ID: 1083764076

View in Genome Browser
Species Human (GRCh38)
Location 11:64833804-64833826
Sequence TCCTGAGATGCCAGGGTCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 321}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083764067_1083764076 17 Left 1083764067 11:64833764-64833786 CCGGCCTCAGATCTGGCTCTCCT 0: 1
1: 0
2: 1
3: 34
4: 336
Right 1083764076 11:64833804-64833826 TCCTGAGATGCCAGGGTCCTTGG 0: 1
1: 0
2: 2
3: 33
4: 321
1083764065_1083764076 21 Left 1083764065 11:64833760-64833782 CCCTCCGGCCTCAGATCTGGCTC 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1083764076 11:64833804-64833826 TCCTGAGATGCCAGGGTCCTTGG 0: 1
1: 0
2: 2
3: 33
4: 321
1083764070_1083764076 -3 Left 1083764070 11:64833784-64833806 CCTCCATGCCTTGTGGCCTCTCC 0: 1
1: 0
2: 1
3: 45
4: 351
Right 1083764076 11:64833804-64833826 TCCTGAGATGCCAGGGTCCTTGG 0: 1
1: 0
2: 2
3: 33
4: 321
1083764071_1083764076 -6 Left 1083764071 11:64833787-64833809 CCATGCCTTGTGGCCTCTCCTGA 0: 1
1: 0
2: 5
3: 53
4: 378
Right 1083764076 11:64833804-64833826 TCCTGAGATGCCAGGGTCCTTGG 0: 1
1: 0
2: 2
3: 33
4: 321
1083764066_1083764076 20 Left 1083764066 11:64833761-64833783 CCTCCGGCCTCAGATCTGGCTCT 0: 1
1: 0
2: 4
3: 16
4: 207
Right 1083764076 11:64833804-64833826 TCCTGAGATGCCAGGGTCCTTGG 0: 1
1: 0
2: 2
3: 33
4: 321
1083764068_1083764076 13 Left 1083764068 11:64833768-64833790 CCTCAGATCTGGCTCTCCTCCAT 0: 1
1: 0
2: 4
3: 22
4: 276
Right 1083764076 11:64833804-64833826 TCCTGAGATGCCAGGGTCCTTGG 0: 1
1: 0
2: 2
3: 33
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083764076 Original CRISPR TCCTGAGATGCCAGGGTCCT TGG Exonic
900715363 1:4140567-4140589 CCCTGAGCTGCAAGGGGCCTTGG + Intergenic
900730622 1:4256802-4256824 TACTGAGATGTCAGGTTCCTTGG + Intergenic
900867884 1:5281572-5281594 TCCTGTGAGGCAAGGGTCCTGGG + Intergenic
900891023 1:5449763-5449785 GCCAGGGATGCCAGGGTCTTTGG - Intergenic
902642971 1:17778538-17778560 TCTTGGGATCCCAGGGTCCTTGG - Intronic
903290590 1:22311645-22311667 TCCTGAGGTGCGAGTGTGCTTGG + Intergenic
903578499 1:24353869-24353891 TCCTGAGATTTCAGCTTCCTGGG + Intronic
903803664 1:25988889-25988911 TGCTGAGATGCCAAGGCACTGGG + Intronic
904117802 1:28175331-28175353 CCCTTAGATGACTGGGTCCTGGG - Intronic
905841534 1:41184148-41184170 TCCTGGGATGTCAGGGTCAGGGG + Intronic
907902555 1:58754345-58754367 TCCTGTGCTCCCATGGTCCTAGG + Intergenic
910185358 1:84532915-84532937 TTCTGAGTTGCCAGGATCATTGG + Intergenic
910975413 1:92901316-92901338 AGCTGTGAGGCCAGGGTCCTAGG + Intronic
911038686 1:93575444-93575466 TCATGAAAAGCCAGGGCCCTGGG - Intronic
911623950 1:100099482-100099504 TCCTGGGCTCCCTGGGTCCTAGG - Intronic
915117056 1:153607840-153607862 TCCTGAGAAGACAGAGGCCTGGG + Intronic
916794468 1:168153125-168153147 TCAGGAGATGCCAGGTTCCTGGG - Intergenic
916848371 1:168676796-168676818 TCCTGAGAAGCCAGGGACTGTGG - Intergenic
918343022 1:183582578-183582600 TGCTGAGATTCCATTGTCCTGGG - Intronic
919818121 1:201454792-201454814 GCCTCACATGCCAGGGTCCTGGG - Intergenic
920069011 1:203289324-203289346 TCCTCAGGAGCCAGTGTCCTGGG - Intergenic
921306648 1:213803617-213803639 TCCAGAGATGGCAGGGTCAGGGG + Intergenic
923617270 1:235548380-235548402 TCCAGGGATGGCAGCGTCCTGGG - Exonic
924622917 1:245678020-245678042 GCCTGAGATGCCAGGGACCAGGG - Intronic
924732829 1:246727745-246727767 TCCTGAGATGCCAGTGTGCTTGG + Intronic
