ID: 1083766858

View in Genome Browser
Species Human (GRCh38)
Location 11:64845378-64845400
Sequence TTTAAGCTTCAGTAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083766848_1083766858 23 Left 1083766848 11:64845332-64845354 CCCTGGGGTGGAGGTGGAGCTGG No data
Right 1083766858 11:64845378-64845400 TTTAAGCTTCAGTAGGAGCAGGG No data
1083766854_1083766858 -7 Left 1083766854 11:64845362-64845384 CCAACACCACAGGCGTTTTAAGC No data
Right 1083766858 11:64845378-64845400 TTTAAGCTTCAGTAGGAGCAGGG No data
1083766850_1083766858 22 Left 1083766850 11:64845333-64845355 CCTGGGGTGGAGGTGGAGCTGGG No data
Right 1083766858 11:64845378-64845400 TTTAAGCTTCAGTAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083766858 Original CRISPR TTTAAGCTTCAGTAGGAGCA GGG Intergenic
No off target data available for this crispr