ID: 1083768177

View in Genome Browser
Species Human (GRCh38)
Location 11:64852287-64852309
Sequence CGGTTTAAGTACAGGGAAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083768177_1083768186 6 Left 1083768177 11:64852287-64852309 CCGGCTTCCCTGTACTTAAACCG 0: 1
1: 0
2: 1
3: 3
4: 67
Right 1083768186 11:64852316-64852338 GGGCTAGCAAGGAGCCAGTCTGG 0: 1
1: 0
2: 4
3: 16
4: 172
1083768177_1083768183 -5 Left 1083768177 11:64852287-64852309 CCGGCTTCCCTGTACTTAAACCG 0: 1
1: 0
2: 1
3: 3
4: 67
Right 1083768183 11:64852305-64852327 AACCGTCCTTGGGGCTAGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083768177 Original CRISPR CGGTTTAAGTACAGGGAAGC CGG (reversed) Exonic
903002987 1:20279604-20279626 CAGGTTAAGGACAGGGAAGTAGG + Intergenic
904289886 1:29478305-29478327 CGGCTGGAGTACAGGGAAGGGGG - Intergenic
911782227 1:101896188-101896210 CAGTTTAAATTCAGGAAAGCAGG - Intronic
921181903 1:212638011-212638033 GGGGTTAAGTAGAGGCAAGCCGG - Intergenic
924494538 1:244574287-244574309 CGGTTAAAGTACAAGGACACAGG + Intronic
1064429390 10:15257869-15257891 CGGCTTTAGTACACGGAGGCAGG - Intronic
1073176255 10:101559420-101559442 CGGGTTAAGTGGAGGGAGGCAGG - Intergenic
1073806757 10:107106901-107106923 CCATTTACGTACAAGGAAGCAGG + Intronic
1075533377 10:123249451-123249473 TGGTCTTAGTATAGGGAAGCTGG + Intergenic
1080831156 11:35894486-35894508 CGTGTTATGTGCAGGGAAGCAGG - Intergenic
1083768177 11:64852287-64852309 CGGTTTAAGTACAGGGAAGCCGG - Exonic
1084751631 11:71208106-71208128 GGGTTTAAGTACAGGGACGCTGG - Intronic
1088690113 11:112319200-112319222 CGGTTTCAGTACATGGAAAAGGG - Intergenic
1088699683 11:112400755-112400777 TGGTTTATGAACTGGGAAGCAGG + Intergenic
1090269358 11:125375027-125375049 TGGTTAAAAGACAGGGAAGCTGG - Intronic
1091839687 12:3611935-3611957 AGGTATAAGAACAGGGAAGCAGG + Intronic
1091884571 12:4006866-4006888 CGGTATAAGTTCAGGAATGCTGG + Intergenic
1093304797 12:17502048-17502070 AAGTACAAGTACAGGGAAGCTGG - Intergenic
1096869224 12:54583086-54583108 GGGTAGAGGTACAGGGAAGCGGG + Intronic
1099845696 12:88025420-88025442 AGGTTTAAGGAGAGGGAAGGAGG + Intronic
1099952672 12:89321800-89321822 CAGTTTAAGTAATGGCAAGCAGG - Intergenic
1103044016 12:117720212-117720234 CCCTTCAATTACAGGGAAGCAGG + Intronic
1107107378 13:36659676-36659698 TGGTTTAAGAACAGGGTAGATGG + Intergenic
1110654376 13:77979594-77979616 AGGTTTAAGTACAGGAAAAGTGG + Intergenic
1112191195 13:97179567-97179589 GAATTTAAGTCCAGGGAAGCAGG - Intergenic
1120496006 14:85236508-85236530 CAATTTAAATACTGGGAAGCTGG - Intergenic
1135489773 16:22899262-22899284 AGGTTTCAGAGCAGGGAAGCTGG + Intronic
1136750605 16:32632449-32632471 GGGTTAAAATACAAGGAAGCCGG + Intergenic
1203052735 16_KI270728v1_random:891655-891677 GGGTTAAAATACAAGGAAGCCGG + Intergenic
1146904989 17:36612510-36612532 TGGGTTAAGTACACGGGAGCTGG + Intergenic