1063271906 10:4518761-4518783 TCCTCAGTTCCCAAGGTCCTGGG + Intergenic
1064828470 10:19433346-19433368 TCCTGAGATGGGAGGGATCTTGG + Intronic
1065368075 10:24953622-24953644 TGGTGAGATGTCAGGGACCTGGG - Intergenic
1068130513 10:52889899-52889921 TACTGAGACTGCAGGGTCCTGGG - Intergenic
1069617263 10:69814027-69814049 CCCTCAGATGTCAGGGTCCCGGG - Intronic
1070461900 10:76678538-76678560 TCCAGAGATGTCACGGCCCTAGG + Intergenic
1073039019 10:100586819-100586841 TCCTTAGATTCCAGGGTCTCTGG - Intergenic
1073080202 10:100854835-100854857 TCCTAAGAAACCAAGGTCCTGGG + Intergenic
1074832026 10:117255904-117255926 TGCAGAGCTGCCTGGGTCCTGGG + Intronic
1075382763 10:122032357-122032379 TCCTGAGGTGCTAGGGGCCTGGG - Intronic
1076265142 10:129103873-129103895 TCCTGAGCTGCCTGCCTCCTGGG - Intergenic
1076822561 10:132946722-132946744 TGCTGAGATGCTGGGGTGCTGGG - Intergenic
1076822569 10:132946754-132946776 TGCTGAGATGCTGGGGTGCTGGG - Intergenic
1076822592 10:132946842-132946864 TGCTGAGATGCTGGGGTGCTGGG - Intergenic
1076822608 10:132946906-132946928 TGCTGAGATGCTGGGGTGCTGGG - Intergenic
1076875413 10:133213356-133213378 TCCCGGGATGGCAGGGACCTGGG - Intronic
1078450589 11:11437856-11437878 TCCAGCTATGCCAGGGTTCTGGG + Intronic
1078470730 11:11584139-11584161 CCCTGAGATTCCAGGGAACTTGG + Intronic
1079033012 11:16999534-16999556 GCCTGGGAAGCCAGGTTCCTGGG - Intronic
1080712977 11:34769339-34769361 TGCTGTGGGGCCAGGGTCCTAGG + Intergenic
1081833900 11:46137604-46137626 CCCTGAGATTCCATAGTCCTGGG - Intergenic
1083764076 11:64833804-64833826 TCCTGAGATGCCAGGGTCCTTGG + Exonic
1083894530 11:65613520-65613542 TCCTGAGATGGCTGCGTCCCGGG + Exonic
1084284554 11:68122447-68122469 TCCTGGGCTGCCAGGGGCTTAGG + Intergenic
1084639188 11:70414364-70414386 TCCTGGGAGGCCCGGGTCCTTGG - Intronic
1086327599 11:85719709-85719731 CCCTGAGATTCCAAGATCCTTGG + Intronic
1087022757 11:93619585-93619607 TCCTGAGATGGCAGGCTGATGGG + Intergenic
1088326300 11:108604740-108604762 TCCTGAGACCCCAGGGTCAAAGG + Intergenic
1088734959 11:112720960-112720982 TCCTGAGATCCCAGCCTCCCTGG - Intergenic
1089073563 11:115719104-115719126 TTCAGAGATGCAAGGGTCCAAGG + Intergenic
1089627746 11:119762329-119762351 CCCTGACCTTCCAGGGTCCTGGG + Intergenic
1091317429 11:134624389-134624411 ACCTGAGATGCCCTGGTCATTGG - Intergenic
1092157870 12:6296096-6296118 TGATGAAGTGCCAGGGTCCTAGG + Intergenic
1094831700 12:34303251-34303273 TCCAGGGATGCCAGGATCCCCGG - Intergenic
1094833511 12:34311597-34311619 ACCAGGGATGCCAGGGTCCCTGG + Intergenic
1094835138 12:34318746-34318768 ACCAGGGATGCCAGGATCCTTGG + Intergenic
1094837523 12:34329104-34329126 TCCAGGGATGCCAGGATCCCTGG + Intergenic
1096112892 12:49039757-49039779 GCCGGACATGCCTGGGTCCTGGG + Exonic
1096127314 12:49129460-49129482 ACCTGAGATCCCAGGATGCTGGG - Intronic
1096583356 12:52602577-52602599 TCTTAAGCTGCCAGAGTCCTGGG + Intergenic
1096604429 12:52754505-52754527 TCCTGAGAAGCCAGTGCCCAGGG - Intergenic
1099577861 12:84403642-84403664 TCCCGAGATGGCAGGGGCCAAGG + Intergenic
1099732655 12:86525520-86525542 TTCTGAGTTGTCAGGGTTCTTGG + Intronic
1100401985 12:94239811-94239833 TTCTGAGATGCCTGGGCTCTTGG + Intronic
1102534083 12:113568041-113568063 TCCTGTGATACCAGGGCCCCTGG - Intergenic
1102803969 12:115763084-115763106 TCCTTAGTGCCCAGGGTCCTTGG + Intergenic
