ID: 1083765787

View in Genome Browser
Species Human (GRCh38)
Location 11:64840829-64840851
Sequence CAGTGTGACCATATGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 503}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083765777_1083765787 28 Left 1083765777 11:64840778-64840800 CCCTGTCTGGCTGCGACTGAGCC 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG 0: 1
1: 0
2: 3
3: 56
4: 503
1083765780_1083765787 6 Left 1083765780 11:64840800-64840822 CCAAGCCCACGCTCTACAGCTCT 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG 0: 1
1: 0
2: 3
3: 56
4: 503
1083765783_1083765787 1 Left 1083765783 11:64840805-64840827 CCCACGCTCTACAGCTCTGGGCC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG 0: 1
1: 0
2: 3
3: 56
4: 503
1083765778_1083765787 27 Left 1083765778 11:64840779-64840801 CCTGTCTGGCTGCGACTGAGCCC 0: 1
1: 0
2: 2
3: 8
4: 168
Right 1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG 0: 1
1: 0
2: 3
3: 56
4: 503
1083765784_1083765787 0 Left 1083765784 11:64840806-64840828 CCACGCTCTACAGCTCTGGGCCT 0: 1
1: 0
2: 0
3: 14
4: 205
Right 1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG 0: 1
1: 0
2: 3
3: 56
4: 503
1083765779_1083765787 7 Left 1083765779 11:64840799-64840821 CCCAAGCCCACGCTCTACAGCTC 0: 1
1: 0
2: 1
3: 24
4: 259
Right 1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG 0: 1
1: 0
2: 3
3: 56
4: 503
1083765776_1083765787 29 Left 1083765776 11:64840777-64840799 CCCCTGTCTGGCTGCGACTGAGC 0: 1
1: 0
2: 1
3: 9
4: 107
Right 1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG 0: 1
1: 0
2: 3
3: 56
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083765787 Original CRISPR CAGTGTGACCATATGGAAAA TGG Intronic
900631039 1:3635469-3635491 CAGTGAGAGCATGAGGAAAAAGG + Intronic
900695607 1:4007997-4008019 CTGTGTGATCATCTGGCAAAAGG - Intergenic
901643241 1:10703654-10703676 GAGTCTGACCCTATGGAGAAGGG - Intronic
901825162 1:11856667-11856689 CAGTTTTCCCATTTGGAAAATGG + Intergenic
901837768 1:11935211-11935233 CAGTTTGCCCAGCTGGAAAACGG - Intronic
902035064 1:13451945-13451967 CAGTGTGGCCATCTGAAAGATGG - Intergenic
902566835 1:17316880-17316902 CAGTGTGCTCATCTGTAAAATGG + Intronic
902679630 1:18033879-18033901 CAGTGTGTCCATCTGCAAAATGG + Intergenic
902730343 1:18364878-18364900 CAGTGGAACCACATGGGAAATGG - Intronic
903008955 1:20317220-20317242 CAGTGTCCCCACATGGAAAGTGG + Intronic
903090166 1:20907585-20907607 CAGTGAGAACATATGGACACAGG - Intronic
903264117 1:22146557-22146579 CAGTTTCTCCATATGTAAAATGG - Intergenic
903642051 1:24866940-24866962 CAATGTGCTCATATGCAAAAGGG + Intergenic
904468260 1:30720511-30720533 CAGTTTCACCATCTGTAAAATGG + Intronic
905298484 1:36969905-36969927 AACTATGACCATATGAAAAATGG + Intronic
905676439 1:39828854-39828876 CAGTTTTGCCATATGGAAAATGG + Intergenic
906803292 1:48756134-48756156 CAGTGTTCTCATATGTAAAATGG - Intronic
906975792 1:50571386-50571408 CTGTGTGACCATGGGGCAAATGG + Intronic
907162879 1:52384275-52384297 CAGTGTGGCAACATGGAAAAGGG - Intronic
907664980 1:56426782-56426804 CAGTTTGCCCATCTGTAAAATGG + Intergenic
907888127 1:58612728-58612750 CAGTGGGACCCTATGGCCAAGGG - Intergenic
909184303 1:72466241-72466263 CAGGATGACCATTTGGAATAAGG - Intergenic
909341459 1:74536267-74536289 CAATGTGACCATTTGCAAACAGG + Intronic
909537017 1:76748348-76748370 CAGTGTAACCATATAGAAATGGG + Intergenic
909846535 1:80400701-80400723 CAGTGTTACCCTATGGATAGGGG - Intergenic
910727179 1:90351379-90351401 CAGTGTCACTCTCTGGAAAATGG - Intergenic
910730009 1:90384799-90384821 TTATGTGCCCATATGGAAAAGGG + Intergenic
911248209 1:95543378-95543400 GGGTCTGACCATATAGAAAATGG + Intergenic
911364144 1:96916363-96916385 CAGTGAGAACATATGGACATAGG + Intergenic
911369891 1:96984219-96984241 CAGTGTCTTCATCTGGAAAATGG - Intergenic
911508662 1:98784828-98784850 CATTGTGATCATTTGGAGAAGGG - Intergenic
912703525 1:111895670-111895692 CATTCTGAGCATATGGAGAAGGG - Intronic
913721269 1:121598389-121598411 CAATGAGAACAGATGGAAAAAGG - Intergenic
916804644 1:168247366-168247388 CAATGAGAACACATGGAAAAGGG - Exonic
917061994 1:171051535-171051557 CAATGAGAACACATGGAAAAAGG + Intronic
917302971 1:173597641-173597663 CAGTTTGCTCATATGCAAAATGG + Intronic
917443831 1:175090127-175090149 CAGTGTTCTCATATGTAAAATGG - Intronic
917517504 1:175720121-175720143 CAGTGTGACAATTTGGAGATAGG + Intronic
917814047 1:178689339-178689361 CAGTGTTAGCATCTGTAAAATGG - Intergenic
919725640 1:200881164-200881186 AAATGTGACCATGTGGAGAAGGG - Intergenic
919905978 1:202078528-202078550 TAGTTTCCCCATATGGAAAATGG - Intergenic
920286863 1:204885917-204885939 CAGAGTGCCCATCTGGAAAGGGG - Intronic
920316508 1:205079337-205079359 CAGTCTCTCCATCTGGAAAATGG + Intergenic
920773374 1:208911597-208911619 CATTGTAACCATGTGGATAAGGG - Intergenic
923066421 1:230521368-230521390 CAATGAGAACATATGGAAAATGG - Intergenic
1063258725 10:4358838-4358860 CAGTGTGGACATATTGATAAGGG + Intergenic
1063417225 10:5883796-5883818 CAGTGTTCCCATCTGTAAAATGG - Intronic
1063908547 10:10805821-10805843 CAAGGTGATCAAATGGAAAATGG - Intergenic
1064292673 10:14050338-14050360 CAGTTTTACCATCTGCAAAATGG - Intronic
1065043328 10:21719694-21719716 CAATGTTTCCATATGTAAAATGG + Intronic