1161601010 19:5182781-5182803 CGTTCTAAGTACAGGGAAACTGG - Intronic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
932400420 2:71477043-71477065 CACTTTCAGTACTGGGAAGCTGG - Intronic
945622141 2:212153242-212153264 GGTTTAAAGTACAGGGAACCTGG - Intronic
1169198780 20:3697533-3697555 GGGTTGCAGTACAGGGAAGGAGG + Intronic
1169285136 20:4301517-4301539 CTGATTAGGGACAGGGAAGCTGG - Intergenic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1180859509 22:19069267-19069289 CGGTTCAGGTTCAGGGAAGGAGG - Intronic
1184575354 22:45359950-45359972 CTGTGTAATTACAGGGAAGTGGG - Exonic
950690684 3:14653692-14653714 CGGTTCAAGAACAGGAAAGAAGG - Intronic
956271646 3:67454192-67454214 CTCTTTAAGTACAGGGACGAGGG + Intronic
960768086 3:121160144-121160166 CAGTTCAATTACAGGGAATCTGG - Intronic
961196674 3:125007813-125007835 CAGTTTAAGAATAGAGAAGCTGG - Intronic
966488241 3:180496527-180496549 AGGATTAAATACAGGGAAGTTGG - Intergenic
972815187 4:42637127-42637149 CGGTTGAGGTACAGGGAACAGGG - Intronic
977989771 4:103427000-103427022 CAGTTTATGTGGAGGGAAGCAGG + Intergenic
978577233 4:110199223-110199245 GGGTTTAGGTACCGGGAAGGGGG + Intergenic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
987916570 5:24222785-24222807 GGGTTTCATTACAGGGATGCAGG - Intergenic
993131191 5:83900237-83900259 CGGTATAAGTGCAGGGATGGGGG + Intergenic
996097807 5:119417369-119417391 CCTTTTAAATATAGGGAAGCCGG - Intergenic
998518141 5:142774383-142774405 TGATTTAAGTGCAGGGAAGGAGG - Intronic
999950184 5:156640985-156641007 AGGATTAAGCACAGGGAAGGTGG - Intronic
1005041853 6:21607316-21607338 TGGGTCAAGTACATGGAAGCAGG + Intergenic
1008854215 6:56062181-56062203 TGGTTTAAGCACAGGACAGCTGG - Intronic
1009206646 6:60810378-60810400 CCTTATAAGTCCAGGGAAGCCGG - Intergenic
1010697748 6:78998245-78998267 CCGTTTAAGTAGAGGTAAGCAGG - Exonic
1020997728 7:15284890-15284912 GGGTTTCATTACAGGGATGCAGG + Intronic
1025026385 7:55519763-55519785 CGGGTAAAGCACACGGAAGCTGG - Intronic
1025855025 7:65269225-65269247 CGCTTTATGGACAGGGAAACAGG - Intergenic
1045492019 8:102677131-102677153 GAGTCTAAGTACAGGAAAGCAGG - Intergenic
1047192054 8:122687139-122687161 GCGTTTAAGTAGAGGGAAGAAGG - Intergenic
1049245015 8:141557770-141557792 CGGGTTAAGTGGAGGGAGGCGGG + Intergenic
1050167938 9:2785875-2785897 AGGTTTAGGCACAAGGAAGCTGG + Intronic
1053125396 9:35576757-35576779 AGGTTTAAGTATAGGTAAGAAGG - Intergenic
1056037959 9:82628998-82629020 GGAGTGAAGTACAGGGAAGCAGG - Intergenic
1187189633 X:17021575-17021597 CGGTTTGAATGCAGGCAAGCTGG - Intronic
1187812962 X:23200424-23200446 GGGTGTGAGTACAGGGGAGCAGG - Intergenic
1188979822 X:36716902-36716924 AGATTTAAGTACAGGGCAGAAGG + Intergenic
1189183994 X:39035732-39035754 AGGTTTAAGTCGAGGGAAGGAGG - Intergenic
1193307702 X:79969152-79969174 GGGTTTTATTCCAGGGAAGCAGG - Intergenic
1198441273 X:136665689-136665711 CAGTTTAATTACAGGGCAACAGG + Exonic