ID: 1083762424

View in Genome Browser
Species Human (GRCh38)
Location 11:64825949-64825971
Sequence CTCAGCCTCTCCCAAGTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 691
Summary {0: 1, 1: 11, 2: 70, 3: 153, 4: 456}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083762424_1083762429 4 Left 1083762424 11:64825949-64825971 CCAGCGACTTGGGAGAGGCTGAG 0: 1
1: 11
2: 70
3: 153
4: 456
Right 1083762429 11:64825976-64825998 GAGACTTGCTCAAATGTGGGAGG 0: 1
1: 0
2: 13
3: 262
4: 3652
1083762424_1083762433 10 Left 1083762424 11:64825949-64825971 CCAGCGACTTGGGAGAGGCTGAG 0: 1
1: 11
2: 70
3: 153
4: 456
Right 1083762433 11:64825982-64826004 TGCTCAAATGTGGGAGGTGGGGG 0: 1
1: 3
2: 94
3: 1144
4: 11545
1083762424_1083762427 0 Left 1083762424 11:64825949-64825971 CCAGCGACTTGGGAGAGGCTGAG 0: 1
1: 11
2: 70
3: 153
4: 456
Right 1083762427 11:64825972-64825994 GTAGGAGACTTGCTCAAATGTGG 0: 1
1: 0
2: 1
3: 31
4: 642
1083762424_1083762430 7 Left 1083762424 11:64825949-64825971 CCAGCGACTTGGGAGAGGCTGAG 0: 1
1: 11
2: 70
3: 153
4: 456
Right 1083762430 11:64825979-64826001 ACTTGCTCAAATGTGGGAGGTGG 0: 1
1: 0
2: 6
3: 193
4: 2553
1083762424_1083762431 8 Left 1083762424 11:64825949-64825971 CCAGCGACTTGGGAGAGGCTGAG 0: 1
1: 11
2: 70
3: 153
4: 456
Right 1083762431 11:64825980-64826002 CTTGCTCAAATGTGGGAGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 194
1083762424_1083762428 1 Left 1083762424 11:64825949-64825971 CCAGCGACTTGGGAGAGGCTGAG 0: 1
1: 11
2: 70
3: 153
4: 456
Right 1083762428 11:64825973-64825995 TAGGAGACTTGCTCAAATGTGGG 0: 1
1: 0
2: 1
3: 26
4: 465
1083762424_1083762432 9 Left 1083762424 11:64825949-64825971 CCAGCGACTTGGGAGAGGCTGAG 0: 1
1: 11
2: 70
3: 153
4: 456
Right 1083762432 11:64825981-64826003 TTGCTCAAATGTGGGAGGTGGGG 0: 1
1: 1
2: 3
3: 47
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083762424 Original CRISPR CTCAGCCTCTCCCAAGTCGC TGG (reversed) Intronic
900324047 1:2099197-2099219 CACCCCCTCTCACAAGTCGCTGG + Intronic
900925753 1:5705242-5705264 CTCAGCCTCACCCACCTCGAGGG + Intergenic
901036320 1:6338341-6338363 CTGAGCCTCTCCCGAGTCGTGGG + Intronic
901085714 1:6611060-6611082 CTCAGCCTCCCCCAAAGTGCTGG - Intronic
901203877 1:7483071-7483093 CTCAGCCTCTCTCAGGAAGCTGG + Intronic
901203991 1:7483627-7483649 CTCAGCCTCCCTCAGGACGCTGG - Intronic
901211808 1:7530929-7530951 CTCAGCCTCCCCCAAGTAGCTGG + Intronic
901303837 1:8218019-8218041 CACAGCCTCACCCTAGTCCCTGG - Intergenic
901370541 1:8793949-8793971 CTCAGCCTCTCCTGAGTAGGTGG - Intronic
901512714 1:9725436-9725458 CTCAGCCTCCCGAAAGTAGCTGG - Intronic
901569392 1:10147239-10147261 CTCAGCCTCCCCCAAAGTGCTGG - Intronic
902808574 1:18875584-18875606 CTCACCCTCTCCCCAGTCCCTGG + Intronic
903074475 1:20752143-20752165 CCCAGCCTTGCCCAAGTAGCTGG - Intronic
903078388 1:20789134-20789156 CTCAGCCTCCCGCGAGTAGCTGG - Intergenic
903111172 1:21135382-21135404 CTCAGCCTCTCCCGAGTAGCTGG - Intronic
903298142 1:22358978-22359000 GTCTGCCTCTCCCAACTCCCAGG - Intergenic
903410028 1:23134664-23134686 CTCAGCCTCTCCCAAGTAGCTGG - Intronic
903921964 1:26806105-26806127 CTCAGCCCCTCCCAAGTAGCTGG + Intergenic
904113708 1:28146522-28146544 TTCAGCCTCCCACAAGTAGCTGG + Intergenic
904154641 1:28472716-28472738 CTCAGCCTCTCCTGAGTAGCTGG + Intronic
904168511 1:28574467-28574489 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
904360133 1:29965770-29965792 CTCATCCTCTCCCAGCTCCCAGG - Intergenic
905723545 1:40228464-40228486 CTCAGCCTCCCTCGAGTAGCTGG - Intronic
906429962 1:45748553-45748575 CTCAGCCTCCCCTGAGTAGCTGG - Intronic
906951740 1:50340628-50340650 CCCAGCTTCTGCCAAGTAGCTGG - Intergenic
907039332 1:51244499-51244521 CTCAGCCTGTCCCGAGTAGCTGG + Intronic
907040811 1:51257570-51257592 CTCAGCCTCTCTCGAGCAGCTGG + Intronic
907234938 1:53038027-53038049 TTCAGCCTCCCCCAAGTAGTTGG - Intronic
907467303 1:54647357-54647379 CTCAGCCTCTCCAAAGTGCTGGG - Intronic
907892597 1:58649928-58649950 CACAGCCTGTCCCAGGTCCCTGG + Intergenic
908261605 1:62343518-62343540 CTCAGCCTCTCGAGAGTAGCTGG + Intergenic
909967376 1:81931744-81931766 CTCAGTCTCCCCCAAGTAGCTGG + Intronic
910256007 1:85248337-85248359 CCCAGCCCCTCCCAAATCTCAGG + Intergenic
911035616 1:93542898-93542920 CTCAGCCTCTCACGAGTAGCTGG + Intronic
911398367 1:97340557-97340579 CTCAGCCTCCCGAAAGTAGCTGG - Intronic
912776154 1:112507781-112507803 CTCAGTTTCTCCCACCTCGCAGG - Intronic
913654110 1:120945006-120945028 TTCACCCTCTCAAAAGTCGCTGG - Intergenic
914685628 1:149976358-149976380 CTCGGCCTCTCCCAAAGTGCTGG - Intronic
915390988 1:155543815-155543837 CTCAGCCCCTGCCAAGTAGCTGG - Intronic
915940941 1:160117798-160117820 CTCAGCCTCTCCGTGGTAGCTGG - Intronic
916013880 1:160731066-160731088 CTCAGCCTCTCCAAAGTGCTGGG + Intergenic
916921778 1:169476601-169476623 CCCAGCCTCTCCCTAGTAGCTGG - Intronic
916939059 1:169661444-169661466 CTGAGCCTCCCCCAACTCCCTGG + Intergenic
916940096 1:169668282-169668304 CTGAGCCTCCCCCAACTCCCTGG + Intronic
917422615 1:174880704-174880726 CTCAGCCTCTCCTGAGTAGCTGG + Intronic
917852470 1:179077186-179077208 CTCAGCCTCCCCAGAGTAGCTGG - Intergenic
917912973 1:179670273-179670295 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
918013435 1:180609322-180609344 CTCAGCCTCCCCCGAGTAGCTGG + Intergenic
918496262 1:185140863-185140885 CTCAGCCTCCCAAAAGTAGCTGG - Intronic
918907717 1:190519804-190519826 CTCAGGGACTCCCAAGTAGCTGG - Intergenic
919002183 1:191847063-191847085 CTCGGCCTCTCCCAAAGTGCTGG - Intergenic
919727737 1:200894987-200895009 CTCAGGGTCTCCCAAGCCACAGG - Exonic
919980220 1:202638252-202638274 CCCAGCCCCTCCCCAGTCTCAGG + Intronic
919996868 1:202760197-202760219 CTCAGCCCCCCCCACGTAGCTGG - Intronic
920146396 1:203864759-203864781 CTCAGCTCCCCCCAAGTAGCTGG - Intronic
920314983 1:205070550-205070572 CCCTTCCTCTCCCAAGTCCCAGG - Intronic
920880407 1:209875193-209875215 CTCAGCCCCTCCCAAGTAGCTGG - Intergenic
921388270 1:214592810-214592832 TCCTGCCTCTCCCAAGTAGCTGG - Intergenic
922443272 1:225675049-225675071 CTCAGAGCCTCCCAAGTAGCTGG - Intergenic
922576521 1:226664545-226664567 CTCAGCCCCTCCAAGGTCTCTGG + Intronic
922631472 1:227117564-227117586 CTCAGCCTCTCAAAAGTGCCAGG + Intronic
922721254 1:227901345-227901367 CCCAGCCTCTCCCAAGCCCTTGG + Intergenic
922809932 1:228409658-228409680 CTCCGCCTCTCCTGAGTTGCAGG - Intronic