1065178423 10:23100826-23100848 CACTGTGACAAGATGGAAAAAGG + Intronic
1065200525 10:23308729-23308751 CAGTGTTATCATTTGTAAAATGG + Intronic
1065766123 10:29031299-29031321 CAGTGTGTACATATAGAAATAGG + Intergenic
1068307495 10:55232097-55232119 CAGTGTTACAATATGGAATAGGG - Intronic
1068398435 10:56495187-56495209 CAGTGGGAACACATGGAAACAGG + Intergenic
1068561186 10:58515723-58515745 CAGTTTGCCCATCTGTAAAATGG + Intronic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1068874844 10:61984963-61984985 CAGTTTGCCCATCTGAAAAATGG + Intronic
1069580256 10:69560935-69560957 CAGTGTTATCATTTGTAAAATGG + Intergenic
1070578844 10:77703404-77703426 CTGTGTGACCACATGGCAGAAGG - Intergenic
1070921805 10:80191893-80191915 CAGTGTGACCATTTGTGAAATGG - Intronic
1071140130 10:82500086-82500108 CAGTGAGGACATATTGAAAAAGG + Intronic
1071498391 10:86186620-86186642 CAGTTTTCCCATCTGGAAAATGG + Intronic
1072268092 10:93749723-93749745 CAGTTTGCTCATATGAAAAATGG + Intergenic
1072437004 10:95423004-95423026 CAGTTTGCCCATCTGAAAAATGG + Intronic
1072734341 10:97868975-97868997 CAGTTTCCCCATATGTAAAATGG - Exonic
1073420479 10:103420216-103420238 CTGTGTGACCATCTGGAGGAAGG + Intronic
1073958251 10:108896718-108896740 CAGTGTGGCCACATGAAAAAAGG - Intergenic
1073962895 10:108954482-108954504 CAGTGAGAACATATGGACACAGG + Intergenic
1074062615 10:109981194-109981216 CAGTTTCTCCATATGTAAAATGG + Intergenic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1074181737 10:111071242-111071264 CAGTTTCCTCATATGGAAAAAGG - Intergenic
1074433752 10:113416185-113416207 CAGTTTCACCATCTGTAAAATGG + Intergenic
1074447829 10:113534785-113534807 CAGTGTCCCCATCTGTAAAATGG + Intergenic
1074496096 10:113981273-113981295 CCTTGTGACCATATTTAAAATGG + Intergenic
1075199687 10:120392212-120392234 CAGTTTGCCCATCTGTAAAATGG + Intergenic
1075210457 10:120486465-120486487 CAGTTTGACCAGCTGTAAAATGG + Intronic
1075582861 10:123635154-123635176 CAGTGTGTTCATCTGTAAAATGG - Intergenic
1076072471 10:127501724-127501746 CAGTGTGGTCACATGGAAACAGG + Intergenic
1076252536 10:128995679-128995701 CAGTGTTCCCATCTGGAAAATGG + Intergenic
1076652170 10:131997304-131997326 CAGTGAGACCAAATCGAAAATGG + Intergenic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077674816 11:4186841-4186863 CAGTTTTCCCATATGTAAAATGG + Intergenic
1078595699 11:12684615-12684637 CAGTTTCCCCATCTGGAAAATGG + Intronic
1078979030 11:16510846-16510868 CAGTTTACCCACATGGAAAATGG - Intronic
1079158058 11:17967302-17967324 CAGTGTGACCACGTGAAAAGTGG - Intronic
1079247223 11:18761518-18761540 GAGGGTGACCACATGAAAAAGGG + Intronic
1079610745 11:22429944-22429966 CAGTGTCTCCATATGTAAAATGG + Intergenic
1079633208 11:22703388-22703410 CACTCTCACCCTATGGAAAATGG + Intronic
1079686694 11:23367860-23367882 CAGTGAGAACATATGGACACAGG + Intergenic
1079843331 11:25430946-25430968 CAGTGAGAACACATGGAGAAAGG + Intergenic
1081056391 11:38414900-38414922 CATTGAGCCCATATGGCAAAGGG - Intergenic
1081495961 11:43610560-43610582 CAGTTTCCCCATATGCAAAATGG + Intronic
1081574792 11:44312146-44312168 CAGTCTACCCATATGCAAAATGG - Intergenic
1081674520 11:44960802-44960824 CAGTGTCTCCATCTGTAAAATGG + Intergenic
1082298582 11:50475660-50475682 CAGTGTGAACACATGGACACAGG + Intergenic
1082648323 11:55755758-55755780 CAGGATGACCCCATGGAAAATGG - Intergenic
1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG + Intronic
1083766829 11:64845249-64845271 CAGTGTGTCCATCTGCCAAATGG - Intergenic
1083975824 11:66119071-66119093 CAGTGGCACCAGATGGACAAGGG + Intronic
1084448178 11:69216482-69216504 CAGTTTTCCCATATGCAAAATGG + Intergenic
1084660575 11:70544263-70544285 CAGTGTCCTCATCTGGAAAATGG + Intronic
1085023371 11:73222615-73222637 AAGTGTGACCTGCTGGAAAAAGG - Intronic
1085069407 11:73529364-73529386 CAGTTTCACCATCTGTAAAATGG + Intronic
1085190731 11:74619555-74619577 CAGTTTTACCATATGCGAAAGGG - Intronic
1085209539 11:74762928-74762950 GAGTTTTACCATATGCAAAAAGG + Intronic
1085264595 11:75229774-75229796 CAGTGTAACCATCTGGGAATTGG + Intergenic
1087439336 11:98162375-98162397 CAGTGTGACCAAATGTTACAAGG - Intergenic
1088245275 11:107812381-107812403 CACTGTGCCCATTTGGGAAAGGG - Intronic
1089853679 11:121521920-121521942 GAGTGTGACCATATGGCAAAGGG + Intronic
1091116972 11:133022440-133022462 CAGTGTGACCATCACGCAAATGG + Intronic
1091217829 11:133914215-133914237 CAGTGTCTCCATCTGAAAAATGG - Intronic
1091322844 11:134664121-134664143 CAGTGTGCTCATCTGTAAAATGG + Intergenic
1092437225 12:8459604-8459626 CAGTTTCACCATATGTAAAATGG - Exonic
1093980735 12:25472479-25472501 CAATGGGAGCAAATGGAAAAAGG + Intronic
1094270360 12:28607955-28607977 CAGTCTAACAAGATGGAAAAAGG - Intergenic
1096263824 12:50108802-50108824 CAGTGTCACCAACTGTAAAATGG - Intronic
1099046936 12:77732657-77732679 CATTGTTACCATTTGCAAAATGG - Intergenic
1100626961 12:96345022-96345044 CAGTGAGAACATATGGAAACAGG - Intronic
1101842358 12:108337361-108337383 CAGTTTCACCATCTGTAAAATGG - Intronic
1101844100 12:108348782-108348804 CAGTTTACCCATATGCAAAATGG - Intergenic
1101914351 12:108884811-108884833 CAGTGTTTCCATTTGCAAAACGG + Intronic
