ID: 1083772418

View in Genome Browser
Species Human (GRCh38)
Location 11:64875700-64875722
Sequence GCCCGTGGGCCCCTGGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 164}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083772418_1083772425 -5 Left 1083772418 11:64875700-64875722 CCAGTGACCAGGGGCCCACGGGC 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1083772425 11:64875718-64875740 CGGGCAGAGGGCAGCTGGCCAGG 0: 1
1: 0
2: 6
3: 54
4: 587
1083772418_1083772431 15 Left 1083772418 11:64875700-64875722 CCAGTGACCAGGGGCCCACGGGC 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1083772431 11:64875738-64875760 AGGGCAAGGGGTGCTCTGCAAGG 0: 1
1: 0
2: 1
3: 22
4: 271
1083772418_1083772429 3 Left 1083772418 11:64875700-64875722 CCAGTGACCAGGGGCCCACGGGC 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1083772429 11:64875726-64875748 GGGCAGCTGGCCAGGGCAAGGGG 0: 1
1: 0
2: 12
3: 90
4: 876
1083772418_1083772432 21 Left 1083772418 11:64875700-64875722 CCAGTGACCAGGGGCCCACGGGC 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1083772432 11:64875744-64875766 AGGGGTGCTCTGCAAGGCAGTGG 0: 1
1: 0
2: 3
3: 28
4: 291
1083772418_1083772427 1 Left 1083772418 11:64875700-64875722 CCAGTGACCAGGGGCCCACGGGC 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1083772427 11:64875724-64875746 GAGGGCAGCTGGCCAGGGCAAGG 0: 1
1: 0
2: 8
3: 107
4: 817
1083772418_1083772422 -10 Left 1083772418 11:64875700-64875722 CCAGTGACCAGGGGCCCACGGGC 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1083772422 11:64875713-64875735 GCCCACGGGCAGAGGGCAGCTGG 0: 1
1: 0
2: 2
3: 45
4: 409
1083772418_1083772428 2 Left 1083772418 11:64875700-64875722 CCAGTGACCAGGGGCCCACGGGC 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1083772428 11:64875725-64875747 AGGGCAGCTGGCCAGGGCAAGGG 0: 1
1: 0
2: 6
3: 62
4: 541
1083772418_1083772426 -4 Left 1083772418 11:64875700-64875722 CCAGTGACCAGGGGCCCACGGGC 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1083772426 11:64875719-64875741 GGGCAGAGGGCAGCTGGCCAGGG 0: 1
1: 0
2: 11
3: 91
4: 757

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083772418 Original CRISPR GCCCGTGGGCCCCTGGTCAC TGG (reversed) Intronic
900167865 1:1251116-1251138 GCACGTGGCCTCGTGGTCACAGG - Intergenic
900291011 1:1923605-1923627 CCCCGTGGGGCCCTGGACTCTGG + Intronic
900414464 1:2528609-2528631 GCCAGTGGCCCCCTGGACCCCGG - Intergenic
901082560 1:6591797-6591819 GCCAGAGGGTGCCTGGTCACAGG + Exonic
902512678 1:16974867-16974889 GCCCGAGGGCCCCAGATCCCAGG + Exonic
902605481 1:17566772-17566794 GCACTTGGTCCCCTGGTCATAGG - Intronic
902688813 1:18096862-18096884 GACTGTGGGTCCCTGGGCACCGG + Intergenic
905074350 1:35256570-35256592 GCCTGTGGGCACCTGGTGAGAGG + Intergenic
905416357 1:37807401-37807423 GCCCATGTGCCTCTGGTCTCAGG + Intronic
911356967 1:96834458-96834480 CCCTTTGGGTCCCTGGTCACTGG - Intergenic
913270040 1:117084207-117084229 GCCCGTGGGCCCTTGGGCAGAGG - Intronic
919832743 1:201553279-201553301 GCCCATGGGCCACTGAGCACAGG - Intergenic
921345446 1:214179274-214179296 GCCAGTGGGCCCTTGATCATTGG + Intergenic
922223483 1:223626437-223626459 GCCAGAGGGCAGCTGGTCACAGG + Intronic
924744302 1:246818211-246818233 GCCCGAGGGCCCCAGATCCCAGG - Intergenic
1063366220 10:5492675-5492697 GCCCGGGGGCAGCTGCTCACAGG - Intergenic
1064360232 10:14657697-14657719 GCCCGTGGCCTCTTGTTCACTGG + Intronic
1066010168 10:31187764-31187786 GCCCTTTAGCCCATGGTCACAGG - Intergenic
1067070052 10:43124668-43124690 GCCCGTGGGCCACTGTGCTCAGG - Intronic
1073111958 10:101067722-101067744 GCCCCTGGCGCCCTGGTGACCGG + Intronic
1073151359 10:101313796-101313818 GTCAGTGGGCCCCTGCTCACAGG - Intergenic
1075666538 10:124234565-124234587 GCACGTGGGGCCCTGGGCTCAGG + Intergenic
1075965731 10:126610073-126610095 GCCCTTGGACCCCTGTTCTCTGG + Intronic
1076057442 10:127387081-127387103 GCCCGAGGGCCAGAGGTCACGGG + Intronic
