGGCCGGCCCTGCCGGCCCCGG - Intergenic
1196845042 X:119890689-119890711 CCGGCCGGCCCTGCCGGCCCCGG + Intergenic
1198299967 X:135325552-135325574 CCGGCCGGCCCTGCCGGCCCCGG + Intronic
1198480057 X:137033057-137033079 CCTGCCGCCCCGGCCACCGCGGG + Intergenic
1199772560 X:150983926-150983948 CCTGCGGGCCCGCGCGGCGCCGG - Intronic
1200323726 X:155216436-155216458 CCTCCCGGGCCGCCGGCCGCCGG - Exonic