1101945012 12:109130036-109130058 CAGTGTCCCCATCTAGAAAAGGG - Intronic
1101953039 12:109191088-109191110 CAGTTTCCTCATATGGAAAATGG - Intronic
1102189411 12:110975391-110975413 CAGTGTCTCCACCTGGAAAATGG + Intergenic
1102233001 12:111276571-111276593 CAGTGTTCTCATCTGGAAAAGGG + Intronic
1102432188 12:112892226-112892248 CAGTGTGCTCATCTGCAAAATGG + Intronic
1102805688 12:115778171-115778193 CAGTTTTACCATCTGTAAAACGG + Intergenic
1103949909 12:124545003-124545025 CAGTGTGCCCATCTGTAAAACGG + Intronic
1104868679 12:131978051-131978073 GATGGTGACCAGATGGAAAAGGG + Intronic
1104919009 12:132280908-132280930 CAGTTTCCCCATATGTAAAATGG + Intronic
1105401211 13:20097654-20097676 CAGTGTCTCCATATGTAAAACGG - Intergenic
1105589382 13:21776850-21776872 CAGTGTTCCCACATGGAAAGGGG - Intergenic
1105765602 13:23555467-23555489 AATGGTGACCATAAGGAAAATGG + Intergenic
1106327932 13:28711991-28712013 CAGTGTGACCAAATAGAATTGGG - Intronic
1107145132 13:37053470-37053492 CAGTGAGACCACATGGACACAGG + Intronic
1108522835 13:51260601-51260623 CAGTGTGTGCATCTGCAAAATGG - Intronic
1109762798 13:66852101-66852123 CAGTGTGACTATTTGGAGATAGG - Intronic
1110335690 13:74327697-74327719 CACTGTGACATTTTGGAAAAAGG + Intergenic
1110656500 13:78006258-78006280 CAGTGAGAACATATGGACACAGG + Intergenic
1111953249 13:94728067-94728089 CAGTCTTCCCATATGTAAAATGG + Intergenic
1111987970 13:95084224-95084246 CAGTGTCTCCATCTGTAAAATGG - Intronic
1112032570 13:95471121-95471143 CACTGTGACCTGAAGGAAAAGGG + Intronic
1112297583 13:98201903-98201925 CTGTTTGATCATTTGGAAAAAGG - Intronic
1112639663 13:101258536-101258558 CAGGATGAACATGTGGAAAACGG + Exonic
1113359425 13:109615785-109615807 CAGTGAGACCACATGGACATAGG - Intergenic
1115144394 14:30209748-30209770 CATTGTGACAATATTAAAAAGGG - Intergenic
1115148279 14:30252797-30252819 CAGCCTGAGGATATGGAAAATGG + Intergenic
1115833709 14:37373580-37373602 CAGTGAGAACATATGGACACAGG - Intronic
1116385686 14:44326903-44326925 AAGGTTGTCCATATGGAAAATGG + Intergenic
1117095787 14:52296044-52296066 CTGGGTGACCAGATGGCAAAAGG - Intergenic
1117469340 14:56026025-56026047 CAATGTGACCATACAGAAAATGG - Intergenic
1117841242 14:59862647-59862669 CAGTGGGAACAGATGGGAAATGG - Intronic
1118975128 14:70670248-70670270 CACTGTGACAAAATGGAATAGGG - Intronic
1119544213 14:75459989-75460011 CAGTCTCACCATCTGTAAAATGG + Intronic
1119760219 14:77145406-77145428 CAGTTTCCCCATAAGGAAAATGG - Intronic
1119871687 14:78023339-78023361 CAGTGTCCCCATATGAAAAATGG + Intergenic
1119891621 14:78186810-78186832 CAGTGTGACCATCTGAAATCAGG - Intergenic
1121599431 14:95191988-95192010 CAGTGTGTCCATCTGCAGAATGG - Intronic
1122058487 14:99121221-99121243 CAGTTTGTCCATCTGTAAAATGG + Intergenic
1124662661 15:31562914-31562936 TAGTGTGCCAAAATGGAAAATGG - Intronic
1124764751 15:32479960-32479982 CCCTGTGACCTTAGGGAAAATGG - Intergenic
1125768076 15:42148209-42148231 CAGTTTCAACATCTGGAAAATGG - Intronic
1126069375 15:44852472-44852494 CAGTCTCATCATATGAAAAAGGG - Intergenic
1126123956 15:45278701-45278723 CAGTGTGGCAATATTGAGAATGG - Intergenic
1126264032 15:46731349-46731371 CTGTGTGCTCATATGGCAAAAGG + Intergenic
1128040777 15:64571581-64571603 CAGTTTACCCATATGTAAAATGG - Intronic
1128260859 15:66231978-66232000 CAGTTTGACCATCTGTAAAATGG - Intronic
1128806644 15:70536089-70536111 CAGTGTTCCCATCTGGAAAAGGG - Intergenic
1129020402 15:72512146-72512168 CAGTGTGATCTTATGGAAATTGG + Intronic
1129461240 15:75701039-75701061 CAGTGTCCCCATCTGTAAAAGGG + Intronic
1129509117 15:76107489-76107511 CAGTTTGCTCATATGGAAAATGG - Intronic
1129723586 15:77890699-77890721 CAGTGTCCCCATCTGTAAAAGGG - Intergenic
1129876999 15:78982116-78982138 CAGTGTCCCCATCTGGAAAATGG + Intronic
1129907455 15:79198652-79198674 CGGAGAGACCATGTGGAAAAAGG - Intergenic
1131682599 15:94739461-94739483 CAGTTTTATCATCTGGAAAAAGG - Intergenic
1131952509 15:97696073-97696095 CAGTGTGCTCGTTTGGAAAATGG - Intergenic
1132101309 15:99025284-99025306 TAGTCTGACCATATCCAAAAGGG - Intergenic
1133396428 16:5450941-5450963 CAGTGTTCTCATCTGGAAAATGG + Intergenic
1134020990 16:10921570-10921592 CAGTTTGCCCATCTGTAAAATGG - Intronic
1134194179 16:12146144-12146166 CAGTGTGAGCTTATAGATAAAGG + Intronic
1134809058 16:17151519-17151541 CAGTGTCCCCATCTGGAAAATGG + Intronic
1135069296 16:19338248-19338270 CAGTTTGCCCATGTGCAAAATGG + Intergenic
1135932682 16:26751894-26751916 CACTGTGTCCGTGTGGAAAATGG + Intergenic
1137712164 16:50574062-50574084 CAGTTTTACCATCTGTAAAACGG - Intronic
1137719548 16:50620032-50620054 CAGTTTCCCCATCTGGAAAATGG + Intronic
1137825105 16:51487502-51487524 CAATGTAACCATCTGGAACAAGG + Intergenic
1138431214 16:56970320-56970342 CAGTTTACCCATATGTAAAAAGG - Intronic
1140444301 16:75012434-75012456 CAAGCTGACCATATGGAAAAGGG - Intronic
1141245583 16:82303613-82303635 CAGTGAGAACACATGGAAACAGG - Intergenic
1141270401 16:82534939-82534961 CAGTGTGACATTATGGAACACGG + Intergenic
1141497773 16:84421774-84421796 CAGTTTCCCCATATGCAAAATGG + Intronic
1141714596 16:85719503-85719525 CAGTGTGCCCGTCTGGAAGATGG - Intronic
1141992506 16:87618574-87618596 CAGTGTGGCCAGGTGGAAAAAGG - Intronic
1142123819 16:88400374-88400396 CAGTCTCCCCATCTGGAAAATGG - Intergenic
