ID: 1083764766

View in Genome Browser
Species Human (GRCh38)
Location 11:64836479-64836501
Sequence CAGACGGATGGGCCCCCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083764766_1083764774 14 Left 1083764766 11:64836479-64836501 CCAGCTGGGGGCCCATCCGTCTG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1083764774 11:64836516-64836538 TGTCCCTCAGCATCTCTGCCAGG 0: 1
1: 0
2: 2
3: 31
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083764766 Original CRISPR CAGACGGATGGGCCCCCAGC TGG (reversed) Exonic
900969821 1:5985399-5985421 CAGATGGATGTGCCGCCATCAGG + Intronic
901303595 1:8217108-8217130 CAGAAGGAGGAGCCCCCAGGTGG + Intergenic
901323321 1:8352169-8352191 CAGCGGGATGGGCCCTAAGCAGG - Intergenic
902329382 1:15723828-15723850 CAGCTGGTTGGGCCCCCAGTGGG + Intronic
904081158 1:27873262-27873284 CACAGGGATGGGCACACAGCAGG + Intronic
905442529 1:38004595-38004617 CAGAGGCATGGGCCCCCTGGGGG - Intronic
905913741 1:41671193-41671215 TAGAACGCTGGGCCCCCAGCTGG + Intronic
911902620 1:103525225-103525247 CAGACGGATAGGCCCCTGCCAGG - Intergenic
912548007 1:110465284-110465306 CAAACAGCTGGGCCCCCACCTGG + Intergenic
917503164 1:175604244-175604266 GAGATGGATGGCCCCTCAGCAGG + Intronic
1063692056 10:8296584-8296606 TAGACCGAGGGGCACCCAGCAGG + Intergenic
1064861909 10:19835668-19835690 CTGAGGAATGGGCCCCCAGGCGG + Intronic
1067350961 10:45475049-45475071 GGGACTGTTGGGCCCCCAGCAGG - Intronic
1067806222 10:49395289-49395311 CAGGCGGCTGCGCCCCCCGCAGG + Intronic
1072788698 10:98302135-98302157 CAGACAGCTGGTCTCCCAGCTGG + Intergenic
1074951637 10:118342523-118342545 CAGACGCATTGGCCTACAGCAGG - Intergenic
1075494661 10:122909625-122909647 CAGAAGGAGGGTCCCCAAGCTGG + Intergenic
1076462072 10:130654598-130654620 AAGACGGAGGCGCCTCCAGCTGG - Intergenic
1077501510 11:2911602-2911624 CAGGCGGCTGGGCCCTGAGCCGG - Intronic
1081854961 11:46297149-46297171 CTGGCGGAAGCGCCCCCAGCCGG + Intronic
1083476637 11:62919688-62919710 CAGAAGCTTGGGCTCCCAGCAGG - Intronic
1083689166 11:64396357-64396379 CAGACGCCTGTGCCCCCAGAGGG + Intergenic
1083764766 11:64836479-64836501 CAGACGGATGGGCCCCCAGCTGG - Exonic
1083829640 11:65223390-65223412 CAGACGAAGGGGTTCCCAGCAGG + Intergenic
1083900259 11:65640190-65640212 CAGAGGGCTGGGCCCACAGTTGG + Exonic
1084334748 11:68450141-68450163 CGCAGGGATGGGCCCACAGCAGG - Intergenic
1089695178 11:120212129-120212151 CAGAGGGAGGGGGCCTCAGCTGG - Intronic
1090124291 11:124069832-124069854 CAGACGGATGGGGAGCCAGAAGG + Intergenic
1090843550 11:130513140-130513162 CAGATGAATGGGCCCCTGGCTGG + Intergenic