1104972466 12:132538169-132538191 TCCTGAGACGGAAGGGGCCTGGG + Intronic
1105029680 12:132874035-132874057 TCCAGAGGTGCCACGTTCCTTGG - Intronic
1105291891 13:19058612-19058634 GCCTGAGTTGCCACCGTCCTGGG - Intergenic
1106563266 13:30864488-30864510 TCCTAATATGCCACGATCCTTGG + Intergenic
1110631625 13:77714487-77714509 TCCTGAGTTGCTAGGATCATAGG - Intronic
1112099690 13:96174492-96174514 ACCTGAAATGCCAGGTTACTTGG - Intronic
1113785089 13:112998313-112998335 CCCTGACATGCCAGGGCCCTGGG - Intronic
1114086666 14:19240377-19240399 ACCAGGGATGCCAGGGTCCCCGG + Intergenic
1115216553 14:31019065-31019087 TCCTGAGATGCCAAGGTAGGAGG + Intronic
1116576746 14:46585008-46585030 TGCTGGCATGCCAGGTTCCTGGG + Intergenic
1117508600 14:56426779-56426801 TCCTGAGAGCCTAGGGACCTGGG + Intergenic
1120573696 14:86153820-86153842 TCCTGAGGTGCCAGTGTGCTTGG + Intergenic
1121955145 14:98206826-98206848 TCCAGAGAATCCTGGGTCCTAGG - Intergenic
1202898199 14_GL000194v1_random:21990-22012 ACCAGGGATGCCAGGGTCCCCGG + Intergenic
1202898304 14_GL000194v1_random:22380-22402 GCCAGGGATGCCAGGGTCCCCGG + Intergenic
1202898464 14_GL000194v1_random:23015-23037 ACCAGGGATGCCAGGGTCCCTGG + Intergenic
1202899727 14_GL000194v1_random:28145-28167 ACCAGGGATGCCAGGGTCCCTGG + Intergenic
1125979125 15:43983849-43983871 TAGTGAGAGGCCAGGGTCCCAGG + Intronic
1126528992 15:49690748-49690770 CCCTGAGATGGCAGAGTGCTAGG + Intergenic
1126845020 15:52751459-52751481 TCCTCAAATGTCAGGGTACTGGG - Intergenic
1128128168 15:65208102-65208124 TCCTGAGCAGCCAGTGGCCTGGG + Intronic
1128315667 15:66657707-66657729 TCCTGAGATCCCAGGACTCTAGG - Intronic
1131150786 15:90046129-90046151 CCCTGAGATGTCAGTGGCCTGGG + Intronic
1131183393 15:90255686-90255708 TCCTGGGATGCCCAGGTGCTAGG + Intronic
1132630520 16:915080-915102 TTCCTAGATGGCAGGGTCCTGGG + Intronic
1132678034 16:1128752-1128774 TCCTGAGAGCCTGGGGTCCTTGG + Intergenic
1133459492 16:5974882-5974904 TCCTGAGTAGCCAGGGTAATAGG - Intergenic
1134121304 16:11586753-11586775 TCCTGGGATGCCAGGGGGCGCGG - Intronic
1134406953 16:13969413-13969435 TCCAGAGATGCCAGGAGCCAAGG + Intergenic
1134861938 16:17568131-17568153 AACAGAGATGCCAGGGTCATGGG - Intergenic
1135132818 16:19866938-19866960 TCCAGAGATGCAAGGGCTCTGGG - Intronic
1135274256 16:21097676-21097698 ACCTCAGCTGCCAAGGTCCTTGG - Intronic
1138552200 16:57754085-57754107 TCCTGAGAGGGGAGGGTCCTGGG - Intronic
1140772068 16:78214153-78214175 TCCTGAGACGTGAGGGTCCAGGG - Intronic
1140860490 16:79013617-79013639 TCCTGTGCTGCCTGGGTCCCGGG + Intronic
1141572398 16:84941854-84941876 TCCAGAGAGGTCCGGGTCCTGGG - Intergenic
1142253139 16:89001975-89001997 TCTTGAGATGACATCGTCCTGGG - Intergenic
1143163432 17:4885824-4885846 TCCTGAGAGGCCAGGATGGTGGG + Intronic
1143165343 17:4894655-4894677 TGCTGTGAGGCCAGGGTCCAGGG + Intronic
1143373383 17:6454111-6454133 AGCTGAGATTCCAGGGTTCTAGG - Exonic
1143914196 17:10276718-10276740 TTGTCAGATGCCAGGGTTCTTGG + Intergenic
1145104461 17:20103691-20103713 TCCTGGGATGCCATGCTCCTAGG - Intronic
1145902308 17:28496876-28496898 TCCTGAGCTTCCAGGGCCCTGGG - Intronic
1148195420 17:45709531-45709553 TGCTAAGATGCCAGGATCCTGGG + Intergenic
1148245096 17:46025228-46025250 TCCAGAGATGCCAGTGGCCCAGG - Exonic
1148485857 17:47990566-47990588 TCTTAAGATGCCAGGCTCCCTGG - Intergenic
1149188647 17:54031462-54031484 TCCTGAGATGTCTGGGAGCTAGG - Intergenic