1142150411 16:88510159-88510181 CAGTTTACCCATATGGAGAAGGG - Intronic
1142220782 16:88853940-88853962 CAGTGTGACCAGTTGGAGAGTGG + Intronic
1143265499 17:5634088-5634110 CAGCATGAGCATATGGAAACCGG - Intergenic
1143387232 17:6538302-6538324 CAGTGTTAGGACATGGAAAATGG - Intronic
1143872240 17:9965459-9965481 CAATGGGACCATATGGACACCGG + Intronic
1144025932 17:11275700-11275722 ATGTGTGACCATCTGGAGAAAGG + Intronic
1144048389 17:11473952-11473974 CAATGAGAACATATGGACAAAGG - Intronic
1144168741 17:12637918-12637940 CAGTTTGCTCATATGTAAAATGG - Intergenic
1144238049 17:13281724-13281746 TATTATGACCATAAGGAAAATGG + Intergenic
1146483798 17:33227294-33227316 CAGGGTGGCCACATGGAGAAGGG - Intronic
1146586106 17:34083216-34083238 CAGTGAGAACATATGGACACAGG - Intronic
1147439228 17:40437359-40437381 CAGTTTGGCCATCTGTAAAATGG - Intergenic
1147886415 17:43687487-43687509 CAGTGGAACCTTATGGAAAAAGG - Intergenic
1149262477 17:54895082-54895104 CAGTGTGATGCAATGGAAAAAGG + Intergenic
1149328817 17:55560577-55560599 CAATGTGAACATATGGACACAGG + Intergenic
1150286173 17:63955493-63955515 CAGTTTTCCCATCTGGAAAACGG - Intronic
1151183556 17:72347345-72347367 CAGTGTCACCATATGTACAATGG - Intergenic
1151943249 17:77305835-77305857 AACTGTGACCAGATGGAAATGGG - Intronic
1153696897 18:7652700-7652722 CAGTGAGAACATATGGACACAGG + Intronic
1155229417 18:23758187-23758209 CAGTCTCACCATCTGTAAAATGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156398711 18:36721695-36721717 CAGTGGTAACATATGCAAAATGG - Intronic
1156815157 18:41301230-41301252 AAGTGTGGCCATAAGGAAATAGG + Intergenic
1156866802 18:41897826-41897848 CAATGTGATCATCTGTAAAATGG + Intergenic
1157331742 18:46708984-46709006 CAGTTTTCCCATCTGGAAAATGG + Intronic
1157439817 18:47702152-47702174 CAGTGTGATCATCTGGAAAATGG + Intergenic
1157832810 18:50872769-50872791 CAGTTTTCCCATATGTAAAATGG + Intergenic
1159923914 18:74250032-74250054 CAGTGTGACTATTTGGAAACAGG + Intergenic
1160618176 18:80149775-80149797 CAGTGCTACCAGTTGGAAAAAGG + Intronic
1161251497 19:3282763-3282785 CAGTTTGCTCATCTGGAAAATGG + Intronic
1161263646 19:3352315-3352337 CAGTGAGACCCTGTAGAAAAAGG + Intergenic
1161543868 19:4867998-4868020 CAGTTTGGCCATAGGGGAAATGG - Intergenic
1161856556 19:6769039-6769061 CAGTTTCTCCATCTGGAAAATGG - Intergenic
1162265153 19:9567063-9567085 CTCTGTGACTTTATGGAAAATGG - Exonic
1162389290 19:10379678-10379700 CAGTTTCCCCATCTGGAAAAGGG + Exonic
1162532690 19:11245030-11245052 CAGTTTCCCCATCTGGAAAATGG + Intronic
1163597216 19:18227151-18227173 CAGTTTCTCCATCTGGAAAATGG - Intronic
1163599367 19:18239446-18239468 CAGTTTGCCCATCTGGGAAATGG + Intronic
1164475463 19:28572535-28572557 CAGTTTCACCATGGGGAAAATGG + Intergenic
1165173884 19:33913217-33913239 CACTGTGACCTTATGAAAAGAGG + Intergenic
1165781561 19:38437491-38437513 CAGTGTTCTCATCTGGAAAATGG + Intronic
1166175755 19:41068355-41068377 CAGTTTCCCCATCTGGAAAATGG + Intergenic
1166197784 19:41218401-41218423 CAGTTTGTCCATCTGTAAAATGG - Intergenic
1166375551 19:42325136-42325158 CAGTGTGTCCATCTGTGAAATGG + Intergenic
1166439166 19:42795783-42795805 CAGTGAGACCACATGGACACAGG + Intronic
1166658273 19:44627855-44627877 CAGTTTGCCCATCTGCAAAATGG + Intronic
1167219817 19:48191570-48191592 CATTCTGATCACATGGAAAAGGG + Intronic
1167570210 19:50282218-50282240 CAGTTCGCCCATCTGGAAAATGG + Intronic
1167620741 19:50559032-50559054 CAGTGTGCCCTTCTGTAAAATGG - Intronic
1167820624 19:51924485-51924507 CAGTGAGAACATATGGACAAAGG + Intronic
1168012043 19:53540845-53540867 CAGAGTGACGTGATGGAAAAGGG - Intronic
1168527878 19:57103327-57103349 CAGTGTAACCAGGTGGATAATGG - Intergenic
925248447 2:2407286-2407308 CAGTTTCTCCATATGAAAAATGG - Intergenic
925603651 2:5635801-5635823 CAGTGTGACTATAAGGACAGAGG - Intergenic
926013278 2:9425017-9425039 CACTGTGAAAGTATGGAAAAGGG + Intronic
926516054 2:13847978-13848000 CAGTTTGATCATCTGTAAAAAGG - Intergenic
926793824 2:16602479-16602501 CAGTATGAACATATGTCAAAGGG + Intronic
926955858 2:18299089-18299111 CAGTTTAACCAAATTGAAAAAGG + Intronic
927631104 2:24774841-24774863 CAGTTTCACCATCTGTAAAACGG - Intergenic
927711860 2:25331113-25331135 CAGTTTTACCATCTGTAAAATGG - Intronic
928501420 2:31900478-31900500 CAGTGAGAACATATGGACACAGG + Intronic
929287269 2:40149605-40149627 AAGTGTGACAAGATGGAAAGAGG + Intronic
929318257 2:40507703-40507725 CAGTGTTTCCATCTGTAAAATGG + Intronic
929531996 2:42758574-42758596 CAGTGTTTCCATCTGTAAAATGG + Intergenic
929743589 2:44631194-44631216 CAGTGAGACCACATGGACACAGG + Intronic
929887793 2:45893973-45893995 CAGTTTGCCCATTTGTAAAATGG + Intronic
930394710 2:50806599-50806621 CAGTGTGACCATATCTCTAAGGG - Intronic
930833185 2:55767475-55767497 CTGTGTGCCCATATAGAATATGG + Intergenic
931259230 2:60602607-60602629 CTGTGTGCCCAAATGTAAAAGGG + Intergenic
931457614 2:62424571-62424593 CTGTGTGACAAGATGGAGAAGGG + Intergenic
932054154 2:68427850-68427872 CAGTGTCATCATCTGTAAAATGG - Intergenic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
932783566 2:74579560-74579582 CAGTTTTCTCATATGGAAAATGG + Intronic
932863177 2:75315812-75315834 AAGAGAGGCCATATGGAAAATGG + Intergenic
933140725 2:78789888-78789910 AACTCTTACCATATGGAAAAAGG + Intergenic