1091023917 11:132125130-132125152 CAAACGGATGGGCTCACAGTGGG + Intronic
1094200611 12:27791575-27791597 CAGGCGGAATGGCCCCCAACTGG + Intronic
1094819914 12:34216329-34216351 GAGACGGAGGGGCCTCCAGAAGG + Intergenic
1102863048 12:116353052-116353074 CAGAGGAATGGGTCTCCAGCAGG + Intergenic
1104387567 12:128364444-128364466 CACATGGATGGGCCCCATGCTGG + Intronic
1104828233 12:131730267-131730289 CAGAGGGATGGTCCCTCAGTGGG - Intronic
1106679710 13:31997569-31997591 CAGACAGAAGGGCCCACAGGAGG - Intergenic
1114617219 14:24074728-24074750 CAGGCGGAACGGCTCCCAGCTGG - Exonic
1121272639 14:92648424-92648446 TAAACGGATGGGCCACCAGCCGG - Intronic
1121761150 14:96446172-96446194 CAGCAGGACCGGCCCCCAGCAGG - Intronic
1122202013 14:100128459-100128481 CAGCAGGCTTGGCCCCCAGCTGG + Intronic
1122922699 14:104886543-104886565 CAGACGCAGGAGCCCCCAGGAGG + Exonic
1124875231 15:33585798-33585820 CAGACTGGTTGGCCCCCAGGGGG + Intronic
1125750423 15:42023995-42024017 CACAGAGATGGGCACCCAGCAGG - Intronic
1128683378 15:69667181-69667203 CAGTCGGATGAGCACCGAGCTGG - Intergenic
1129672640 15:77615823-77615845 CAGGAGGATGGGCTGCCAGCAGG + Exonic
1131921965 15:97337979-97338001 CAGACTGATGGGCTGCCTGCTGG - Intergenic
1132207025 15:99993371-99993393 CACTCGGCTGGGGCCCCAGCTGG - Intronic
1132886002 16:2182263-2182285 CAGACGCATGGGGCCACACCTGG + Intronic
1133028445 16:2998582-2998604 AAGACGGAGGGGCCTCCATCAGG + Intergenic
1138463040 16:57164525-57164547 CAGAAGGAAGGGACCCCAGAAGG + Intronic
1138580082 16:57935185-57935207 GAGACGGATGGGCCTGCTGCAGG - Intronic
1139496876 16:67326571-67326593 GAGAGCGAGGGGCCCCCAGCCGG - Intronic
1140901553 16:79372631-79372653 CTGGCGGGTGAGCCCCCAGCAGG + Intergenic
1144852572 17:18251448-18251470 CAGATGCCCGGGCCCCCAGCGGG - Exonic
1145246377 17:21272570-21272592 CAGTGGGATGGGCCCCAATCTGG + Intergenic
1146004885 17:29154897-29154919 ATGAGGGAAGGGCCCCCAGCAGG + Intronic
1147241966 17:39096359-39096381 GGGAAGGATGGGCCCCCAGATGG + Intronic
1151552794 17:74831697-74831719 CAGGGGGGTCGGCCCCCAGCAGG - Intronic
1152322954 17:79618617-79618639 CAGACGGATGTGCACTCCGCCGG - Intergenic
1152533022 17:80931526-80931548 CAGAGGTGTGGGCCCGCAGCAGG + Intronic
1156450891 18:37266031-37266053 CAGCAGGATGGGGCCCCAGCAGG - Intronic
1160790416 19:920372-920394 CAGCTGGATGGGGCCCCAGCAGG - Exonic
1161286491 19:3471138-3471160 CAGAAGGATGGGCCCCAACATGG + Intergenic
1161298299 19:3530865-3530887 CAGAGGGCTTGGCCCCCACCTGG + Intronic
1161390848 19:4019473-4019495 GAGAAGGGTGGGTCCCCAGCAGG - Intronic
1161589090 19:5120754-5120776 GAGAGGGAAGGGCTCCCAGCGGG - Intronic