1149507470 17:57206338-57206360 CCCTGAGATGGCAGGGCCCATGG - Intergenic
1150520927 17:65866097-65866119 TGCTGAGATGCCTGGGTACGTGG - Intronic
1151030668 17:70734180-70734202 TCCTGAGATGCTTGTGCCCTAGG - Intergenic
1151465450 17:74282014-74282036 ACCTGACAGGCCAGGGCCCTTGG - Intronic
1153014770 18:573665-573687 TCCTGACGTTCCAGGGCCCTTGG + Intergenic
1153463663 18:5364942-5364964 TCCTGAGATGACAAGCTCCTTGG - Intergenic
1153776200 18:8456354-8456376 ACCTGAGATTGCAGAGTCCTGGG + Intergenic
1156917249 18:42476348-42476370 ACCTGAGATCCCAGGGTACACGG - Intergenic
1156921286 18:42525165-42525187 TCCTGAGATGCCTGTCACCTGGG + Intergenic
1157129939 18:44997279-44997301 TCCCGAGATGGCAGGTTTCTGGG - Intronic
1157239529 18:45996670-45996692 TCCTGAGTTGCCAGGGTTACAGG - Intronic
1157848549 18:51026813-51026835 AACTGAGAGGCCAGGGTACTGGG + Intronic
1158416949 18:57256993-57257015 GCCTGAGATGCTAGGGGACTGGG + Intergenic
1158547886 18:58411376-58411398 TCCAGAGATGCCAGTTTCCCTGG + Intergenic
1158941502 18:62409424-62409446 TCCTGAAATGCCCATGTCCTTGG + Intergenic
1160152010 18:76402383-76402405 TCCTAAGATGCCTAGGTCCGAGG + Intronic
1160160211 18:76465045-76465067 TCCAGAGGTGCCAGGGCCCAGGG + Intronic
1160879118 19:1311529-1311551 CCCTGAGCTGCCAGGGCACTGGG - Intergenic
1160989805 19:1855845-1855867 TCCCGGAATGCCAGGGTCCAGGG - Intronic
1161806191 19:6444343-6444365 GCCTTTGAAGCCAGGGTCCTAGG - Intronic
1163284101 19:16335530-16335552 TCTTGAGATGGCCGGGGCCTAGG - Intergenic
1163721203 19:18899044-18899066 TCCTGCTGTGGCAGGGTCCTGGG - Intergenic
1163731038 19:18949285-18949307 CCCTGAGAGGCCTGGGTCCTGGG - Intergenic
1164888382 19:31802824-31802846 TCCTCAAAAGCCAGGGTCCCCGG - Intergenic
1165077905 19:33290978-33291000 TCCTAGGATGCCTGGCTCCTGGG + Intergenic
1166761549 19:45227587-45227609 ACCTGGGATGCCCGGATCCTGGG - Intronic
1167387372 19:49171797-49171819 TCCTGAGATGGGAGGGAACTGGG + Intronic
1167741618 19:51327536-51327558 TCCTGAGAGGCCAGGGTGCCTGG + Intronic
1167970068 19:53183747-53183769 ACCTGAGGGGCCAGAGTCCTAGG + Intronic
1168713073 19:58512752-58512774 GCCTGACCTGCCAGGCTCCTAGG - Intergenic
925051252 2:817245-817267 GGCAGAGATGCCAGGGGCCTGGG + Intergenic
925683440 2:6447306-6447328 TACTGAGATGCCAGGATTTTTGG - Intergenic
925932731 2:8723171-8723193 TGCTGAGCTGCCAGGGTGCATGG - Intergenic
926302696 2:11616084-11616106 TCCTGAGATGCCAGGGAGCACGG - Intronic
926307558 2:11649626-11649648 TCCAGAGTTTCCTGGGTCCTCGG + Intergenic
927577277 2:24210088-24210110 CCCTGAGAGGCCAGTGCCCTGGG + Intronic
927695267 2:25235521-25235543 TCCTGACACCCCAGGCTCCTGGG - Intronic
927706524 2:25299592-25299614 CCCTGAGAAGCCAGGGGACTTGG - Intronic
931178165 2:59874123-59874145 CACAGTGATGCCAGGGTCCTGGG - Intergenic
931528430 2:63185593-63185615 TCCTGTGAAGCCAGGGTTATAGG + Intronic
932842778 2:75099212-75099234 CACTGAGATGCCAGAGTGCTGGG - Intronic
933719673 2:85389991-85390013 GCCTTAGATGTCAGGCTCCTGGG + Intronic
934102643 2:88667468-88667490 TCCTGACATGCCAGGCTATTGGG - Intergenic
934601653 2:95662884-95662906 TCCTAAGATGCCAGGCCCCATGG - Intergenic
935659828 2:105456752-105456774 GTCTGAGATGCATGGGTCCTGGG + Intergenic
936535337 2:113306720-113306742 TCCTAAGATGCCAGGCCCCATGG - Intergenic
937115880 2:119404658-119404680 TCCAGAGAGGACAGAGTCCTGGG - Intergenic
938490087 2:131756691-131756713 ACCAGGGATGCCAGGGTCCCCGG - Intronic