923117698 1:230958876-230958898 CTCAGCCCCAACCAAGTAGCTGG - Intronic
923513369 1:234672920-234672942 CTCAGGCTCACACAAGTCTCTGG - Intergenic
923610531 1:235488565-235488587 CTCAGCCTCTCTTAAGTAGATGG - Intronic
923695851 1:236250353-236250375 CTCAGCCTCTCCCGAGTAGCTGG - Intronic
923976080 1:239264770-239264792 CTCAGTCTCTCCCAAGTAGCTGG - Intergenic
924091630 1:240507445-240507467 CTCAGCCTCCCAAAAGTAGCTGG + Intronic
924699063 1:246431613-246431635 CTCAGCCTCCCCCGAGTAGCTGG - Intronic
1063519875 10:6731470-6731492 CTCAGCCTCTCCTGAGTAGCTGG - Intergenic
1065132526 10:22636512-22636534 CTCAGCCTCCCCAAAGTGGTAGG + Intronic
1065721039 10:28629109-28629131 ATCAGCCTCTCCTAAGAAGCAGG + Intergenic
1066009153 10:31177559-31177581 CTCAGCCTCTCCTGAGTACCTGG + Intergenic
1067016866 10:42763740-42763762 CTCAGCCCCTCCCAAGTAGCTGG + Intergenic
1067147112 10:43702003-43702025 TCCTGCCTCTCCCAAGTAGCTGG + Intergenic
1067392694 10:45879116-45879138 CTCAGCCTCTCCTGAGTAGCTGG - Intergenic
1067474582 10:46557121-46557143 CTCCGCCTCTCACAATTCTCTGG + Intergenic
1068533233 10:58211796-58211818 CTCAGCCTCTTCCGAGTAGCTGG - Intronic
1069010200 10:63363799-63363821 CCCAGCCTCTCCCGGGTAGCTGG + Intronic
1069384279 10:67870331-67870353 CTCAGCCTTTCCCAAATTGCTGG - Intergenic
1069390119 10:67926278-67926300 CTTAGCCTCCCCCAAGTAGCCGG - Intronic
1069425545 10:68285793-68285815 CTCAGCCCCCCGCAAGTAGCTGG + Intronic
1069449192 10:68502613-68502635 CTCAGCCTCCCAAAAGTAGCTGG - Intronic
1069482809 10:68798868-68798890 CTCTACCTCTCCCAAGTAGCTGG - Intergenic
1070024749 10:72622028-72622050 CTCAGCCTCCCCGGAGTAGCTGG + Intronic
1070107725 10:73451651-73451673 CTCAGCCTCTCAAAAAGCGCTGG - Intronic
1070235928 10:74626414-74626436 CTCAGCCTCTTCCAAGTAGCTGG + Intronic
1071244846 10:83751444-83751466 TTCTGCCTCTTCCAAGTTGCTGG - Intergenic
1072398352 10:95068944-95068966 CTCAGCCTCCCCCGAGTAACTGG - Intronic
1072644388 10:97241206-97241228 TTCAGCCTCCCCCGAGTAGCTGG - Intronic
1072943173 10:99785631-99785653 CTCAACCCCTCCCGAGTAGCTGG + Intronic
1073237342 10:102028986-102029008 TTCAGCCTCCCCCAACTAGCTGG + Intronic
1074526422 10:114267229-114267251 CTCAGACTCTCCCGAGTAGCTGG + Intronic
1074858803 10:117493626-117493648 CTGAGCCCCTCCCAAATCCCTGG + Intergenic
1075111664 10:119591288-119591310 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
1075605547 10:123803212-123803234 CTCAGAGCCTCCCAAGTGGCTGG + Intronic
1075872488 10:125781060-125781082 CTCAGCCTCCCGCAAGTAGCTGG + Intergenic
1076906116 10:133362000-133362022 CTCCCCCCCTCCCAAGTAGCTGG - Intergenic
1078240408 11:9526025-9526047 CTCAGCACCCCCCAAGTAGCTGG - Intronic
1078965121 11:16330438-16330460 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1079380850 11:19935972-19935994 CTCAGCCTCTCCTGAGCAGCTGG + Intronic
1080061451 11:27960994-27961016 CTCAGCCTCCCTCAAGCAGCTGG + Intergenic
1080364830 11:31561556-31561578 CTCAGCCTCCTCCAAGTAGCTGG + Intronic
1080452623 11:32391097-32391119 CTCAGCCTCCCCCAAATAGCTGG + Intronic
1080506351 11:32917709-32917731 TCCTGCCTCTCCCAAGTAGCTGG - Intronic
1080536812 11:33229909-33229931 CTTAGCCTCCCCCGAGTAGCTGG - Intergenic
1081755050 11:45538463-45538485 CTCAGCCTCTCCCTGTTCCCTGG + Intergenic
1082783674 11:57304753-57304775 CTCAGTCTCCCCCAAGAAGCTGG - Intronic
1082833695 11:57637906-57637928 TTCAGCCTCACCCAAGGCGGTGG - Intergenic
1083762424 11:64825949-64825971 CTCAGCCTCTCCCAAGTCGCTGG - Intronic
1083931269 11:65847118-65847140 CTCAGCCCCCCCCAAGTAGCTGG + Intronic
1084079297 11:66809818-66809840 CTCAGCCTCTCCTGAGTAGCTGG + Intronic
1084099098 11:66933774-66933796 CTCTGCCTCTCCCCATTCCCAGG + Intronic
1084706239 11:70817454-70817476 CACTGCCTGTCCCAAGTCGAGGG - Intronic
1084964537 11:72737737-72737759 CTCAGCCTCTCCAGAGTAGCTGG + Intronic
1085146295 11:74200935-74200957 CTCAGTCTCTCCCGAGTGGCAGG + Intronic
1086290769 11:85306685-85306707 CTCAGCCTCCCCTAAGTAGCTGG + Intronic
1086450897 11:86915797-86915819 CTTAGTCTCTCCCAAAGCGCTGG - Intronic
1086467528 11:87070517-87070539 TTCAGCCCCTCCCGAGTAGCTGG - Intronic
1088312606 11:108476020-108476042 CTCAGCCTCCCACTAGTAGCTGG - Intronic
1088896026 11:114078935-114078957 CTCAGCCTCCCCCGACTAGCTGG - Intronic
1088896037 11:114078995-114079017 CTCAGCCTCTCCCGACTAGCTGG - Intronic
1089062598 11:115638080-115638102 GACAGCCCCTCCCAATTCGCTGG - Intergenic
1089568061 11:119382843-119382865 CTCAGCCTCCCCCGAGTAGCTGG + Intergenic
1090171506 11:124610205-124610227 CTCAGACTCTCCCAAGCCCCTGG + Intergenic
1090806339 11:130204695-130204717 CTCAGCCGCCCCCAAGTAGCTGG - Intronic
1092174966 12:6397738-6397760 CTCAGCCTCTCTCCAGTAGCTGG + Intergenic
1092785810 12:12025576-12025598 CTCAGCCTCTCCTAAGATGCTGG - Intergenic
1092909347 12:13132725-13132747 CTCAGCCTCCCGCGAGTAGCTGG - Intronic
1093206608 12:16259146-16259168 CTCAGCTTCTCTCAAGTAGCTGG + Intronic
1093968938 12:25356808-25356830 CTCAGCCTATCCCGAGTAGCAGG - Intergenic
1094251242 12:28364269-28364291 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
1094291984 12:28861335-28861357 CTCAGCCTCACCCAAAGTGCTGG + Intergenic
1094472458 12:30816467-30816489 CTCAGCCTCCCACAAGTAGCTGG - Intergenic
1094684134 12:32694198-32694220 CTCAGCCTATCCTGAGTAGCTGG + Intronic
1095380943 12:41591207-41591229 CTGAGCATCTCCCAAGTGCCAGG - Intergenic
1095699388 12:45175248-45175270 CTCAGCCTCCCCAGAGTAGCTGG - Intergenic
1095879687 12:47119848-47119870 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
1095943172 12:47739342-47739364 CTCAGCCTCTCCTCAGCCCCAGG + Intronic
1096095627 12:48933748-48933770 CTCAGCCTTTTCCGAGTTGCTGG - Intronic
1096358361 12:50962292-50962314 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
1096640770 12:52992562-52992584 CTCAGCTTCCCCCAAGCAGCTGG - Intergenic
1096646303 12:53038698-53038720 CTCAGCGTCTCCCGAGTAGCTGG - Intronic
1096970635 12:55663566-55663588 CTCACTCTCTCCCGAGTCCCTGG - Intergenic
1097075351 12:56388985-56389007 CTCAGCGCCTCCCAAGTAGATGG - Intergenic
1098166235 12:67701328-67701350 CTCAACCTCTCCTGAGTCACTGG + Intergenic
1098268027 12:68743283-68743305 CTCAGCCTCCCCTGAGTAGCTGG - Exonic
1099342628 12:81457096-81457118 CCCAGGCCCTCCCAAGTAGCTGG + Intronic
1100190923 12:92190822-92190844 CTCAGCCTCCCCCAAAGTGCTGG - Intergenic
1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG + Intronic