1161614779 19:5263996-5264018 CAGACAGATGGACCCACAGATGG + Intronic
1162968376 19:14166309-14166331 CCCAGGGCTGGGCCCCCAGCTGG + Intronic
1164597516 19:29539910-29539932 CAGGTGGGTGGGCCTCCAGCAGG - Intronic
1164739419 19:30565396-30565418 CAGGAGGGTGGGCCCCCACCGGG - Intronic
1165345975 19:35249049-35249071 CAGAGGGCTGGGCTCCCACCCGG + Exonic
1165484072 19:36084738-36084760 GAGACGGGTGAGCCCGCAGCAGG + Exonic
1166375728 19:42325859-42325881 TAGACGGGTGGGTCCCCAGGGGG - Intronic
1167905722 19:52658996-52659018 CAGGCGATTGGGCACCCAGCAGG + Intronic
1168511846 19:56979755-56979777 CAGATGGATGGGCCACCCTCGGG + Intergenic
1168511884 19:56979871-56979893 CAGATGGATGGGCCACCCTCGGG + Intergenic
1168554667 19:57327870-57327892 AATAGGGATAGGCCCCCAGCGGG + Exonic
925082100 2:1078503-1078525 CAGGTGGATGGGCCCCAGGCAGG + Intronic
925742478 2:7018188-7018210 GAGACGGAAGGGTCCCTAGCAGG + Intronic
927845982 2:26473142-26473164 CAGACCGCTCGGCCCCCAGCTGG - Exonic
928202178 2:29254960-29254982 CAGACGGATGGGCCTAGAGAGGG + Intronic
930198396 2:48530402-48530424 CAGAGGGATGGCCTCCCGGCAGG + Intronic
931230028 2:60366316-60366338 CAGCCACTTGGGCCCCCAGCTGG - Intergenic
932567792 2:72920474-72920496 CAGACGGATGCGCTCCCCGGCGG + Intronic
933842431 2:86298295-86298317 CACAGGGATGGGCTCCCAACTGG + Intronic
934951472 2:98578617-98578639 CAGGCGGATGGGGCCCTTGCGGG - Intronic
935182957 2:100706468-100706490 CAGACAGCTGGGCCCTAAGCGGG + Intergenic
937110992 2:119367108-119367130 CAGCCGGCTGAGCCCCCAACGGG - Intronic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
1172344436 20:34186409-34186431 CAGAGGGATCGCCCCACAGCTGG + Intergenic
1172602744 20:36195178-36195200 CAGCTGGGTGGGCCACCAGCAGG - Intronic
1173807830 20:45937521-45937543 CAGCCGGATGGACCCCCACAGGG - Exonic
1174554339 20:51383039-51383061 CAGATGGAGAGGCGCCCAGCCGG + Intergenic
1175988836 20:62777591-62777613 CAGATGGCTGGGGCGCCAGCAGG - Intergenic
1176380162 21:6108382-6108404 CAAAGGGATGGGTGCCCAGCTGG - Intergenic
1178486900 21:33025216-33025238 CAGCCGGTAGCGCCCCCAGCTGG - Intergenic
1179743312 21:43429856-43429878 CAAAGGGATGGGTGCCCAGCTGG + Intergenic
1180187174 21:46145663-46145685 CACACGGGTGGGACCCCCGCAGG - Intronic
1180960857 22:19761603-19761625 CAGCCGGGTGCGCCCCAAGCCGG - Intronic
1183347193 22:37314387-37314409 CAGACAGATGGGACTCAAGCAGG + Exonic
1184297849 22:43537157-43537179 CATGCAGATGGGCCCCCTGCTGG + Intronic
1185056488 22:48581336-48581358 CAGTGGGAGGGACCCCCAGCTGG - Intronic
953481363 3:43255152-43255174 CAGAAGGATGGGGTCTCAGCTGG - Intergenic