939039584 2:137172166-137172188 TCCTGAGATACAGGGGTGCTAGG + Intronic
939936901 2:148304094-148304116 TCCTGAGATTTCAGACTCCTAGG - Intronic
943656682 2:190516570-190516592 TGCTGGGATGGCAGAGTCCTAGG + Intronic
944449241 2:199824134-199824156 GCTAGAGATGCCAGGCTCCTGGG + Intronic
944890407 2:204111196-204111218 TCCAGAGTTGCCAGTGTTCTGGG + Intergenic
944995354 2:205287808-205287830 TACTGAGATGTCAGGGTACATGG - Intronic
945041330 2:205745933-205745955 TCGTGGGATGCCAGGGTCAGAGG - Intronic
947518000 2:230823743-230823765 CCCTCAGCTGCCAGTGTCCTTGG + Intergenic
947743171 2:232494216-232494238 TCCTTGGCTGCCAGGGTCCTGGG + Intergenic
948215344 2:236224997-236225019 GCCTGAGATGCCAGGCTCACAGG - Intronic
948403734 2:237702469-237702491 TCCTGAGAAGCCAGGGAGCCTGG + Intronic
948784026 2:240341553-240341575 TCCCGAGATGCCAGAGGCTTTGG - Intergenic
948926158 2:241099645-241099667 TCCTGTGGTACAAGGGTCCTTGG - Exonic
949021691 2:241744453-241744475 TCCAGAGGTGGCTGGGTCCTGGG + Intronic
1169111393 20:3036498-3036520 GCCTGAGATGCCAGTTTCCCAGG + Intronic
1169263805 20:4155709-4155731 GCCTGAGGTGCAAGGGGCCTTGG - Intronic
1170795274 20:19541577-19541599 TCCTGAGATGCTAGGGATTTGGG - Intronic
1171483797 20:25472754-25472776 TCCTGGGCTCCCAGAGTCCTGGG + Intronic
1171523968 20:25795506-25795528 TCCTGAGCGGCCAGTTTCCTAGG - Intronic
1171552859 20:26060377-26060399 TCCTGAGCGGCCAGTTTCCTAGG + Intergenic
1173666303 20:44765783-44765805 TCCCGAGATGTCTGGGTCATCGG - Intronic
1174050240 20:47762683-47762705 GCCTGTGATGCCAGGGTACAGGG + Intronic
1174278033 20:49417750-49417772 TCCTTAGAAGCCAGGCGCCTGGG - Intronic
1175799653 20:61794182-61794204 TCCTGAGCTGCCAGGGTGAGAGG - Intronic
1175818481 20:61895991-61896013 CCCTGAGATGCCAGGATCTCAGG + Intronic
1175964408 20:62653281-62653303 TCCTGAGATCCCTGTGGCCTTGG + Intronic
1176413427 21:6461216-6461238 TGCTGAACAGCCAGGGTCCTTGG + Intergenic
1176617991 21:9038373-9038395 GCCAGGGATGCCAGGGTCCCCGG + Intergenic
1176618146 21:9039005-9039027 ACCAGGGATGCCAGGGTCCCTGG + Intergenic
1176619102 21:9042919-9042941 ACCAGGGATGCCAGGGTCCCTGG + Intergenic
1176707050 21:10124905-10124927 ACCAGGGATGCCAGGGTCCCTGG - Intergenic
1178428578 21:32499347-32499369 TCCGGAGCTGCCAGGGTCCCAGG + Intronic
1178756277 21:35353185-35353207 TCCTGTGATACCAGTCTCCTTGG + Intronic
1178813924 21:35909908-35909930 AGCTGAAATGCCAGGGCCCTGGG + Intronic
1178848748 21:36195408-36195430 TCCTGAGTAGCCAGGGTTATAGG - Intronic
1179688924 21:43069539-43069561 TGCTGAACAGCCAGGGTCCTTGG + Intronic
1179732076 21:43373682-43373704 CCGTGAGATGCCAGGACCCTGGG + Intergenic
1180148559 21:45935685-45935707 TCCTGAGGGGCCAGGGCCCATGG - Intronic
1180291199 22:10852361-10852383 ACCAGGGATGCCAGGGTCCCCGG - Intergenic
1180354177 22:11824979-11825001 ACCAGGGATGCCAGGGTCCCTGG + Intergenic
1180384067 22:12167347-12167369 ACCAGGGATGCCAGGGTCCCTGG - Intergenic
1181111723 22:20606438-20606460 TCTTCAGAAGCCAGGGTCATGGG + Intergenic
1181583860 22:23842384-23842406 TCCTGGGAGGCCAGGAGCCTGGG + Intergenic
1182516066 22:30859822-30859844 TCCCGAGATGTCAGGACCCTGGG + Intronic
1183176863 22:36230744-36230766 TCCTGAGAGGCCTAGTTCCTGGG - Intronic
1183310889 22:37109061-37109083 GCCTGTGAGCCCAGGGTCCTGGG + Intronic
1184646134 22:45896493-45896515 TCCCCAGATGCCAGGTCCCTGGG + Intergenic
1184889567 22:47371533-47371555 TCCTCAGAAGCCAGAGTCCTGGG - Intergenic