1101433096 12:104643209-104643231 CTCAGCCTCCCACAAGTAGCTGG - Intronic
1101591115 12:106126322-106126344 TTCTGCCTCTCCCAGGTAGCTGG - Intronic
1101746465 12:107545356-107545378 CTCAGCCCCCCTCAAGTAGCTGG + Intronic
1102336191 12:112082453-112082475 CTCAGCCTCTTGCCAGTAGCTGG - Intronic
1102518324 12:113464570-113464592 CTCCCCCTCTCCCAAGTCGCTGG - Intronic
1102525248 12:113507984-113508006 CTCAGCCTCCCCCAAAGCGCTGG + Intergenic
1102559418 12:113751689-113751711 CTGAGCCTTTCCCAAGTTCCTGG - Intergenic
1103077172 12:117993368-117993390 CTCAGCCTCCCCGGAGTAGCTGG - Intergenic
1103545594 12:121698887-121698909 CTCAGCCTTTCCCAAAGTGCTGG - Intergenic
1103862986 12:124029080-124029102 CTCAGCCTCCCCCAAGCAGCTGG + Intronic
1103866128 12:124053397-124053419 CTCAGCCTCTCCCAAAGTGCTGG - Intronic
1103876048 12:124127988-124128010 CTCAGCCTCTCCAAAGTGCCAGG - Intronic
1104023419 12:125009090-125009112 CTCAGTCTCTCCCAAGTAGCTGG + Intronic
1104454818 12:128902366-128902388 CTCAGCCTCCCGAAAGTAGCTGG - Intronic
1104546563 12:129718303-129718325 CTCAGTCTCACCCATGTCCCTGG + Intronic
1104645998 12:130497588-130497610 CTCAGCCTCTCCCCAGCTCCTGG - Intronic
1105364819 13:19755117-19755139 CTCAGCACCCCCCAAGTAGCTGG - Intronic
1105381767 13:19893886-19893908 CTCAAGCTCTCCCAAGCAGCTGG + Intergenic
1105491185 13:20890196-20890218 CTCAGCCTCTCCAAAGTGCTGGG - Intronic
1105674527 13:22656365-22656387 CTCAGCCTCGGCCAAGTAGCTGG + Intergenic
1106333640 13:28763255-28763277 CTCAGCCTGGCCCAGGTCTCAGG - Intergenic
1106364078 13:29060387-29060409 CTCACTCTTTCCCAAGTTGCTGG + Intronic
1106949599 13:34868325-34868347 CACAGCCTCACCCAATTCTCTGG + Intergenic
1107465459 13:40645948-40645970 CTCAGCCTCACCGGAGTAGCTGG - Intronic
1109858840 13:68171189-68171211 CTGAGCCTCTCCCACGCCGAGGG + Intergenic
1113143549 13:107182387-107182409 CTCAGCCTCTCTCAAGTAGCTGG + Intronic
1113297203 13:108972091-108972113 CTCAGCAGTTCCCAAGTAGCTGG - Intronic
1114636474 14:24189885-24189907 CCCACCCTCTCCCATGTTGCTGG + Intronic
1115621307 14:35143274-35143296 CTCAGCCTCCCCCGAGTAGCTGG + Intronic
1115635808 14:35289444-35289466 CTCAACCTCTCCCGAGTAGCTGG + Intronic
1116420216 14:44723243-44723265 CTCATCCTCTCTCAAGGCCCAGG + Intergenic
1119457690 14:74770229-74770251 CTCAGCCACCCGCAAGTAGCCGG - Intronic
1119923850 14:78472859-78472881 CTCAGCCTTTGCAAAGTCTCAGG + Intronic
1121113075 14:91325691-91325713 CTCAGTCTCTCCCAAGTAGATGG + Intronic
1121175701 14:91889265-91889287 CTCAGCCTCTGGCCAGGCGCTGG + Intronic
1121454543 14:94029931-94029953 CTCTGCCTTTCCCAAGATGCAGG - Intronic
1122048153 14:99038006-99038028 CTGAGCCTCTCCCAGGGCCCGGG + Intergenic
1122248104 14:100418518-100418540 CTCAGCCTCCCAAAAGTAGCTGG - Intronic
1122458052 14:101871356-101871378 CTCAGCCTCCCCCAAGTAGCTGG + Intronic
1122629127 14:103099369-103099391 CTCAGCCACCCCCATGTCCCTGG + Intergenic
1122652617 14:103233725-103233747 CTCAGCCTCACCCAGGACACAGG - Intergenic
1122677044 14:103424091-103424113 CTTGGCCTCCCCCAAGTAGCTGG - Intronic
1123201915 14:106674283-106674305 GTCAGCCTCTCCCACGTGGCTGG + Intergenic
1123505286 15:20936254-20936276 CTCAGCCTCTCCTGAGTAACTGG - Intergenic
1123562525 15:21509957-21509979 CTCAGCCTCTCCTGAGTAACTGG - Intergenic
1123598770 15:21947234-21947256 CTCAGCCTCTCCTGAGTAACTGG - Intergenic
1124867196 15:33504022-33504044 CTCAGCCTCTCCACATTCGCTGG - Intronic
1125434725 15:39632427-39632449 CTCAGCCTCTCCAAAGTGCTGGG + Intronic
1125581453 15:40788758-40788780 CCCAGCCCCACCCAAGTAGCTGG - Intronic
1125639848 15:41221523-41221545 CTCAGCCTCCCAAAAGTCGTGGG + Intronic
1125646596 15:41277838-41277860 CTCAGCCTCCCCCAAGGAACTGG - Intronic
1125971171 15:43912914-43912936 CTCAGCCTCTCCCAAGTAATTGG - Intronic
1126615175 15:50570736-50570758 CTCAGCCTCCCGAAAGTAGCTGG - Intronic
1128337276 15:66795145-66795167 CCCAGGCTCTCCCGAGTAGCAGG - Intergenic
1128655290 15:69456710-69456732 CTCAGCCACCCTCAAGTAGCTGG + Intergenic
1128880177 15:71235701-71235723 CTCAGCCTCTCCCGAGTAGCTGG + Intronic
1129021664 15:72524999-72525021 CTTAGCCTCTCCCAAGTATCTGG + Intronic
1129249397 15:74300478-74300500 CTCAACCACTGCCATGTCGCTGG - Intronic
1130002949 15:80063663-80063685 CTCAGCCTCTCCCCAGTAGCTGG + Intronic
1130261645 15:82359087-82359109 TTCTGCCTCTCCCGAGTAGCTGG + Intergenic
1130279590 15:82509925-82509947 TTCTGCCTCTCCCGAGTAGCTGG - Intergenic
1130470969 15:84226108-84226130 TTCTGCCTCTCCCGAGTAGCTGG - Intergenic
1130478463 15:84340678-84340700 TTCTGCCTCTCCCGAGTAGCTGG - Intergenic
1130493307 15:84447454-84447476 TTCTGCCTCTCCCGAGTAGCTGG + Intergenic
1130519313 15:84650300-84650322 CTCAGCCTCCCCTGAGTAGCTGG + Intronic
1130593258 15:85230746-85230768 TTCTGCCTCTCCCGAGTAGCTGG - Intergenic
1130884712 15:88083335-88083357 CTCAGCCTCTCTGGAGTAGCTGG + Intronic
1131879103 15:96843668-96843690 CTCAGCCTCCCCCAAGTAGCTGG + Intergenic
1132085867 15:98907853-98907875 CTCAGCCTCTCCTAGATTGCTGG + Intronic
1202970876 15_KI270727v1_random:237096-237118 CTCAGCCTCTCCTGAGTAACTGG - Intergenic
1132780878 16:1624693-1624715 CTCAGCCCCTCCCGAGTAGCTGG + Intronic
1132843000 16:1987345-1987367 CTCAGCCTTTCCCTGGGCGCAGG + Exonic
1133276830 16:4643484-4643506 CTCAGCCCCTCCCAAGTACCTGG + Intronic
1133344574 16:5061314-5061336 TTTAGCCTCTCTCAAGTAGCTGG - Intronic
1133363638 16:5193831-5193853 CTCAGGCTCTCCCAAGTGCAGGG - Intergenic
1133763494 16:8818955-8818977 CTCAGCCACTCTGAATTCGCAGG + Intronic
1134028211 16:10970861-10970883 CTCAGCCTCTCCCAAGTAGCTGG + Intronic
1134160535 16:11884815-11884837 CTCGGCCTCCCCCAAGGTGCTGG - Intronic
1134430811 16:14204077-14204099 CTCAGAGCCTCCCAAGTAGCTGG + Intronic
1134508931 16:14830762-14830784 CTCAGCCTCTCCGGAGTATCTGG + Intronic
1134696632 16:16229596-16229618 CTCAGCCTCTCCGGAGTATCTGG + Intergenic
1134738897 16:16524920-16524942 CTCAGCCTCCCCCGAGTACCTGG + Intergenic
1134928602 16:18187233-18187255 CTCAGCCTCCCCCGAGTACCTGG - Intergenic
1135114807 16:19715529-19715551 CTCAGCCTCCCCTGAGTAGCTGG + Intronic
1135137497 16:19895732-19895754 CTCAGCCCCTCCTGAGTAGCTGG - Intergenic
1135261178 16:20982267-20982289 CTCAGCCTCCCCCAAGCAGCTGG - Intronic
1135397976 16:22145935-22145957 CTCAGCCTCCCCCAAGCAGCTGG + Intronic
1135463787 16:22667937-22667959 CTCAGCCTCTCCTGAGTAGCTGG + Intergenic
1135590053 16:23698700-23698722 CTCAGCCACCCCCCAGTAGCTGG + Intronic