933248489 2:80002408-80002430 GAGTTTGACCAAGTGGAAAATGG + Intronic
935482842 2:103614805-103614827 CAGTGTTACCATTTGTGAAATGG + Intergenic
936170721 2:110170630-110170652 CAGTGAGACAATCTAGAAAATGG + Intronic
936581023 2:113700675-113700697 CAATGTGGGCATATGGTAAATGG - Intergenic
937121220 2:119441126-119441148 CAGTCTGCCCATATGTGAAACGG - Intronic
938209315 2:129453602-129453624 CAGTGAGAACATATGGAAACAGG + Intergenic
938323142 2:130378854-130378876 CAGTGTTGACATTTGGAAAATGG + Intergenic
939245458 2:139617837-139617859 CAGCTTGACCATGTGGTAAAAGG - Intergenic
939726744 2:145729985-145730007 CAGGATGACCATATGGTAAGGGG + Intergenic
940833387 2:158493459-158493481 TAGGGTAACCACATGGAAAATGG - Intronic
940969159 2:159876322-159876344 CAGTGTGATGTAATGGAAAATGG - Intronic
940970583 2:159892439-159892461 CACTGTGATCATCTGTAAAATGG + Intronic
941967601 2:171314917-171314939 CACTGTGACCTTATGGAAAGTGG - Intergenic
942192971 2:173489125-173489147 CAGTGTGGCCATAATGAAATTGG + Intergenic
943575140 2:189623256-189623278 CAGTTTGATCATCTGTAAAATGG + Intergenic
944910517 2:204306155-204306177 CAGTGTCCCCATCTGTAAAATGG - Intergenic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
945774707 2:214091309-214091331 CAGTGTTTCCATCTGCAAAATGG - Intronic
946807993 2:223491417-223491439 CAATGAGAACATATGGAAACAGG + Intergenic
946842766 2:223835167-223835189 CAGTTTGCCCATTTGAAAAATGG - Intronic
947977424 2:234378993-234379015 CAGTGAGACCACATGGACACAGG - Intergenic
948597573 2:239090089-239090111 CAGTGACACCATATGGAACGAGG - Exonic
1168984769 20:2038719-2038741 CAGTTTCCCCATCTGGAAAATGG + Intergenic
1171041415 20:21767379-21767401 CAGTGTCATCATCTGTAAAATGG + Intergenic
1172126172 20:32626626-32626648 CAGTCTCCCCATCTGGAAAATGG + Intergenic
1172226585 20:33309485-33309507 CAGTGTCCCCATCTGCAAAATGG + Intronic
1172245277 20:33441787-33441809 CAGTGTGTCCATCTGCAGAATGG + Intronic
1172321373 20:33997609-33997631 CTGTGTGCCTCTATGGAAAAAGG - Intronic
1172775588 20:37404817-37404839 CAGTGTGCCCATCTGTAAAGGGG + Exonic
1172897846 20:38313072-38313094 CAGTTTTACCATCTGTAAAATGG + Intronic
1173076483 20:39824277-39824299 CAGTTTGCCCATGTGCAAAATGG + Intergenic
1173608836 20:44351820-44351842 CAGTGTACCCATCTGTAAAAAGG - Intergenic
1173747343 20:45448014-45448036 CAGTGTTCCCATCTGAAAAAGGG - Intergenic
1173841516 20:46160490-46160512 CAGGGTGACCAGATGGCAACAGG - Intergenic
1173925832 20:46780526-46780548 CAGTGCCACCCCATGGAAAAGGG - Intergenic
1174279471 20:49428301-49428323 CAGTTTTACCATCTGTAAAATGG - Intronic
1174375868 20:50126279-50126301 CAGTGTGCTCATGTGGAAAATGG - Intronic
1174385865 20:50188465-50188487 CTGTGTGACCTTAGGCAAAATGG - Intergenic
1174429437 20:50456948-50456970 CAGTTTTGCCATCTGGAAAAAGG + Intergenic
1174529000 20:51196193-51196215 CAGTGTGACCATCCATAAAATGG + Intergenic
1174546584 20:51330454-51330476 CAGTTTTACCACTTGGAAAATGG - Intergenic
1174822118 20:53735579-53735601 CAGTTTCATCATCTGGAAAACGG - Intergenic
1175788462 20:61726434-61726456 CAGTGTGTCCATATGTAAAATGG + Intronic
1177073720 21:16545277-16545299 CAGTTTGGTCATCTGGAAAATGG - Intergenic
1177283165 21:19011641-19011663 CAGTGTTAACATTTGGAAGAGGG - Intergenic
1177960467 21:27660377-27660399 CAGTATGGCCACATGGAGAATGG + Intergenic
1178123963 21:29497584-29497606 GAATGTGACCATATGAAAATAGG - Intronic
1178678470 21:34651488-34651510 CATTCTGACCATATGGAACTTGG - Intergenic
1179171488 21:38976393-38976415 CACTGGGAGCATTTGGAAAATGG + Intergenic
1179418351 21:41216193-41216215 CAGTGTCACCACACAGAAAATGG + Intronic
1180318043 22:11294202-11294224 CAATGAGAACACATGGAAAAAGG + Intergenic
1181980497 22:26762655-26762677 CAGTGTTCCCATCTGTAAAATGG - Intergenic
1182096567 22:27630102-27630124 CAGTTTGCCCATCTGTAAAATGG + Intergenic
1182276838 22:29195271-29195293 CAGTGTGTTCACCTGGAAAATGG - Intergenic
1182547836 22:31085849-31085871 CAGTGTCCCCATCTGGAAAATGG - Intronic
1182787485 22:32919857-32919879 CAGTTTGCCCATCTGTAAAATGG + Intronic
1183247595 22:36705787-36705809 CAGTCTTACCATATGTTAAATGG + Intergenic
1184283041 22:43449777-43449799 CAGTTTTATCATTTGGAAAATGG + Intronic
1184469075 22:44685298-44685320 CAGTCTCACCATCTGTAAAATGG + Intronic
1184473995 22:44710953-44710975 CAGTGTCCCCATCTGGAAAATGG - Intronic
1184566212 22:45293636-45293658 CAGTTTCCCCATCTGGAAAATGG + Intronic
949271315 3:2220643-2220665 CAGTTTGATCATCTGAAAAAAGG + Intronic
949761793 3:7479041-7479063 CAGTGTACCCATATGTAAAGTGG + Intronic
949815137 3:8050101-8050123 CAGTGTTCCTATATGTAAAATGG - Intergenic
950390818 3:12695122-12695144 CAGTCTTACCTTATGTAAAATGG - Intergenic
950950837 3:16996548-16996570 CAGTGGGACCATAAGGGAAATGG + Intronic
951835407 3:26977894-26977916 CAGTGAGAACATATGGACACAGG + Intergenic
952069947 3:29622797-29622819 CAGTGTGCTCATCTGTAAAATGG + Intronic
952179015 3:30898151-30898173 CAGTTTGTCCATTTGCAAAATGG - Intergenic
952212515 3:31242495-31242517 CTGTTTGACCATATTGAGAAGGG - Intergenic
952583526 3:34863999-34864021 CAGTGTCTCCATATGTAAAATGG - Intergenic
952641364 3:35600722-35600744 CAATGAGAACATATGGACAAAGG - Intergenic
952970372 3:38647048-38647070 CAGTTTCACCATCTGCAAAACGG + Intronic