963119639 3:141765162-141765184 CAGAGTGAGGGGCCCGCAGCAGG - Intergenic
969465578 4:7354361-7354383 CAGGGGGCTGAGCCCCCAGCGGG - Intronic
969610178 4:8223302-8223324 CAGAGGGCTGGGCCCCAAACAGG - Intronic
969894555 4:10291195-10291217 CAGACGGATGGGCTCAGTGCTGG + Intergenic
972940207 4:44186335-44186357 CAGATGGATGGGGAGCCAGCAGG - Intronic
980340615 4:131540494-131540516 CAGAAGTATGGGCCACCCGCAGG - Intergenic
985053543 4:186016616-186016638 CAGACAGAGGGGGACCCAGCTGG + Intergenic
985666689 5:1184728-1184750 CGGATGCTTGGGCCCCCAGCTGG + Intergenic
990722141 5:58708490-58708512 CAGACAGAGTGGCACCCAGCTGG + Intronic
998104466 5:139459663-139459685 CAGAGGGACGGGAACCCAGCTGG - Intronic
1001718972 5:173840976-173840998 CAGACGGATGGGGCACAAGCAGG + Intergenic
1001872172 5:175166256-175166278 CAGGCAGGTGTGCCCCCAGCTGG + Intergenic
1007678868 6:43620865-43620887 CAGACTGATGGGCATGCAGCTGG + Exonic
1017889154 6:158624952-158624974 CAGAACAATGGGCTCCCAGCCGG - Intronic
1018859230 6:167698878-167698900 CAGACGGAAAGGCCCCACGCTGG + Intergenic
1018859243 6:167698915-167698937 CAGACGGAAAGGCCCCACGCTGG + Intergenic
1019587695 7:1814045-1814067 AAGGCGGATGGGACCCCACCAGG - Intergenic
1020081466 7:5288183-5288205 CTGTCGGCAGGGCCCCCAGCAGG - Intronic
1023870604 7:44261247-44261269 CAGCCTGCTGGGCCCCCAACTGG - Intronic
1030794436 7:113770399-113770421 CAGGCTGATGGGCCACCAACTGG - Intergenic
1031232312 7:119123654-119123676 CAGATGGATGGGGAGCCAGCAGG - Intergenic
1031923204 7:127615948-127615970 CAGAAGGATGAGACTCCAGCTGG + Intergenic
1037811629 8:22089869-22089891 CAGGCTGGTGGGCCCCCAGCCGG + Intronic
1039248179 8:35632544-35632566 CACAGGGATGAGGCCCCAGCTGG - Intronic
1039885191 8:41650351-41650373 CCCAGGGCTGGGCCCCCAGCTGG - Intronic
1040482520 8:47839453-47839475 CAGGAGGATGGGCCCACAGGAGG + Intronic
1047286077 8:123488261-123488283 CAGAGAGATGGGTCCCCAGTGGG - Intergenic
1049015546 8:139917605-139917627 CAGCGGGGTGGGCCCACAGCAGG - Intronic
1050086249 9:1968828-1968850 CAGAGGGCAGGGGCCCCAGCTGG + Intergenic
1052196539 9:25723333-25723355 CAAAATGATGGGCCACCAGCCGG + Intergenic
1057489665 9:95511195-95511217 CCGGCGGACGGGCCCCCTGCGGG - Intronic
1060010816 9:120041473-120041495 CAGACGGCTCCGCCTCCAGCAGG - Intergenic
1061092382 9:128433954-128433976 CAGGCAGTGGGGCCCCCAGCAGG + Intronic
1062352458 9:136145791-136145813 CATCCAGATGGGCCCCCAGTGGG + Intergenic
1198339207 X:135698066-135698088 GAGACATCTGGGCCCCCAGCTGG + Intergenic
1198799530 X:140434507-140434529 GAGAAGGAGGGGCCACCAGCAGG - Intergenic
1202117358 Y:21482461-21482483 CAGACAGATGGGGACCCAGAAGG - Intergenic