1135880785 16:26253950-26253972 CTCAGCCTCTCTCAAGTAGCTGG - Intergenic
1136037900 16:27554346-27554368 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
1136267431 16:29129924-29129946 CTCAGCCTCCTCCAAGCCGCTGG - Intergenic
1136297678 16:29312956-29312978 CTGAGCCTCTCCTAAGTGGGTGG + Intergenic
1136410315 16:30072907-30072929 CTCAGCCTCTCCAGAGTAGCTGG + Intergenic
1137990665 16:53151366-53151388 CTCAGCCTCTCCCAAGTAGCTGG + Intronic
1138159200 16:54737420-54737442 CTCAGCTGCTCCCAAGTCCTTGG - Intergenic
1138297383 16:55898738-55898760 CTCAGCCTCTCCCATGGTGCTGG - Intronic
1138474149 16:57260796-57260818 CCCAGCCTCTCCCAGGCCTCAGG + Intronic
1138475388 16:57267762-57267784 TCCTGCCTCTCCCAAGTAGCTGG - Intronic
1138500264 16:57437638-57437660 CTCAGCCCCCACCAAGTAGCTGG + Intronic
1139453127 16:67048123-67048145 CCCAGCCTCTCTCAAGTAGCTGG - Intronic
1139816557 16:69679048-69679070 CTCAGCCTCTCATGAGTAGCTGG + Intronic
1139827891 16:69772074-69772096 CTCGGCCTATCCCAAGTAGCTGG + Intronic
1139903214 16:70344524-70344546 CTCAGCCTCTCCCGAGTAGCTGG + Intronic
1140168522 16:72579637-72579659 CTCAGCCACTTCCAAGTAGCTGG + Intergenic
1140200169 16:72888548-72888570 CTCAGCCTGCCCCATGTCCCTGG - Intronic
1141256068 16:82403550-82403572 CTGAGCCCCTCCCCAGTCTCAGG - Intergenic
1141389245 16:83650654-83650676 CTCAGCATCTCCCAATGCACAGG + Intronic
1141560747 16:84866348-84866370 CTCAGCACCCCCCAAGTAGCTGG + Intronic
1141884456 16:86882290-86882312 CTCAGGCTGTCCCAAGACCCAGG + Intergenic
1142070723 16:88090247-88090269 CTCAGCCTCCTCCAAGCCGCTGG - Intronic
1142194915 16:88734867-88734889 CTCACCCTCTTCCAGGTGGCTGG - Exonic
1142205289 16:88779969-88779991 CACAGCCGCTTCCAAGTCTCAGG - Intronic
1142376185 16:89708210-89708232 CTCAGCCTCTCCCAGACAGCAGG - Intronic
1142491460 17:282390-282412 CTCAGACTCTGCCAAGCCCCGGG - Intronic
1142636297 17:1259834-1259856 CTCAGCCTCCCCCGAGCAGCTGG - Intergenic
1142676918 17:1519326-1519348 CTCAGGCTCTGTCAAGTTGCAGG + Exonic
1142886526 17:2915947-2915969 CTCAGCCTCTCCCAAAGTGCTGG + Intronic
1143086773 17:4421893-4421915 CTCAGCCTCCCAGAAGTAGCTGG - Intergenic
1143225153 17:5295270-5295292 CTAAGCCTCTCTCAAATAGCTGG - Intronic
1143330968 17:6135434-6135456 CCAAGCCTCTCCAAAGTCTCCGG + Intergenic
1143503197 17:7350723-7350745 CTCAGCCTCCCCTGAGTAGCTGG + Intronic
1143560723 17:7692866-7692888 CTCAGCCTCTCCCGAGTAGCTGG + Intronic
1143740906 17:8953382-8953404 CTCTGCCTCTCTCAAGTGGGAGG + Intronic
1143869805 17:9949976-9949998 CTCAGCCTCTCCCGGGTAGCTGG + Intronic
1143906607 17:10214199-10214221 CTCAGCCTCTCCCAAGTAGCTGG - Intergenic
1143955655 17:10666457-10666479 ATGAGCCACTCCCAAGTAGCTGG - Intergenic
1144704056 17:17355788-17355810 CTCTCCCTCTCCAAAGCCGCAGG - Intergenic
1145937174 17:28721235-28721257 CTCAGCCTCCCGCGAGTAGCTGG - Intronic
1145952899 17:28833500-28833522 TCCTGCCTCTCCCAAGTAGCTGG - Intronic
1146020570 17:29275133-29275155 CTCAGCCCCCCCCAAGCAGCTGG + Intronic
1146076023 17:29730067-29730089 CTCAGCCTCTCCCGAAGTGCTGG - Intronic
1146166353 17:30592510-30592532 CTCAGCTTCTCCCAAGTACCTGG - Intergenic
1146262256 17:31429710-31429732 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1147241770 17:39095199-39095221 CTCAGCCTCCCCCACTCCGCTGG - Intronic
1147335767 17:39726217-39726239 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1147673812 17:42191707-42191729 CTCAGCCTCTCCCAAAGTGCTGG + Intronic
1147677087 17:42214864-42214886 CTCAGCCCCCCCCAAGTAGCTGG + Intronic
1147973714 17:44235597-44235619 CTCAGCCCCTCCCAAGGTGCTGG + Intergenic
1148111218 17:45145539-45145561 CTCAGCCTCCCGGAAGTAGCTGG + Intergenic
1148663500 17:49356310-49356332 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
1149458199 17:56806638-56806660 CTCAGCCTCTCCTGAGTAGCTGG + Intronic
1149668452 17:58383408-58383430 CTCAGCAACCCCCAAGTGGCTGG + Intronic
1149773011 17:59335798-59335820 CTCAGCCTCTGACAAGTCTTGGG + Intronic
1150372802 17:64655507-64655529 CTCAGCCTCCCCAAAGTCCAAGG + Intronic
1150377356 17:64692769-64692791 CTCAGCTTCTCCCAAGTACCTGG + Intergenic
1150724288 17:67638857-67638879 CTCAGCCTCCCCCAAAGTGCTGG - Intronic
1150777271 17:68091359-68091381 CTCAGCCTCTCCCGAGTAGCTGG - Intergenic
1150779474 17:68109020-68109042 CTCAGCCTCCCCAAAGTCCTGGG - Intergenic
1150868070 17:68875658-68875680 CTCAGCCTCTGCCATGTAGTGGG + Exonic
1150877282 17:68984100-68984122 CTCAGCCTCTGCCATGTAGTGGG + Exonic
1150965852 17:69967554-69967576 CTCAGCCTCTCCCAGGTAGCTGG - Intergenic
1151230704 17:72683169-72683191 CTCAGACTTTCCCATGTAGCTGG + Intronic
1151546924 17:74798987-74799009 CTCAGACTGTCCCAAGTGTCTGG + Intronic
1151558942 17:74860755-74860777 CTCCGATTCTCCCAGGTCGCAGG + Intronic
1151673084 17:75583207-75583229 CTCAGCTACTCCCGAGTAGCTGG - Intergenic
1151687368 17:75656189-75656211 TTCAGCCTCTTCCAAGTAGCTGG + Intronic
1152384494 17:79963098-79963120 CTCAGTCTCCCCCAAGTAGCTGG - Intronic
1153862181 18:9223368-9223390 CTCAGCCTCCCCCGAGTAGCTGG + Intronic
1154065889 18:11106662-11106684 CTCAGCCTCCCCAAAGTCCTGGG + Intronic
1154938611 18:21088379-21088401 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1155152281 18:23132846-23132868 CTCAGCCCCCCCCGAGTAGCTGG - Intergenic
1155185560 18:23383814-23383836 GTCAGCCTCTCCCTCGTCACTGG - Intronic
1157222330 18:45837276-45837298 CGCAGGCACTCCCAAGTCGAGGG + Intronic
1157932442 18:51838057-51838079 CCCAGGCCCTCCCAAGTAGCTGG - Intergenic
1158100025 18:53819937-53819959 TTCAGCCTCTCTAAAGTAGCAGG + Intergenic
1158932126 18:62332848-62332870 CTCAGCCTCTCTGAAGTCAGAGG - Intronic
1160878516 19:1308999-1309021 CTCAGCCTCTCGCGAGTGGCTGG + Intergenic
1160937414 19:1603488-1603510 CTCAGCCTCCCATAAGTAGCTGG - Intronic
1161191548 19:2959958-2959980 CTCAGCCCTGCCCAAGTAGCTGG - Intergenic
1161328459 19:3674617-3674639 CTCAGCCTCCCCCGAGTAGCTGG + Intronic
1161493469 19:4575329-4575351 CTCTGCCCCTCCCAAGAGGCTGG + Intergenic
1161658200 19:5529097-5529119 CTCAGCCTCCCCCGAGTAGCTGG + Intergenic
1161790529 19:6357159-6357181 CTCAGTCTCTCCCAAGTAGCTGG + Intergenic
1162056096 19:8065101-8065123 CTCAGCCTCTCCCAAGTAGCTGG - Intronic
1162440259 19:10688151-10688173 CACAGCCTCTGTCAAGTCCCTGG - Intronic
1163740282 19:19007567-19007589 CTCAGCCTCCCCCGAGTAGCTGG + Intronic
1163763869 19:19151615-19151637 CCCAGCCTCTACCATGTCACAGG + Intronic
1164445915 19:28317337-28317359 CTCAGCGTGTTCCAAGACGCAGG - Intergenic