953297463 3:41734745-41734767 CAGTGGGACTATGTGAAAAAGGG - Intronic
954070843 3:48141776-48141798 CTGTCTGTCCATCTGGAAAATGG + Intergenic
955422241 3:58750377-58750399 CAATGTAACCATGTGGAAGATGG + Intronic
955523596 3:59798749-59798771 CAGTTTCAGCATCTGGAAAATGG + Intronic
955584710 3:60463780-60463802 CAGTGTTAACTTATGTAAAATGG + Intronic
955940333 3:64141042-64141064 TAGTGTACCCATATGTAAAATGG + Intronic
956333605 3:68139018-68139040 GAGTGTGACCATGTAGAAACAGG + Intronic
957586191 3:82135537-82135559 GAGTGTGACCATGTGGAGATAGG - Intergenic
959030507 3:101294286-101294308 CAGTGAGAACACATGGAAAAAGG - Intronic
959319781 3:104857254-104857276 GATTGTGACCATATGTAAGATGG - Intergenic
960743513 3:120860909-120860931 CAGTGTCCTCATCTGGAAAATGG - Intergenic
962451252 3:135519187-135519209 AAGTGTGAAAATATGGCAAAAGG - Intergenic
963113780 3:141708464-141708486 CAGTCAGACCACATGAAAAAAGG + Intergenic
963512501 3:146266009-146266031 CTGTGTGAATATAAGGAAAATGG + Intergenic
964044562 3:152307587-152307609 CAGTGTGTCCATCTGTGAAATGG - Intronic
964925588 3:161952776-161952798 AAGTGTGACCTGATGGAAACAGG - Intergenic
965294444 3:166925581-166925603 AAGTGTGACCTTATGGACTAAGG - Intergenic
965671265 3:171150292-171150314 CAGTTTGACCATTTATAAAATGG - Intronic
966087012 3:176080286-176080308 CAGTGTGACCATTAGGACCAGGG + Intergenic
968079178 3:195834838-195834860 CAGTGTATCCATCTGGGAAAGGG - Intergenic
969090364 4:4689553-4689575 CAGTGGCACCACCTGGAAAAGGG - Intergenic
969481110 4:7447425-7447447 CAGTGTTCCCATCTGGAAAATGG - Intronic
969594271 4:8140049-8140071 CAGTGAGAACACATGGAAACGGG + Intronic
970072185 4:12173217-12173239 CAGTTTCATCATATGCAAAAGGG - Intergenic
970156492 4:13147307-13147329 CAGTGTGAAATTCTGGAAAATGG + Intergenic
970736896 4:19182012-19182034 CAATCTGTCCATCTGGAAAAGGG + Intergenic
971038670 4:22725117-22725139 CAGTGTGAACATATAGACACAGG - Intergenic
971182215 4:24339464-24339486 CAGTGTGAACAAAGGTAAAAAGG - Intergenic
972340092 4:38145007-38145029 CACAGTGACCAAATGGAAGATGG + Intergenic
972525188 4:39903179-39903201 CTATGTGACAACATGGAAAATGG - Intronic
974213704 4:58817045-58817067 AAATGTAACCATATAGAAAAGGG + Intergenic
974316138 4:60282924-60282946 CAGTATGGCCACATGGAGAATGG - Intergenic
974320857 4:60347719-60347741 CAGTGTGAGGATATTGAAAAGGG - Intergenic
975503790 4:75116553-75116575 CAATGTGAGCACTTGGAAAAGGG + Intergenic
975555729 4:75662949-75662971 CATTGTTACCATTTTGAAAATGG - Intronic
975704392 4:77097652-77097674 CCATGTGAACATATGGCAAAAGG + Intergenic
976651093 4:87435663-87435685 CAGTGTGAAAAAATAGAAAAGGG + Intronic
977191723 4:94009359-94009381 CAATGTAACAATATGGATAAGGG - Intergenic
978085853 4:104652983-104653005 CAGTGTAACCATCTGGAACTGGG - Intergenic
978337732 4:107687903-107687925 CAGAGGGACCATAAGGAAGATGG - Intronic
978913060 4:114088509-114088531 CAGTGTACTCATATGTAAAATGG - Intergenic
979322963 4:119345695-119345717 CAGTTTCCCCATCTGGAAAATGG + Intergenic
980747521 4:137037926-137037948 CAATGTGGCAATATGGAGAAGGG - Intergenic
980915729 4:139031579-139031601 GAATGCGACCATAAGGAAAATGG - Intronic
981576358 4:146210032-146210054 CAGTTTTACCATCTGCAAAATGG - Intergenic
982221468 4:153129144-153129166 CAGTCTCACTATATGAAAAAGGG + Intergenic
982619756 4:157689650-157689672 CAATGTGAGAAAATGGAAAAAGG - Intergenic
983240799 4:165230344-165230366 CAGTTTCCCCATCTGGAAAATGG + Intronic
986376584 5:7138028-7138050 CACTGTTACCATAAGAAAAATGG - Intergenic
986611470 5:9572293-9572315 CAGTCTGACCATGTGAAGAAGGG - Intergenic
987853164 5:23383072-23383094 CAGTGAGAACACATGGACAAGGG + Intergenic
988003242 5:25377036-25377058 CAGTGGGAACATATGTGAAAGGG - Intergenic
989037327 5:37189264-37189286 CAGTTTGACATTATGGAAAGTGG + Intronic
989429227 5:41332891-41332913 CAGTGTGAACACATGGACACAGG + Intronic
989470529 5:41812372-41812394 CATTCTGACAATATGAAAAAGGG + Intronic
990108256 5:52291480-52291502 CAGTGTCATCATATGAAAAGGGG + Intergenic
990175233 5:53100410-53100432 CAAGGTGCCCATATGGAAAAAGG - Exonic
990343343 5:54847245-54847267 CAGTGAGAACACATGGACAAAGG + Intergenic
992174403 5:74135200-74135222 CAGTGTGGCCCTATGTAATATGG - Intergenic
992556117 5:77905438-77905460 CTGTGTGGCCATACGAAAAAAGG + Intergenic
992938816 5:81741147-81741169 CAGTTTCCCCATATGTAAAATGG + Intronic
993019263 5:82571664-82571686 CATTGTTACCATATGGTGAAAGG - Intergenic
994121202 5:96114958-96114980 CAGTTTGCTCATATGTAAAATGG + Intergenic
994555740 5:101300149-101300171 GGGTGTCACCATATGGGAAATGG - Intergenic
994933173 5:106216494-106216516 CAGTATGACAACTTGGAAAAAGG + Intergenic
995398168 5:111711398-111711420 CAGTGAGAACATATGGACACAGG - Intronic
995609075 5:113889698-113889720 CAATGTGAACATATGGACACAGG - Intergenic
996037107 5:118770778-118770800 CAGTTTCCCCATGTGGAAAATGG + Intergenic
997397809 5:133578371-133578393 CAGTTTGCCCATCTGTAAAACGG + Intronic
997622597 5:135308427-135308449 CAGTGTGCTCATCTGTAAAACGG + Intronic
997658928 5:135575470-135575492 CAGTTTGGCCATCTGTAAAATGG + Intronic
998459164 5:142296657-142296679 CAGTTTCCCCATCTGGAAAATGG - Intergenic
998538307 5:142954778-142954800 CAGTGTCTCCATAAGGACAAAGG - Intronic
999028456 5:148262415-148262437 CAGTGTGTCCATCTGTAAAATGG - Intergenic