949822393 3:8129761-8129783 TTCTGAGATACCAGGTTGCTAGG + Intergenic
950139378 3:10604668-10604690 TCCAGAGATGTCAGGGACCCAGG - Intronic
951638234 3:24804276-24804298 TCCTGAGAGTACAGGGACCTGGG - Intergenic
953138758 3:40207805-40207827 TCTTCAGATGACAGTGTCCTAGG - Intronic
954271114 3:49509985-49510007 TCCCAAGATGCCAGGATCATAGG + Intronic
954941695 3:54378774-54378796 CCCTGAGCTGCCTTGGTCCTTGG + Intronic
955501773 3:59592302-59592324 TCCTGAGTAGCCAGGATCGTAGG + Intergenic
955919642 3:63942035-63942057 TCCTGAGATGCTAGGACTCTCGG - Intronic
957730230 3:84125338-84125360 TGCAGAGATGCCTGGGTCCTGGG - Intergenic
957950035 3:87112703-87112725 TCCTAGGATCCCAGGCTCCTGGG + Intergenic
960159258 3:114332184-114332206 TCCTGAGAGTCCAGGCTTCTGGG - Intergenic
961447412 3:126987437-126987459 TCCTGGATTGCCAGGGTACTCGG - Intergenic
961934944 3:130573357-130573379 TTCTGAGATGCCAGAGAACTGGG - Intronic
961974020 3:131003651-131003673 TCCTGAGAGGGGAGGGTCTTCGG - Intronic
963004279 3:140711440-140711462 TCCAGAGATGCCAGGTTCAAAGG + Intergenic
965193176 3:165557895-165557917 TCCTGAGATTCCTGAGTCTTAGG + Intergenic
966732966 3:183165608-183165630 TCCTTATATGCCAGAGTTCTAGG - Intergenic
966831903 3:184017449-184017471 GCCTGGGATGCCCGGGCCCTAGG + Intronic
966904366 3:184511098-184511120 AGCTGACATGCCAAGGTCCTTGG + Intronic
967366478 3:188692188-188692210 GCCTGCTATGCCAGGGTCCTGGG + Intronic
968405545 4:336881-336903 TCCTGGGAACCGAGGGTCCTGGG + Intergenic
968701934 4:2061501-2061523 GCCTGCAGTGCCAGGGTCCTGGG + Intronic
969270205 4:6094493-6094515 TCCTGAGACCCCAGGGGCCCCGG - Intronic
969393503 4:6906469-6906491 TCCTGAGATGCGGGGGTGCTCGG + Intergenic
970598547 4:17622105-17622127 TCCTGAGTTTCCAGGAACCTGGG - Intronic
971587236 4:28419830-28419852 TCCTGAAATGACAGACTCCTGGG + Intergenic
972184853 4:36516143-36516165 TCCTGAGATGCCAAGGTTGGGGG - Intergenic
972818926 4:42676597-42676619 TGCTGGGATGCCAGGCTTCTGGG - Intergenic
973373992 4:49275672-49275694 ACCAGGGATGCCAGGGTCCCTGG - Intergenic
973383420 4:49334567-49334589 ACCAGGGATGCCAGGGTCCCTGG + Intergenic
973387027 4:49519581-49519603 ACCAGGGATGCCAGGGTCCCTGG + Intergenic
974051833 4:56949129-56949151 TCCCGGGATGCCAGGCTTCTGGG + Intergenic
977607362 4:98996033-98996055 TCCTGGGGTCCCTGGGTCCTCGG + Intronic
979709026 4:123755788-123755810 GGCTGAGCTGACAGGGTCCTTGG - Intergenic
982114739 4:152088727-152088749 TCCTGAGATCACCGGTTCCTCGG - Intergenic
982409082 4:155053089-155053111 TCCTGAGATGAGATTGTCCTAGG - Intergenic
983566553 4:169158980-169159002 CCCTGAGAGGCCAATGTCCTGGG + Intronic
983996977 4:174194135-174194157 TACTGAGATGCCATGATCCCTGG + Intergenic
984837375 4:184034184-184034206 TCCTGTCATGCCTGGGTCTTTGG + Intergenic
985587923 5:750551-750573 TCCCGTGATGCCAGCATCCTCGG - Intronic
985602592 5:843018-843040 TCCCGTGATGCCAGCATCCTCGG - Intronic
986281528 5:6327019-6327041 TCCAGAGATGCATGGCTCCTTGG - Intergenic
988442093 5:31244750-31244772 TCTTGAAATGCCTGGGACCTAGG + Intronic
991719451 5:69481758-69481780 TCCTAAGAGGCCATGGTCCGTGG + Intergenic
992068671 5:73129950-73129972 GCCTGAGGTGCCAGGAGCCTGGG + Intronic
993939470 5:94041019-94041041 TGCTGACATGCCAGGCTTCTGGG - Intronic
994316547 5:98339640-98339662 TCCTGCCATGCCAGGGTACATGG - Intergenic
995234514 5:109812032-109812054 TGATGATGTGCCAGGGTCCTTGG + Intronic