1165044241 19:33092161-33092183 CTCAGCTTCCCCCGAGTAGCTGG + Intronic
1165221568 19:34320835-34320857 CTCAGCCTCTTCCAAGTAGCTGG + Intronic
1165368465 19:35385786-35385808 CTCAGCCTCCCTCAAGTAGCTGG + Intergenic
1165484212 19:36085554-36085576 CTCAGCCTCTCGAGAGTAGCTGG + Intronic
1165535425 19:36440291-36440313 CTCAGTCTCTGCCAAGTGACTGG - Intergenic
1165777002 19:38410662-38410684 CTCAGCCTCCCCGAAGTCCTGGG + Intronic
1166537630 19:43584961-43584983 CTCAGCCTCCCCCATGTAGTTGG + Exonic
1166795062 19:45420872-45420894 CTCAGCCTCTCCAAAGTGCTGGG + Intronic
1167585828 19:50375230-50375252 CTCAGCCTCTCCCGAGTAGCTGG + Intronic
1167843741 19:52142695-52142717 CTCAGCCTCTCTCAATGTGCTGG - Intergenic
1168318079 19:55492910-55492932 CTCAGCCTCTCCCAAGTAGCTGG - Intronic
1168527635 19:57101386-57101408 CTCAGCCTCCCGAAAGTAGCTGG - Intergenic
925022572 2:583267-583289 CTCGGCCGCTCCCTAGTCGTAGG - Intergenic
926225489 2:10964258-10964280 CTCAGCCTCTGCGAGGTCTCAGG - Intergenic
926356666 2:12047051-12047073 CTCAGCCTCCCCCGAGTAGCTGG + Intergenic
927291417 2:21408490-21408512 CACAGCCCCTCCCAAGACACAGG - Intergenic
927983808 2:27393369-27393391 CGCCGCCTCTCCTTAGTCGCCGG - Intronic
928315538 2:30241712-30241734 CTCAGCCTCCCCAAAGTGCCAGG + Intronic
928500054 2:31881891-31881913 CTCAGCCTCTCAAAAGTCCTGGG - Intronic
928510167 2:31995335-31995357 CTCAGCCTCTCCCGAGTAGCTGG - Intronic
928842938 2:35632800-35632822 CTCAGCCCCTCCCAAGTAGCTGG + Intergenic
928979157 2:37120388-37120410 CTCAGCCTCCCCGGAGTAGCTGG - Intronic
929150662 2:38745401-38745423 CTCGGCCTCTCCCAAAGTGCTGG - Intronic
929202624 2:39253246-39253268 CTCAGCCTCTCCCGAGTAGCTGG + Intronic
929474027 2:42227233-42227255 CACAGCCTGCCCCAAGTAGCTGG + Intronic
929705760 2:44210331-44210353 CTCAGCCTCTCCCAAGTAGCTGG + Intronic
930797046 2:55404844-55404866 CCCAGCCTCCCCCGAGTAGCTGG + Intronic
931304676 2:61017153-61017175 CTCACCTTCTCCCCAGACGCCGG + Intronic
931351659 2:61495782-61495804 CTCAGCCCCTCCCGAGTAGCTGG + Intronic
931463978 2:62471037-62471059 CTCAGCCTCTCTCCAGATGCAGG + Intergenic
931598425 2:63976233-63976255 CTCAGCAACCCCCAAGTAGCTGG - Intronic
932065362 2:68552249-68552271 CTCAGCCTCTCACACCTCTCAGG + Intronic
932704236 2:74010709-74010731 CCCTGCCTCTCCCATGTCCCTGG + Intronic
932723178 2:74154074-74154096 CCCAGCCTCTCCTGAGTAGCTGG - Exonic
932932655 2:76061017-76061039 CTCAGCCTCTCCCAAGTAGCTGG + Intergenic
933060810 2:77734873-77734895 CTGAGCCTCCCCCAAGCCGTGGG - Intergenic
934097475 2:88619837-88619859 CTCAGCCTCTCCCAATTAGCTGG - Intronic
934665278 2:96165046-96165068 CTCATCCTCTGCCATGTCGATGG + Intergenic
935760068 2:106312337-106312359 CTCTGCCCCTCCCAAGTAGCTGG + Intergenic
936450559 2:112630840-112630862 CTCAGCCTCTCCCGAGTAGCTGG - Intergenic
937219107 2:120331437-120331459 CTCACCCTCCCCCACCTCGCTGG - Intergenic
938769049 2:134484023-134484045 CTCAACCTCTCCCGAGTAGCTGG - Intronic
939067649 2:137503908-137503930 CTCAGCCTCCCCCAGGTAGCTGG - Intronic
941785952 2:169498688-169498710 CTCAGCCTCTCCGGAGTAGCTGG - Intronic
942238651 2:173938340-173938362 CTCAGCCTCTCCCGAGTAGCTGG - Intronic
942357415 2:175132969-175132991 CTCAGCCTCTCTCAAGTAGCTGG - Intronic
942374472 2:175322827-175322849 CTCAGCCTCCCCCAAGTAACTGG + Intergenic
943147975 2:184069663-184069685 CTCAGCCTCCCCCGAGTAGCTGG - Intergenic
943597837 2:189879234-189879256 CTCAGCCTCCCCCGAGTAGCTGG + Intergenic
944558993 2:200916366-200916388 CTCAGCATCCCACAAGTAGCGGG - Intronic
945258324 2:207821012-207821034 CTCAGCCTCCCCTGAGTAGCTGG + Intergenic
945291047 2:208127917-208127939 GTCAGCCTCTCCCAGGTCTCTGG + Intergenic
948117393 2:235503710-235503732 CTCAGCCCCCGCCAAGTAGCTGG + Intronic
948238218 2:236406557-236406579 GTCAGCCTCTTCAAAATCGCTGG - Intronic
1169260618 20:4135714-4135736 CTCAGCCTCTCCCAACCTCCAGG + Intronic
1169494291 20:6099286-6099308 CTCACCCTCCCCCAAGTAGCTGG - Intronic
1169791152 20:9412259-9412281 CTCCTCCTCTCCCAAGTAGTGGG + Intronic
1170769657 20:19321362-19321384 CTAAGCGTTTCCCAAGTCCCTGG + Intronic
1170862629 20:20122268-20122290 CTCAGCCTCTCCCGAGCAGCTGG + Intronic
1171998340 20:31751067-31751089 CTCAACCCCTCCTAAGTAGCTGG - Intronic
1172192791 20:33071979-33072001 CTCAGCCTCCCCCAAGCCTGAGG - Intronic
1172335159 20:34109982-34110004 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1172372544 20:34406136-34406158 CTCAGCCTCCCCCCAGCAGCTGG + Intronic
1172464205 20:35143654-35143676 ATCAGCCTCTCCCAAACCACAGG - Intronic
1172525390 20:35597944-35597966 TTCAGCCTCCCACAAGTAGCTGG + Intergenic
1172645154 20:36464443-36464465 CTCAGCCTCCTCCAAGTAGCTGG - Intronic
1172687808 20:36770179-36770201 CTCAGCCTCTCTCCAGTAGCTGG + Intronic
1172726909 20:37051293-37051315 CTCAGCCTCTCCCAAGTAGCCGG + Intronic
1173181976 20:40812706-40812728 CTCAGCGCCTCCCAAGGCCCTGG + Intergenic
1173422970 20:42919006-42919028 ATCAGCTTCTCCCACGTCTCAGG + Intronic
1173600589 20:44292269-44292291 TTCAGCCTCCCCCTAGTAGCTGG - Intergenic
1174333085 20:49836442-49836464 TCCTGCCTCTCCCAAGTAGCTGG + Intronic
1175030370 20:55947448-55947470 CTCAGCCTCTCCCGAGTAGCTGG - Intergenic
1175438415 20:58972366-58972388 CTCAGCCCCCTCCAAGTAGCTGG - Intergenic
1176089476 20:63312547-63312569 CCCAGCCTCTCCCCACTCACTGG - Exonic
1176193548 20:63825591-63825613 CTCAGCCTCTGCAAAGCGGCTGG + Intronic
1177575610 21:22950919-22950941 CTCAGCCTCCCCCAAGCAGCTGG - Intergenic
1178661264 21:34509704-34509726 CTCGGCCTCTCCCAAAGTGCTGG + Intergenic
1178806849 21:35846479-35846501 CTCAGCTTTCCCCAAGGCGCTGG + Intronic
1179064930 21:38016084-38016106 CTCAGCCTCTCAAAAGTAGCTGG + Intronic
1179127845 21:38607515-38607537 CTCAGCCTCTCAGGAGTAGCTGG - Intronic
1179635309 21:42704802-42704824 CCCAGCCTTTCCCAAGGCCCTGG + Intronic
1179942455 21:44648982-44649004 CTCTGCCCCTCCCAGGTCCCGGG + Intronic
1180665043 22:17504256-17504278 CTCAGCACCCCCCAAGTAGCTGG - Intronic
1180995729 22:19964359-19964381 CTCAGCCTCTCCAAAGAGCCAGG + Intronic
1181140580 22:20801767-20801789 CTCAGCCTCCCCCGAGTAGCTGG - Intronic
1181160090 22:20954841-20954863 CTCAGCCTCCCCTGAGTAGCTGG + Intergenic
1181300787 22:21879647-21879669 CTCAGCCTCCTCCAAGTAGCTGG - Intergenic
1181898284 22:26130396-26130418 CTCAGCCTCCCAAAAGTAGCTGG - Intergenic
1182232931 22:28852531-28852553 CTCAGCCTCTTCCAAAGTGCTGG - Intergenic