999238769 5:150115483-150115505 CAGTTTTCCCATATGTAAAATGG - Exonic
999674247 5:153983061-153983083 CAGTTTGACAATCTGTAAAATGG - Intergenic
1000078899 5:157824814-157824836 CAGTGTGACATAATAGAAAATGG - Intronic
1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG + Intergenic
1000378006 5:160602222-160602244 CAGTTTTACCATCTGTAAAATGG - Intronic
1000998220 5:167980465-167980487 CAGTGTGACCACCTGGACATGGG + Intronic
1001110453 5:168891677-168891699 CATTCTGACCAAAGGGAAAAAGG + Intronic
1001136782 5:169109046-169109068 CACTGACAGCATATGGAAAAGGG + Intronic
1001241766 5:170076704-170076726 CAGTTTTACCATCTGTAAAATGG - Intronic
1001400268 5:171442203-171442225 TGGTGTGTCCATATGGAGAAAGG + Intronic
1001489043 5:172142757-172142779 CAGTTTCCCCATATGTAAAATGG - Intronic
1002135240 5:177103730-177103752 CAGTGTCCACATCTGGAAAATGG - Intergenic
1002296725 5:178235494-178235516 CAGTGTTCCCCTATGTAAAATGG + Intergenic
1003497623 6:6678232-6678254 CCCTGGGACCATATGGAAACGGG - Intergenic
1003966925 6:11261298-11261320 CAGTTTTGCCATATAGAAAATGG - Intronic
1004043002 6:12000353-12000375 CAGTGTCCCCATCTGTAAAATGG - Intergenic
1004210581 6:13638225-13638247 CAGTGTATTCATATGTAAAATGG - Intronic
1005359826 6:25021275-25021297 CAGGGTGACTATATGAAAAAAGG + Intronic
1005898941 6:30200757-30200779 CAGTGTATCCATCTGTAAAATGG + Intronic
1006394629 6:33779076-33779098 CAGGATGACCATATTGAAAGTGG - Intronic
1006435788 6:34025601-34025623 CAGTCTCACCATCTGGAAAATGG + Intronic
1006499873 6:34451349-34451371 CAGTTTCACCATCTGTAAAATGG - Intergenic
1006797021 6:36738314-36738336 CAGTGTTCTCATCTGGAAAATGG + Intergenic
1006840684 6:37026294-37026316 CAGTGTTCCCATCTGTAAAATGG - Intronic
1006902484 6:37512118-37512140 CAGTGTGCTCATCTGGAAAGCGG - Intergenic
1009280625 6:61746351-61746373 CAGTGAGACCACATGGACACAGG - Intronic
1009400253 6:63246141-63246163 CAGTGAGAACATATGGACACAGG - Intergenic
1009570795 6:65381413-65381435 CAGTGTGAACACATGGAGATAGG + Intronic
1009604864 6:65854500-65854522 CAGGGTGGACATATGAAAAAGGG - Intergenic
1011344365 6:86352801-86352823 CAGTGGGGCCAAATGGAGAATGG - Intergenic
1011572510 6:88754528-88754550 CAGTGAGCCAATAAGGAAAATGG + Intronic
1012628353 6:101431693-101431715 CAGTTTGACCATTTGAAAAATGG + Intronic
1014012074 6:116487380-116487402 CAGTGTGAACACATGGATACAGG - Intergenic
1014620890 6:123666013-123666035 CAGTGTGAGAATATTGAAAATGG - Intergenic
1014902805 6:126988452-126988474 CAGTGAGAACATATGGACACAGG + Intergenic
1015363070 6:132363669-132363691 CAGTGTGTTCATATGGAAAGTGG + Intronic
1015451812 6:133378612-133378634 CAGTGTTACTATATGGGAACTGG + Intronic
1018224670 6:161616605-161616627 CAGTGAGAACATATGGATACAGG - Intronic
1018414375 6:163588717-163588739 CAGTGTGACCGTAGAGAATAAGG - Intergenic
1018588886 6:165394261-165394283 CAGTGAGAACATATGGACACAGG - Intronic
1019212549 6:170418278-170418300 CTCTGGGACCATTTGGAAAATGG - Intergenic
1019841789 7:3453388-3453410 GAATGTGACCATTTGGACAAAGG + Intronic
1020995205 7:15255155-15255177 CAGTGTGAACATATGGACATAGG + Intronic
1022037132 7:26545140-26545162 CAGGGTGACAAAATGGAACACGG + Intergenic
1022117505 7:27275172-27275194 CAGTTTCCCCATATGTAAAATGG - Intergenic
1022400554 7:30032491-30032513 CAGTGTCTTCATCTGGAAAATGG - Intronic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1022952753 7:35354239-35354261 CAGTTTTATCATCTGGAAAATGG - Intergenic
1023185271 7:37526571-37526593 CAGTGTGACCAAAAGGAATCTGG - Intergenic
1023906152 7:44522965-44522987 CAGAGTGACATTAGGGAAAATGG + Intronic
1024727981 7:52221174-52221196 TTTTGTGACCATATGGAAAGGGG + Intergenic
1026638061 7:72101627-72101649 AAGGGTGACCATATGGTGAATGG - Intronic
1026970382 7:74464216-74464238 CAGTTTGACCCTCTAGAAAATGG + Intronic
1028575872 7:92349779-92349801 CAGTTTCACCATATGTAAAATGG - Intronic
1028682575 7:93553631-93553653 CAATGTCCCCATTTGGAAAATGG + Intronic
1029662345 7:101971091-101971113 CAGTCTCCCCAGATGGAAAATGG - Intronic
1030635885 7:111948224-111948246 CAGTTTTCCCATATGTAAAATGG - Intronic
1031490216 7:122378264-122378286 CAGTATGACAAAATAGAAAAAGG + Intronic
1033262178 7:139853470-139853492 CAGTGTTCCCATCTGCAAAACGG + Intronic
1037087634 8:14872115-14872137 CAATGAGAACATATGGAAACAGG + Intronic
1037606387 8:20441210-20441232 CAGTGTCCCCATCTGTAAAATGG - Intergenic
1037881926 8:22577813-22577835 CAGTTTCCCCATGTGGAAAATGG - Intergenic
1038026039 8:23591642-23591664 CAGTGAGAACATAGGGGAAAGGG + Intergenic
1039380918 8:37084481-37084503 CAGTTTGCCCATCTGTAAAAGGG - Intergenic
1040748797 8:50680307-50680329 CAGTGTGAGAATGTGGACAAAGG - Intronic
1040809550 8:51436491-51436513 CAGTGGGATCACATGGAAGAAGG - Intronic
1041074227 8:54154568-54154590 CAGTCTCACCATCTGAAAAATGG + Intergenic
1041380206 8:57246930-57246952 CACTGTGACATTATAGAAAAAGG + Intergenic
1041617686 8:59927446-59927468 CAGTTTCCCCATGTGGAAAAGGG + Intergenic
1042701179 8:71616747-71616769 CAGTGTCAGCAAATGGAACAAGG + Intergenic
1043571733 8:81611381-81611403 CAGTGAGAACACATGGACAAGGG + Intergenic
1043987510 8:86711125-86711147 GAGGGTTGCCATATGGAAAAGGG - Intronic
1044290609 8:90464672-90464694 CAGTGTCCTCATATGTAAAATGG - Intergenic