996028396 5:118677730-118677752 TCCTGGAAGGTCAGGGTCCTAGG + Intergenic
996453240 5:123651512-123651534 TCCTGTGTTCCCAGGGTCCCAGG + Intergenic
997669171 5:135656398-135656420 AGCTGAGATCCCTGGGTCCTGGG + Intergenic
998174749 5:139894900-139894922 AGCTGAGATGCCAGGCACCTGGG - Intronic
999331189 5:150674450-150674472 TGCTCAGCTTCCAGGGTCCTGGG + Intronic
999458199 5:151735796-151735818 TCCAGAGATGTCAGGGGCCTTGG - Intergenic
999801815 5:155045458-155045480 TCCTGAGAACCCAGGGTGATTGG - Intergenic
1000049412 5:157548957-157548979 TCCTGAGATGCAAGGCTGGTGGG - Intronic
1001091957 5:168748259-168748281 TGGTGAGATGACAGGGTGCTTGG + Intronic
1001292454 5:170473604-170473626 TGCTGAGCTGCCAGGGGCCCTGG - Intronic
1001946968 5:175787353-175787375 TCCTGAGATTGGAGAGTCCTTGG - Intergenic
1003060045 6:2855769-2855791 GACTGGGATGCCATGGTCCTAGG - Intergenic
1005386926 6:25294249-25294271 TCCTGAGACTCCAGGGCCCAGGG - Intronic
1005845332 6:29772542-29772564 TCCTGAGAGGTCTGGGCCCTTGG - Intergenic
1007421153 6:41720530-41720552 TCCTGAGCGGCCAGCCTCCTGGG - Intronic
1007806303 6:44451974-44451996 TGCTGAGGTGCCAGGGTGCCAGG + Intergenic
1008515058 6:52311026-52311048 ACCATAGATGCCAGAGTCCTGGG - Intergenic
1011763374 6:90592515-90592537 TCCTGGGATGCCAGAGACCTAGG - Intergenic
1015877422 6:137837028-137837050 TCCATAGATTCCAGGGTCCAGGG - Intergenic
1015926778 6:138318338-138318360 TCCTTAGATGACAGGCTCCTAGG - Intronic
1018717073 6:166541548-166541570 TTCTGAGGTGCCAGCGTCCATGG - Intronic
1019563517 7:1669094-1669116 GCCTGACACGCCCGGGTCCTAGG - Intergenic
1021493439 7:21246009-21246031 TCATGATATGCCAGATTCCTGGG - Intergenic
1022259960 7:28694803-28694825 TCCTGAGTAGCCAGGGTTATAGG + Intronic
1022646240 7:32230753-32230775 CCCTGAGAGGCCAGCATCCTGGG - Intronic
1024231986 7:47369539-47369561 ACCTGGGATGCCAGGATCCGAGG + Exonic
1024626667 7:51213667-51213689 TTCTGAGAGGCCTGGGTCCCGGG + Intronic
1025101455 7:56138757-56138779 TCCTGAGATGTCAGAGTTCCTGG - Intergenic
1026239069 7:68556107-68556129 TCCTGAGATCCCTGGGTCCTTGG + Intergenic
1026507023 7:70993620-70993642 TTCTGAGGTGCCAGGGGCTTAGG + Intergenic
1026888153 7:73966711-73966733 TCCTGCCAAGCCAGTGTCCTGGG + Intergenic
1028445426 7:90916515-90916537 TCCAGAGATGCCACTGTCCAGGG + Intronic
1029381361 7:100217302-100217324 TGCTGAGAAGCCAGAGCCCTGGG - Intronic
1029400791 7:100344612-100344634 TGCTGAGAAGCCAGAGCCCTGGG - Intronic
1030279176 7:107752562-107752584 TCGTGAGAAGCCTGGCTCCTTGG + Intronic
1033888174 7:145974094-145974116 TCCTGACATGACAGGGTAGTTGG - Intergenic
1034902442 7:154915791-154915813 TCCTGAGCTGCAGGTGTCCTGGG - Intergenic
1035292860 7:157850697-157850719 GCCTGGGATTCCAGGTTCCTGGG + Intronic
1035327119 7:158072430-158072452 GCCTGAGAGCCCAGGGGCCTTGG + Intronic
1035362404 7:158322272-158322294 TCCAGAGCTTCCAGGATCCTGGG + Intronic
1038266831 8:26044504-26044526 TCCTGAACTGCCTGGGTCGTAGG - Intronic
1038516751 8:28193927-28193949 TCCTGTGATGCCAGGCTCAGAGG - Intergenic
1039919383 8:41882584-41882606 TCCTGAGAATCCCGAGTCCTTGG + Intronic
1039972605 8:42333156-42333178 TCCTCAGATCCCAAGGTCCAGGG - Intergenic
1040010131 8:42654693-42654715 TCCAGAGATGCCAGTCTCATTGG - Intergenic
1041799816 8:61786920-61786942 TCTTGAAGAGCCAGGGTCCTGGG + Intergenic
1042101090 8:65275697-65275719 GCCTGAGACTGCAGGGTCCTGGG - Intergenic
1042748259 8:72131257-72131279 TCCTGAGCTGTCAGGGTACCTGG + Intergenic