1182471738 22:30553098-30553120 CTCAGCCTCCCCTGAGTAGCTGG - Intergenic
1182980352 22:34664973-34664995 CTCAGCCTCCCCCAAGTAGCTGG + Intergenic
1183049504 22:35249308-35249330 CTCAGCCTCCCCCAAGTACTGGG + Intergenic
1183503720 22:38196691-38196713 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
1183951781 22:41356572-41356594 CTCAGCCTCTCCGAGGTGGGTGG + Intronic
1183959170 22:41400874-41400896 CTCAGCCTCCCCCAAGTAGCTGG + Intergenic
1184054846 22:42039020-42039042 CTCAGCCTCTCTTACGTAGCTGG + Intronic
1184470626 22:44693742-44693764 CTCAGCCTCCTACAAGTAGCTGG + Intronic
1184575486 22:45361509-45361531 CTTAGTCTCCCCCAAGTAGCTGG - Intronic
1184755539 22:46513907-46513929 CTCAGCCCCCCCCGAGTAGCTGG + Intronic
1185066018 22:48632113-48632135 CCCAGCCGCTCCCAACTCCCAGG - Intronic
1185279425 22:49963667-49963689 GTCTGCCTCTCCCAAGCCCCAGG + Exonic
1185318263 22:50188357-50188379 CTCAGCCTCTCCTGAGTAGCTGG + Intronic
949540636 3:5029347-5029369 CTCAGCCTCCCCAAAGTGCCGGG + Intergenic
949553305 3:5130648-5130670 CTCAGCCTCTCCCCAGTAGCTGG + Intronic
952757954 3:36888927-36888949 CTCAGCCTCTCCTGAGTAGTTGG - Intronic
953938013 3:47063358-47063380 CTCAGCCTCTTGCAAGTAGCTGG - Intronic
954658939 3:52216104-52216126 CTCAGCCTCCCCCGAGCAGCTGG - Intergenic
954821811 3:53336218-53336240 CTCAGTCTCTCCCGAGTAGCTGG + Intronic
955227046 3:57069035-57069057 CTCAGCCTCTCTCTAGTAACTGG + Intronic
955300683 3:57775570-57775592 CTCAGCCTCCCTCAAGCAGCCGG - Intronic
955414557 3:58680272-58680294 CTCTGCCTCCCCTAAGTCACTGG - Intergenic
957128733 3:76197022-76197044 CTCAGCCTCAGTTAAGTCGCTGG + Intronic
958490800 3:94769536-94769558 CTCAGCCTGCCCCGAGTAGCTGG - Intergenic
959525256 3:107369432-107369454 CTCTGCCTCTCCTGAGTAGCTGG + Intergenic
960221638 3:115118310-115118332 CTCAGCCTCTGCAGAGTGGCTGG + Intronic
961143289 3:124573616-124573638 CTCAGCAACCCCCAAGTAGCTGG + Intronic
961249658 3:125490405-125490427 CTCAGCCTCTCCGGAGTAGCTGG - Intronic
961545012 3:127627185-127627207 CTCAGTCTCCCCCAAGTAGCTGG + Intergenic
961567249 3:127772624-127772646 TCCAGCCTCTCCCTAGTTGCTGG - Intronic
962018797 3:131474380-131474402 CCCATCCTCTCCCCAGTCTCTGG - Intronic
962542127 3:136393388-136393410 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
963170738 3:142248793-142248815 CTCAGCCTCCTCCCAGTAGCTGG - Intergenic
963326487 3:143868989-143869011 CTCAGCCTCCCCCAAGTAGCTGG + Intergenic
963779207 3:149470256-149470278 TTCAGCCTCTCCCAGGACCCCGG + Intergenic
963827820 3:149973351-149973373 CTCAGCCTCCCAAAAGTAGCTGG + Intronic
964099602 3:152972876-152972898 CTCAGCCTCCCACGAGTAGCTGG - Intergenic
964446472 3:156764517-156764539 CTCAGCTACTCCCGAGTAGCTGG + Intergenic
965470319 3:169082132-169082154 TTCAGCCTCTCTCAAGTAGCAGG + Intergenic
965819969 3:172675184-172675206 CTCAGCCTCCCCTGAGTAGCTGG - Intronic
966516067 3:180821960-180821982 CTAATCCTCTCCCAAGTCCAGGG + Intronic
966563207 3:181346571-181346593 CTCAGCCTCTCCTGAGTAGCTGG + Intergenic
966752671 3:183337440-183337462 TCCTGCCTCTCCCAAGTAGCTGG - Intronic
967165411 3:186775461-186775483 CTCAGCCTTCCCCGAGTAGCTGG + Intergenic
967312737 3:188121492-188121514 CTCAGCCTCCCACAAGTAGCTGG + Intergenic
967340832 3:188395795-188395817 CTCAGCCTCTCCAAAGTAGTCGG - Intronic
967977723 3:195044759-195044781 CCCTGCCTCTCCCAAGGCTCAGG + Intergenic
968178886 3:196575339-196575361 CTCAGCCTCCCCCGAGTAGCTGG - Intronic
968185788 3:196632869-196632891 CTCCTCCTCTCCCACGTCTCAGG + Intergenic
968298218 3:197593481-197593503 CTCAGCCTCCCCCAAGTAGCTGG - Intergenic
968317281 3:197735837-197735859 CTCAGCCTCCCCCAAGGTGCTGG + Intronic
968528158 4:1075154-1075176 CACAGCCCCTCCCATGTGGCAGG - Intronic
968548672 4:1211336-1211358 CTCAGCCTCTCTGAAGTGGGCGG - Intergenic
968922937 4:3532050-3532072 CACAGCCTCCCCCAAGTGTCAGG - Intronic
970532037 4:16994653-16994675 CTCAGCCCCTTTCAAGTCTCTGG - Intergenic
970592545 4:17572002-17572024 CTCAGCCTCCCCCAGGTAGCTGG - Intergenic
971290876 4:25338206-25338228 CTCAGTCTCTCCCAAGTAGCTGG + Intronic
971295745 4:25389105-25389127 CTCAGCCTCCTCCGAGTAGCTGG + Intronic
971320773 4:25604104-25604126 CTCAGCCTCCCAAAAGTCGGAGG + Intergenic
971649809 4:29257292-29257314 TCCAGCCCCTCCCAAATCGCAGG - Intergenic
972445569 4:39140110-39140132 CCCAGCCCCCCCCAAGTAGCTGG - Intergenic
972572757 4:40326049-40326071 CTCAGCCTCCCCCATGTAGGAGG + Intergenic
972626798 4:40807462-40807484 CTCAGCCTCAACCTAGTAGCTGG + Intronic
973783274 4:54310919-54310941 CTCAGCCTCTCCTCAGTAGCTGG + Intergenic
973887445 4:55337381-55337403 CTCAGCCTCCCCAAAGTGGTGGG + Intergenic
975641758 4:76507651-76507673 CTCAGCCCCTCCCGAGTAGCTGG + Intronic
976873738 4:89828824-89828846 CTCAGCCCCTCCCAAGTAGCTGG - Intronic
977836605 4:101652607-101652629 CTCAGCCTGTCCCGAGTAGCTGG - Intronic
977938994 4:102837835-102837857 CTCAGCCTCTCCCGAGTAGCTGG - Intronic
977958894 4:103062169-103062191 CTCGGCGTCTCCCAAAGCGCTGG - Intronic
978592106 4:110335284-110335306 CTCAGCCTTCCCCATGTAGCTGG - Intergenic
978743580 4:112166161-112166183 CTCAGCCTCTCCCGAGTAGCTGG + Intronic
980031497 4:127837055-127837077 CTCAACCTCTCCTGAGTAGCTGG + Exonic
980312344 4:131147663-131147685 CTCCTCCTCTCCCAAGCCTCTGG + Intergenic
980893204 4:138836767-138836789 TTCAGCCCCTCCTAAGTGGCAGG + Intergenic
980944808 4:139308865-139308887 CTCAGCCTCTCCCAAGTGCTGGG + Intronic
981476754 4:145194825-145194847 CTCAGCCTCCCCCATGTAGATGG - Intergenic
982007669 4:151078942-151078964 CTCAGCCTCCCCCAAGTAGCTGG + Intergenic
982091179 4:151881108-151881130 CACAGGCTGTCCCAAGTTGCTGG - Intergenic
982184653 4:152783191-152783213 CTCAGCCCCTCCCAAGTAGCTGG - Intronic
983985425 4:174053779-174053801 CTCAACCTCCCCCAAGTAGCTGG - Intergenic
985243113 4:187951647-187951669 CTCAGCCTGTCCCAAGTAGCTGG + Intergenic
985555596 5:556479-556501 CTCGGCCTCCCCCCAGTAGCTGG + Intergenic
985708775 5:1416384-1416406 CTCAGGCTCTTCCAGGCCGCTGG - Intronic
985725552 5:1514125-1514147 TCCAGCCTCTCCCCAGCCGCTGG - Intronic
985940100 5:3128515-3128537 CTCAGCCACACCCAGGTCCCTGG + Intergenic
986094591 5:4542185-4542207 CTCAGCCTCCCCCAGGTGTCTGG - Intergenic
986432447 5:7694442-7694464 CTCCCCCTCCCCCAAGTCCCAGG + Intronic
986685776 5:10274175-10274197 CTCGGCCTCTCCCATGACACAGG + Intergenic
986689961 5:10306333-10306355 CTCAGGCTCTCCCAGGAGGCTGG - Intronic
988522417 5:31958503-31958525 CTCAGCCTCCCCAAAGTGCCGGG + Intronic