1045086714 8:98694544-98694566 CAATGAGAACATATGGACAAAGG - Intronic
1045480086 8:102584811-102584833 GGGTGTGACCATATGGAAACAGG - Intergenic
1045499675 8:102735525-102735547 CAGAGTGACAAGAAGGAAAATGG + Intergenic
1046060902 8:109138467-109138489 CAATCTGACCATTTGGGAAATGG - Intergenic
1046449885 8:114374776-114374798 CAGAGTGATCACATGGCAAAAGG - Intergenic
1047670198 8:127137536-127137558 CTGTGTCCCCATATGCAAAATGG + Intergenic
1048216987 8:132505380-132505402 CAGTTTGCCCATCTGTAAAATGG - Intergenic
1048352919 8:133630412-133630434 CAGTATCTCCATCTGGAAAATGG - Intergenic
1048386877 8:133920297-133920319 CAGTGTGAACACATAGAAATGGG - Intergenic
1048444515 8:134483267-134483289 CAGTGTCCCCATTTGTAAAATGG - Intronic
1048663470 8:136633706-136633728 CAGGGTGACCCTAAGGACAACGG - Intergenic
1048715593 8:137265226-137265248 CAGTGATAGCATAGGGAAAATGG + Intergenic
1048720715 8:137321160-137321182 CAGTATGCTCATATGCAAAAAGG + Intergenic
1048721440 8:137330280-137330302 CAGTTTGGCCATCTGTAAAATGG + Intergenic
1048856480 8:138690686-138690708 CAGTGTCTCCGTCTGGAAAATGG + Intronic
1048977503 8:139681198-139681220 TAGTGTTTCCATATGTAAAATGG - Intronic
1049316622 8:141972585-141972607 GAGTGTGGCCATTTGGAAGATGG + Intergenic
1051205838 9:14688204-14688226 CAGTTTGACCATCTGTAAAATGG + Intronic
1052323939 9:27197030-27197052 CAATGAGAACATATGGAAACAGG + Intronic
1052389049 9:27856676-27856698 CAGTGTGATCATCTTAAAAATGG + Intergenic
1055039113 9:71849899-71849921 CAATGAGAACATATGGAAACAGG + Intergenic
1055129734 9:72761364-72761386 CAGTGAGATCATATGGGTAAAGG + Intronic
1055540515 9:77299874-77299896 CAGTGAGAACATATGGACACAGG + Intronic
1055618619 9:78099651-78099673 CAGTGTGACTGTTTGGAAATAGG + Intergenic
1056538089 9:87548356-87548378 CAGTATCACCATCTGTAAAATGG + Intronic
1057307112 9:93918852-93918874 CAGTTTCACCACCTGGAAAAGGG + Intergenic
1057952837 9:99383722-99383744 CAGTTTTACCATCTGCAAAATGG + Intergenic
1059358462 9:113719615-113719637 CAGTGTGACTATTTGGATATAGG + Intergenic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1059543179 9:115150964-115150986 CAGTGTCTCTATATGGAATAAGG - Intronic
1059656490 9:116362391-116362413 CAGTTTCCCCATATGTAAAATGG + Intronic
1059705665 9:116820962-116820984 CAGTGTGCCCACCTGTAAAATGG + Intronic
1060191862 9:121598856-121598878 CAGTGTGCCTATCTGGGAAATGG + Intronic
1060204264 9:121673369-121673391 CAGTTTCTCCATCTGGAAAATGG + Intronic
1060292149 9:122313894-122313916 AAGTGTAACCATATGTACAAAGG + Intronic
1060529239 9:124338758-124338780 CAGTTTCTCCATCTGGAAAATGG + Intronic
1060802227 9:126552007-126552029 CAGTTTCATCATCTGGAAAATGG - Intergenic
1060857195 9:126924268-126924290 CAGTGTGACTGTATAGGAAAAGG + Intronic
1061045578 9:128163292-128163314 CAGTGTCACCGTCTGGAAAATGG - Intronic
1061057388 9:128231792-128231814 CAGTTTCTCCATGTGGAAAATGG - Intronic
1061630053 9:131866648-131866670 CAGTTTTCCCATCTGGAAAATGG + Intronic
1061700661 9:132412545-132412567 CAGTGTGCTCATTTGCAAAAAGG - Intronic
1062021621 9:134322230-134322252 CAGTGTTTCCATCTGGGAAACGG + Intronic
1186351314 X:8742459-8742481 CAGTGTTCTCAAATGGAAAATGG + Intergenic
1189092806 X:38105149-38105171 CAGTGTGTCCAACTGGACAAAGG + Intronic
1189289435 X:39874836-39874858 CAGTTTCATCATATGAAAAATGG + Intergenic
1189718259 X:43886613-43886635 CAATGGAACCATAAGGAAAAAGG - Intergenic
1189917296 X:45868612-45868634 CAGTGTGACAATTTGAAACATGG + Intergenic
1190407082 X:50098937-50098959 CAGTGTTCCCATCTGCAAAATGG + Exonic
1190684644 X:52860810-52860832 CAGTGAGAACACATGGAAACAGG + Intergenic
1190912499 X:54786138-54786160 CAGAGTGACCATGTGGATGATGG - Intronic
1190918460 X:54827270-54827292 CAGAGTGACCATGTGGATGATGG + Intergenic
1191691462 X:63943385-63943407 CATTGTGCCCATATGTAAAATGG - Intergenic
1191721570 X:64233621-64233643 CAGTGAGAACATATGGACACGGG + Intergenic
1191777080 X:64826459-64826481 CAATGAGAACACATGGAAAAAGG + Intergenic
1191785761 X:64915804-64915826 CAGTGTCCTCATCTGGAAAATGG - Intronic
1192269195 X:69562841-69562863 CAGTGTGATGATCTGTAAAATGG + Intergenic
1192746959 X:73948909-73948931 CATTGTGACTATATAGAAAAAGG - Intergenic
1193086757 X:77453942-77453964 CAGTTTTTCCATATGTAAAACGG - Intronic
1193895671 X:87111833-87111855 CAGTGTGAACATATAGACACAGG + Intergenic
1194593980 X:95835836-95835858 CAGTGAGAAGATATGGAAACAGG + Intergenic
1194746380 X:97633017-97633039 CACTGGGAGCATTTGGAAAAGGG - Intergenic
1195401292 X:104464228-104464250 CAGTGTTCTCATATGTAAAATGG + Intergenic
1195767721 X:108314278-108314300 CAGTGTTATCATCTGTAAAATGG - Intronic
1195983234 X:110601834-110601856 CACTGTGATCATTTGGAGAAGGG - Intergenic
1197537913 X:127713233-127713255 CAATGAGAACATATGGACAAAGG - Intergenic
1197891940 X:131277525-131277547 CAGTTTGCCCATTTGGACAAGGG + Intronic
1198010038 X:132542992-132543014 CAGTGAGAGCATATGGACACAGG - Intergenic
1198134739 X:133737620-133737642 CATTGAGACCATATGGAATGTGG - Intronic
1198875680 X:141223811-141223833 CAATGAGAACATATGGACAAGGG - Intergenic
1198987382 X:142471042-142471064 CTGTATGACCTTATAGAAAAAGG + Intergenic
1199208428 X:145176630-145176652 CAGTGTCACACCATGGAAAAGGG + Intergenic
1199455547 X:148023970-148023992 CAGTTTCCCCATATGAAAAATGG + Intronic