1045130487 8:99146694-99146716 TCCTGAGTTGCCAGGACCATAGG + Intronic
1045695606 8:104805820-104805842 TCCACAGCTGCCAGGGTCCTGGG + Intronic
1046486932 8:114899090-114899112 TGCTGACATGCCAGGTTTCTGGG - Intergenic
1048799715 8:138184598-138184620 TCCAGAGGTTCCAGGGGCCTTGG - Intronic
1049136747 8:140908963-140908985 TCCTGACATCCCAGAGTGCTGGG - Intronic
1050938652 9:11430031-11430053 TCCTGGGATGCCAGGGAGCCTGG + Intergenic
1052915153 9:33919413-33919435 TCCCGCAATGCCAGGGTGCTGGG - Exonic
1053644352 9:40112060-40112082 ACCAGGGATGCCAGGGTCCCTGG - Intergenic
1053761806 9:41353427-41353449 ACCAGGGATGCCAGGGTCCCTGG + Intergenic
1054325201 9:63709303-63709325 ACCAGGGATGCCAGGGTCCCTGG - Intergenic
1054350304 9:64013969-64013991 ACCAGGGATGCCAGGGTCCCCGG + Intergenic
1054350666 9:64015344-64015366 ACCAGGGATGCCAGGGTCCCTGG + Intergenic
1054350935 9:64016398-64016420 ACCAGGGATGCCAGGGTCCCTGG + Intergenic
1054540399 9:66264547-66264569 ACCAGGGATGCCAGGGTCCCTGG + Intergenic
1059340932 9:113597179-113597201 CCCTGACCTGCCAGGGTCTTGGG - Exonic
1059992784 9:119881052-119881074 TTCTGAGATCTCAGAGTCCTGGG - Intergenic
1061066001 9:128277742-128277764 TCCAGAGATGGCAGGGTCAGAGG + Intronic
1061185751 9:129052244-129052266 TCCTGAGAAGCCAGAGTCAGAGG + Intronic
1061879008 9:133559309-133559331 TTCTGAGATGACAGGGTCTTGGG + Intronic
1062268290 9:135697354-135697376 ACCTGAGTTGGCAGGGCCCTGGG + Intronic
1062439119 9:136561694-136561716 TCCTGAGATGCCAAGTACCCTGG - Intergenic
1202791795 9_KI270719v1_random:93778-93800 ACCAGGGATGCCAGGGTCCCTGG - Intergenic
1203697674 Un_GL000214v1:113584-113606 ACCAGGGATGCCAGGGTCCCTGG - Intergenic
1186262366 X:7792815-7792837 TCCTGAGATGGAAAGGGCCTTGG + Intergenic
1188687144 X:33083100-33083122 TGCTGGGATGCCAGGTTTCTGGG + Intronic
1189125162 X:38437983-38438005 TCCTGAGATGTCTGAGCCCTTGG - Intronic
1189372455 X:40439690-40439712 GCCTGAGAATCCTGGGTCCTGGG + Intergenic
1189731147 X:44022388-44022410 TCCAGAGATGCCAGGATCTTTGG + Intergenic
1190055992 X:47181354-47181376 TCCAGTGATGCCAGGGCCCTTGG - Exonic
1191609924 X:63101673-63101695 TGCTGGGATTCCAGGGGCCTAGG - Intergenic
1192387786 X:70690580-70690602 TCCTGAGTAGCCAGGACCCTAGG - Intronic
1192661798 X:73049573-73049595 TCCTGAGGTGGCAGGGGCCAAGG - Intergenic
1193681155 X:84519960-84519982 TCCTGAGGGGCAAGGGACCTGGG - Intergenic
1193702474 X:84779941-84779963 GCCTGAGCTGCCAGAGTCCAGGG - Intergenic
1194732361 X:97471093-97471115 TCCTCAAAAGCCAGGGTCCTTGG - Intronic
1195757681 X:108215518-108215540 TCCATAGAGGCCAGGCTCCTAGG - Intronic
1198085592 X:133279020-133279042 TCCTGCGCCACCAGGGTCCTGGG + Intergenic
1198993811 X:142548958-142548980 TTCAGAGATGGCAGGGTCTTTGG - Intergenic
1199717394 X:150516289-150516311 TATTGAGATGCTAGGGTACTGGG - Intergenic
1199995135 X:153019355-153019377 TCCTGTGATTCTAGCGTCCTGGG - Intergenic
1200037714 X:153344191-153344213 TCTTGAGATGCCAGAGGCCTAGG + Intronic
1200770433 Y:7120000-7120022 TCCTGATAGGCCAGCATCCTGGG - Intergenic
1201151266 Y:11096818-11096840 ACCAGGGATGCCAGGGTCCCCGG + Intergenic
1201151370 Y:11097208-11097230 GCCAGGGATGCCAGGGTCCCCGG + Intergenic
1201151536 Y:11097842-11097864 ACCAGGGATGCCAGGGTCCCTGG + Intergenic
1201578334 Y:15484465-15484487 TCCTGAGTAGCCAGGATCATAGG + Intergenic
1201984980 Y:19956545-19956567 TCCTGGGATTCCAGAGCCCTTGG - Intergenic