989160477 5:38386306-38386328 TCCTGCCTCTCCCAAGTAGCTGG + Intronic
990438302 5:55817580-55817602 CTCAGCCTCTCCCGAGTAGCTGG + Intergenic
990806544 5:59669226-59669248 CTCAGCCTCCCAAAAGTAGCTGG + Intronic
991210370 5:64097516-64097538 CTCAGTCTCTCTGAAGTCCCAGG + Intergenic
991418423 5:66415733-66415755 CTCTTCCTCTCCCCAGTCCCTGG - Intergenic
991708722 5:69385383-69385405 CTCAGCCTCCCCCGAGTAGTGGG + Intronic
991726217 5:69538420-69538442 CTCAGCCTCCTCCTAGTAGCTGG + Intronic
991868740 5:71089454-71089476 CTCAGCCTCCTCCTAGTAGCTGG - Intergenic
992121677 5:73599913-73599935 CTCAGCCTCCCCCGAGTAGCTGG + Intergenic
992222098 5:74583265-74583287 CCCAGCCTCTCCCACTTCACTGG - Intergenic
993314334 5:86380822-86380844 CTCAGCCCCTCCCAAGTAACTGG + Intergenic
996153156 5:120064681-120064703 CTCAGAGCCTCCCAAGTAGCTGG + Intergenic
996679597 5:126217130-126217152 CTCAGCCCCTGCCAAGTAGCTGG - Intergenic
996783630 5:127215107-127215129 CTCTGCCTCCCCCAAGTAGCTGG - Intergenic
996897308 5:128500557-128500579 CTCAGCCTCTCTCGAGTAGCTGG + Intronic
996944839 5:129054706-129054728 CTCAACCTCCCCCGAGTAGCTGG - Intergenic
997115400 5:131121310-131121332 CTCTGCCTCACACAAGTAGCTGG - Intergenic
997493005 5:134295129-134295151 CTCAGCCTCCCCCAAGTAGCTGG + Intronic
998209878 5:140187479-140187501 CTCAGTCTCCCCCAGGTAGCTGG + Intronic
998971581 5:147598113-147598135 CTCAGCCTCCCAAAAGTAGCTGG + Intronic
999226299 5:150027665-150027687 CTCAGCCTTTCCTGAGTAGCTGG + Intronic
999380479 5:151117820-151117842 CTCAGACTATCACAAGTCCCTGG - Exonic
1001108084 5:168872753-168872775 CTCAGCCTCTCCCGAGTAGCTGG + Intronic
1001393259 5:171397902-171397924 TTCTGCCTCTCCCAAGTAGTTGG + Intronic
1001645061 5:173274277-173274299 CTCAGACTCTCCTGAGTAGCTGG - Intergenic
1002051998 5:176576511-176576533 CTCAGCCTCCCCCAGTTCCCAGG - Intronic
1002343902 5:178535085-178535107 CTCAGCCTCCCCCCAGTAGCTGG + Intronic
1002369865 5:178742966-178742988 CTCAGCCTCCCTCGAGTAGCAGG + Intergenic
1002486716 5:179543468-179543490 CTCAGCCTCTCCGGAGTAGCTGG + Intergenic
1003177307 6:3761627-3761649 CTCAGCCTCCCCCACGCCGTGGG + Intergenic
1003241434 6:4349023-4349045 CTCAGCCTCTCCCGAGTAGCTGG + Intergenic
1003769874 6:9288414-9288436 ATCAGCCTCTCCTAATTCTCAGG + Intergenic
1004932886 6:20478692-20478714 CTCAGCCCTCCCCAAGTAGCTGG - Intronic
1005111236 6:22284203-22284225 CTCAGCCCCCCCCAGGTAGCTGG - Intergenic
1005266340 6:24116035-24116057 CTCAGCCTCCCCCAAGCAGCTGG - Intergenic
1005626403 6:27666462-27666484 CTCAGCCCTCCCCAAGTAGCGGG - Intergenic
1005645380 6:27832991-27833013 CTCAGCCTCCCCTGAGTAGCTGG + Intergenic
1005752037 6:28892367-28892389 CTCAGCCTCCCCCAACCTGCAGG - Intergenic
1005752152 6:28893605-28893627 CTCAGCCTCACCCAAGTGCTGGG + Intergenic
1006531007 6:34653852-34653874 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1006565202 6:34950341-34950363 CTCAGCCTCCCTCAGGTAGCTGG + Intronic
1006752432 6:36387136-36387158 AGCAGCCTCTCCCCACTCGCCGG - Intronic
1006768177 6:36527434-36527456 CTCAGCCCCTCCCAAGTAACTGG - Intronic
1006815575 6:36847674-36847696 CTCAGCCTCTGCCATGGCCCAGG + Intergenic
1006822905 6:36912689-36912711 CTCAGCCAGTCTCAACTCGCAGG - Intronic
1007467447 6:42064367-42064389 CTCAGCCTCCCCCAAGTAGTTGG + Intronic
1007547027 6:42702123-42702145 CTCAGCCCCTTCCAAATAGCTGG - Intronic
1007557549 6:42779733-42779755 CTCAGCCTCTCTGTAGTAGCTGG + Intronic
1007558739 6:42788009-42788031 CTCAGCCTCTCCTGAGTAGCTGG + Intronic
1007559224 6:42792380-42792402 CTCAGCCTCTACTGAGTAGCTGG + Intronic
1007648522 6:43401254-43401276 CTCAGCCTCCCGGAAGTAGCTGG - Intergenic
1007759126 6:44122040-44122062 ATGAGGCTCTCCCAAGTCACTGG - Intronic
1007986459 6:46211968-46211990 CTCAGCCCCTCCAAGGTAGCTGG - Intergenic
1008816221 6:55570020-55570042 CTCAGCCTCAGCCAAGTCCTGGG - Intronic
1011052802 6:83172283-83172305 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1011644002 6:89440672-89440694 CTTAGCCTCTCCCAAGTAGCTGG - Intronic
1011762101 6:90578387-90578409 CTCAGCCACCCCAAAGTAGCTGG + Intronic
1012900247 6:104996866-104996888 CTTAGCTTCCCCCAAGTAGCTGG - Intronic
1013201071 6:107896347-107896369 CTCAGTCTCTCTCTAGTAGCTGG - Intronic
1013251654 6:108340477-108340499 CTCAGCCTCTCCCAAGTAGCTGG + Intronic
1013836485 6:114341890-114341912 CTCAGTCTCTCCCAGAGCGCTGG - Intronic
1015015019 6:128402372-128402394 CTCAGCCTCCCCTGAGTAGCTGG + Intronic
1015490275 6:133817213-133817235 CTCAGCCTCCCCCGAGTAGCTGG - Intergenic
1015504474 6:133968101-133968123 CTCAGCCTCCCCCAAGTAGCTGG + Intronic
1017127275 6:151077934-151077956 CTCAGCCTCTCCGGAGTAGCTGG - Intronic
1017156037 6:151323434-151323456 CTCAGCCTCCCAAAAGTAGCTGG - Intronic
1017598233 6:156053222-156053244 CTCAGTCTCCCCTAAGTCTCTGG - Intergenic
1018185209 6:161260770-161260792 CTCAGCCCTCCCCAAGTAGCTGG - Intronic
1018768630 6:166953761-166953783 CTCAGCGCCTTCCAAGTAGCTGG - Intronic
1018873056 6:167797427-167797449 CACGGCCTCTCCCAAGGCGGAGG + Intergenic
1019255022 7:44066-44088 CTCAGCCTTTCCCCAGACACTGG + Intergenic
1020134913 7:5581784-5581806 CTCGGCCTCTCCCAAAGTGCTGG - Intergenic
1020566117 7:9797897-9797919 CTCAGCCTCCCCCAAGTAGCTGG + Intergenic
1025079966 7:55972987-55973009 CTCAACCCCTCCCAAGTAGCTGG - Intronic
1025172009 7:56767509-56767531 CTCAGCCCCTCCCAAGGAGCTGG - Intergenic
1025827108 7:65019435-65019457 CTCAAACTCTCCCAAGTAGGTGG - Intergenic
1025917685 7:65878789-65878811 CTCAGCCCCTCTCAAGTAGCTGG - Intronic
1026469953 7:70686645-70686667 CTCAGCCTCCCCCGAGAAGCTGG + Intronic
1026541450 7:71283146-71283168 CTCAGCCCCCCCCAAGTAGCTGG + Intronic
1026824340 7:73571944-73571966 CTCAGCCTCCCCCAAGTAGCTGG - Intronic
1027002053 7:74660304-74660326 CTCAGTCTCCCCCGAGTAGCTGG + Intronic
1028179327 7:87699518-87699540 CTCAGCCTCTCTCAAGTAGCTGG + Intronic
1028389664 7:90300900-90300922 CTCAGCCTCTGCCAAGTGTTGGG + Intronic
1029461891 7:100699460-100699482 CTCAGCCTTTCCCAAAGTGCTGG - Intergenic
1029686445 7:102151609-102151631 CTTAGCCTCTCCCAAGTAGCTGG - Intronic
1030717290 7:112824475-112824497 CTCAGACTCTCCTGAGTAGCTGG + Intronic
1030780201 7:113591531-113591553 CTCAGCCTAGCCCTAGTAGCTGG - Intergenic
1032100284 7:128970761-128970783 CCCAGCCACTCCAAAGGCGCAGG + Intronic
1032242962 7:130179847-130179869 CTCAGCCGCATCCAAGTAGCTGG - Intronic
1032485354 7:132282991-132283013 CTCAGCCCCCCCCAAGTAACTGG + Intronic
1033068101 7:138175583-138175605 CTCAGCCTCCCCCAAGTAGCTGG - Intergenic
1033094210 7:138415768-138415790 TTCAGCCTCCCCCACGTAGCTGG + Intergenic
1033255659 7:139799344-139799366 CTCAGCCTCCCCCAAGTAGCTGG + Intronic
1033336901 7:140461516-140461538 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1034418392 7:150976960-150976982 GTCATCCTCTCCCAACTCCCAGG + Intronic
1034475569 7:151279676-151279698 CTCAGCCTCTCCCAGTTCACTGG - Intergenic
1034739797 7:153463171-153463193 CCCAGCCCCTCCCAAATCTCAGG - Intergenic
1035199760 7:157254647-157254669 CTCAGCCTCCCCAAAGTGCCAGG + Intronic
1035207893 7:157306451-157306473 CTCAGCCCCTCCCTAGTAGTTGG - Intergenic
1035265141 7:157685970-157685992 CCCGGCCTCTCCCAGGTTGCAGG - Intronic
1035429603 7:158808857-158808879 CTCAGCCCCTCCCAAGTAGCTGG - Intronic
1035838834 8:2788522-2788544 CTGGGCGTCTCCCAAGGCGCTGG - Intergenic
1036216525 8:6884270-6884292 CTCAGCCCCCCCCAAGAAGCTGG + Intergenic
1036934445 8:12987573-12987595 TTCAGCCCCTCCCAAGTATCTGG - Intronic
1037155253 8:15691893-15691915 CTCAGCCTCACCCAAGTAACTGG + Intronic
1037499974 8:19476353-19476375 CTCAGCCTCCCCCAAGTAGCTGG + Intronic
1037543087 8:19890577-19890599 CTCAGCCTCTCCTGAGTAGCTGG - Intergenic
1037599821 8:20384560-20384582 CTCAGTCTCCTCCAAGTAGCTGG + Intergenic
1037758232 8:21725145-21725167 CTCAGCCTCTCCAGACTGGCTGG - Intronic
1037889641 8:22616996-22617018 CTCAGCCTCTCTCCAGTAGGTGG + Intronic
1038517123 8:28196787-28196809 CTCAACCTCTCCCAAATCACTGG - Intergenic
1038865414 8:31434215-31434237 CTCTGCCTCTCCTGAGTAGCTGG - Intergenic
1039059049 8:33559051-33559073 CTCAGCCTCTCCAAAGTACTGGG - Intronic
1039751613 8:40483775-40483797 TACAACCTCTCCCAAGTAGCTGG - Intergenic
1040063003 8:43120609-43120631 CTCAGCCTCCCCTGAGTAGCTGG + Intronic
1040105566 8:43539684-43539706 CCCTGCCTCTCCCAATTCCCAGG - Intergenic
1040363984 8:46695298-46695320 CTCAGGACCTCCCAAGTAGCTGG + Intergenic
1041598733 8:59689697-59689719 CTCAGCCTTTCCTGAGTAGCTGG - Intergenic
1041891126 8:62869882-62869904 CTCAGCCCCCCCGAAGTGGCTGG + Intronic
1043522360 8:81059899-81059921 CTCAGCCCCCCACAAGTAGCTGG - Intronic
1044656191 8:94550968-94550990 CTCAGCCTCACCAAAGTGCCGGG + Intronic
1047497497 8:125419052-125419074 GTGAGCATCTCCCAAGTCTCAGG - Intergenic
1047985192 8:130225992-130226014 TTCAGTCTCTCCCTAGTAGCTGG + Intronic
1048393050 8:133986244-133986266 CTGAGCCCCTCCCAAGTAGCTGG - Intergenic
1048801982 8:138202500-138202522 CTCAGCCTCTCAAAAGTAGTGGG + Intronic
1048867677 8:138772744-138772766 CTCAGCCTCTCCTGAGTAGCTGG - Intronic
1049268777 8:141683339-141683361 CCCAGCCGCTCCCAGGTCCCCGG + Intergenic
1049310304 8:141930629-141930651 CTCAGCATCTCACAGGGCGCAGG + Intergenic
1049319591 8:141988879-141988901 CTCGGACTCTCCCAGCTCGCGGG + Intergenic
1049419764 8:142511377-142511399 CCCAGCCTCTCCCCAGGCCCAGG - Intronic
1050210614 9:3251582-3251604 CTCAGCCTCCCCCAAATAGCTGG + Intronic
1050513749 9:6420588-6420610 CTCAGCCTCCCTGAAGTAGCTGG - Intronic
1050814872 9:9797729-9797751 CTCAGCCCCCCCCGAGTAGCTGG - Intronic
1052535233 9:29737836-29737858 CTCAACCTCTCCTGAGTAGCTGG - Intergenic
1052567483 9:30174948-30174970 CTCAGTGTCTCCCATGTAGCTGG - Intergenic
1053034431 9:34812119-34812141 CTCAGCCACCGCCAAGTAGCTGG - Intergenic
1053246627 9:36539726-36539748 CTCAGCCCCTCCCGAGTATCTGG - Intergenic
1054716355 9:68560780-68560802 CCCAGCCTCTCCAAAGTGGAAGG - Intergenic
1055196587 9:73601579-73601601 CTCAGTCTCTCCCAAAGCTCTGG + Intergenic
1055910371 9:81343798-81343820 CTTAGTCTCTCCCAAGTAGCTGG - Intergenic
1056400733 9:86224822-86224844 CTCAGCCTCTCCCATGTAGCTGG - Intronic
1057045865 9:91885988-91886010 CTCAGCCTCTCCCGAGTAGCTGG + Intronic
1057883831 9:98813612-98813634 CTCAGCTTCTCCCTAGTAGCTGG + Intronic
1058215618 9:102230017-102230039 CCCAGCCTCTCCCATGTATCTGG + Intergenic
1058512536 9:105735982-105736004 CTCAGCCTCTCAAAAATAGCTGG + Intronic
1058650841 9:107174613-107174635 CTCAGCCTAGCGCAAGTCCCTGG - Intergenic
1059178306 9:112188088-112188110 GTCAGCCTCTCCCAAACCCCAGG + Intergenic
1059283527 9:113154086-113154108 CTCAGCACCTCCCAAGTAGCTGG + Intronic
1060391857 9:123284244-123284266 CCCAGCCTCCCCCCAGTAGCTGG - Intergenic
1060832510 9:126725470-126725492 CTCAGCCTTTCCTGAGTAGCTGG + Intergenic
1060927162 9:127463080-127463102 CTCAGCCTCCCCCGAGTAGCTGG - Intronic
1061067136 9:128285573-128285595 CTCAGTCTCTGCCATGTGGCTGG - Intronic
1061162789 9:128905056-128905078 CTTAGCCTCCCCCAGGTAGCTGG - Intronic
1061289081 9:129640722-129640744 CTCAGCCTCTCTCCTGTCCCAGG - Exonic
1061375474 9:130221544-130221566 CTCACCTCCTCCCAAGTAGCTGG + Intronic
1061401511 9:130370851-130370873 CTCAGACTCTCCCAATTGGGTGG + Intronic
1061742115 9:132714858-132714880 CTCAGCCTCTCCCGAGTAGCTGG - Intergenic
1061848145 9:133399624-133399646 CTCAGCCCCTCCCAAAGTGCTGG - Intronic
1062623225 9:137431781-137431803 CTCCGCCTCTCCCCAGGTGCCGG - Intronic
1185455556 X:308848-308870 CTCAGCCTCTCTTGAGTAGCTGG + Intronic
1185477032 X:421486-421508 CTCAGCCTCTCCTGAGTAACTGG - Intergenic
1185563484 X:1078738-1078760 CTCAGCCTCTCCCAAGTAGCTGG + Intergenic
1185567944 X:1109945-1109967 TTCAGCCTCTCCTGAGTCACTGG + Intergenic
1185612397 X:1400650-1400672 CTCAGCCTCCCCCCTGTAGCTGG + Intergenic
1185665176 X:1759977-1759999 TCCTGCCTCTCCCAAGTAGCTGG - Intergenic
1185686121 X:1930061-1930083 CTCAGCCTCCCCCAAAGTGCTGG - Intergenic
1185691116 X:2155982-2156004 CTCTGCCTCTCCCAGCTCCCGGG + Intergenic
1185857047 X:3545267-3545289 CTCAGCCCCTCCTAAGTAGCTGG - Intergenic
1186023146 X:5279586-5279608 CTCAGCCTCTCCCGAGTAGCTGG - Intergenic
1186817341 X:13250963-13250985 CTTGGCCTCTCCCTAGTTGCAGG + Intergenic
1187366549 X:18670340-18670362 TTCAGCCTCCCCCGAGTAGCTGG + Intronic
1187688629 X:21841167-21841189 CTCAGCCTCCCCCAAAGTGCTGG - Intronic
1187917174 X:24164821-24164843 CTCAGCCTCCCAAAAGTAGCTGG - Intronic
1188175805 X:26987327-26987349 CTCAGCCTCATCCAAATTGCAGG - Intergenic
1190468401 X:50750374-50750396 CTCAGCCTCCCCCGAGTAGCTGG + Intronic
1190791950 X:53708700-53708722 CTCAGCCTCTCCTGAGTAGCTGG + Intergenic
1192208124 X:69109523-69109545 CTCAGCCTCACCAATGTCACAGG - Intergenic
1193466201 X:81850622-81850644 CTCAGCCTAACCCAAGTAGCTGG - Intergenic
1196804787 X:119574570-119574592 CGCTGCCTCTCCGAAGTCGAGGG - Exonic
1198215223 X:134549441-134549463 CTCGCCGTCTCCCAAGTCCCGGG - Intergenic