1076313154 10:129522303-129522325 TGCCTTGGGCCCCTGGACACAGG + Intronic
1077393108 11:2308857-2308879 GCCAGTGGGCACCTGGGGACTGG + Intronic
1077610879 11:3642487-3642509 CCCGGTCGGCCCCTGGTCCCCGG + Intergenic
1078233307 11:9461487-9461509 GCCCGTGGGCCCGGCGTCCCAGG - Intronic
1081603512 11:44511987-44512009 GCCCTTGACCTCCTGGTCACTGG - Intergenic
1083697069 11:64449970-64449992 CCCCGCTGGCCCCTGGTGACTGG + Exonic
1083772418 11:64875700-64875722 GCCCGTGGGCCCCTGGTCACTGG - Intronic
1084666714 11:70580353-70580375 GCTGGTGGCCCCCTGGACACTGG - Intronic
1085044554 11:73345453-73345475 GCCCCTGAGTCCCTGGTCAGAGG + Intronic
1089356954 11:117860208-117860230 GCCCTTGGGCCCCACCTCACAGG + Intronic
1090478645 11:127047981-127048003 GCCTGTTGGCACCTGGGCACGGG + Intergenic
1090828177 11:130402463-130402485 GCCCAGGTGCCCCTGGTCCCAGG - Intergenic
1094472257 12:30814209-30814231 GTCCCTGTCCCCCTGGTCACTGG + Intergenic
1094851076 12:34382668-34382690 GCCCGGGGTCCCCTGGACCCTGG + Intergenic
1095853080 12:46831580-46831602 GGATGTGGGCCCCTGGTCTCTGG - Intronic
1097337097 12:58395438-58395460 GCCCGTGGGCACCTGGCCTCTGG + Intergenic
1098154642 12:67584966-67584988 AGCCGTGGCCCCCAGGTCACAGG + Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1103427023 12:120844795-120844817 GCCCGTGGGCCCTTGGCCTCCGG - Intronic
1103480613 12:121247835-121247857 GCCGGCGGGCCCCTGGGCTCTGG - Intronic
1104993563 12:132640488-132640510 TTCCGGGGGGCCCTGGTCACAGG + Intronic
1106078930 13:26484614-26484636 GCACCTGTGCCCGTGGTCACAGG + Intergenic
1106539145 13:30674415-30674437 TCCCCTGGGTCCCTGGTTACTGG - Intergenic
1108496443 13:51030087-51030109 GCCCATGGTCACTTGGTCACAGG - Intergenic
1109291489 13:60480765-60480787 GCCTGTGGGGCCCTCCTCACTGG - Intronic
1113586852 13:111471638-111471660 CCTCGTGGGCCCCTGAGCACAGG + Intergenic
1113755687 13:112809097-112809119 GTCTGTGGGCCCCTGGTGCCTGG + Intronic
1117196296 14:53343015-53343037 TCCCCTGGGCCCCTTGCCACTGG + Intergenic
1119437829 14:74609677-74609699 CCCCAGGGGCCCCAGGTCACAGG + Intronic
1121743577 14:96270485-96270507 GCCCGCTGGGCCCTGGTGACAGG + Intergenic
1122093431 14:99354525-99354547 GCACCAGGGCCCCGGGTCACTGG + Intergenic
1122362159 14:101173965-101173987 GCCCGTGGGAACCTGGTGAGGGG - Intergenic
1129175655 15:73838032-73838054 GCCCTTGTTCCCCAGGTCACAGG - Intergenic
1129350115 15:74951117-74951139 GCCGGTGGGAGCCAGGTCACAGG - Intergenic
1129937417 15:79462476-79462498 GCAGATGGGCCCCTGGTCAGAGG - Intronic
1132320172 15:100919561-100919583 GCCCGCGGGCCCCTGCGCTCCGG + Intronic
1132504157 16:298366-298388 GGCCGGGGGCCCCTCGCCACCGG + Intronic
1133279315 16:4656080-4656102 GCCTGTGGAGCCCTGGCCACAGG + Intronic
1135745737 16:25015070-25015092 GCCCGTGCCCCGCTGGTCTCGGG + Intronic
1135904847 16:26502162-26502184 GCCAGTAGGCCTCTGGGCACAGG + Intergenic
1140811348 16:78581629-78581651 TCCCGTGGGCCCCTTTTCATTGG + Intronic
1141042069 16:80681298-80681320 ACCCTTGGGCCCCTGGAGACTGG + Intronic
1141869019 16:86771938-86771960 CCCCGTGTCCCCCTGGTGACAGG - Intergenic
1142808603 17:2384907-2384929 GCCCGGGGGCCACTGGCCTCAGG + Exonic
1143321128 17:6070112-6070134 GCCCGTGGGGCCCCGGTGAAAGG + Intronic
1145398549 17:22514189-22514211 GGCAGTGGGGCCCTGGGCACTGG - Intergenic
1146302060 17:31697162-31697184 GACAGTGAGCCCCTCGTCACTGG - Intergenic
1146884658 17:36463136-36463158 TCCCCTGGGGCCCTGCTCACGGG + Intergenic
1148641640 17:49192408-49192430 GCCCGTGGGGCCCCGGTCCAGGG + Intergenic
1151335165 17:73435403-73435425 GCCCGTGAGCCCCTCTTCCCAGG - Intronic
1151510060 17:74552757-74552779 GCACCTTGGCCCCTGGTCCCTGG - Intergenic
1152356073 17:79808107-79808129 GCCAGTGGGTCTCTGGTCTCAGG - Intergenic
1152468440 17:80477968-80477990 GCCCGTGGGTCCCTGCTGGCTGG - Intergenic
1152926124 17:83088553-83088575 GGCCCTGGGCACCTGCTCACTGG - Intronic
1155176631 18:23306916-23306938 GCCAGGCTGCCCCTGGTCACAGG + Intronic
1158137558 18:54224132-54224154 GCCCGGGGTCCCCTGGGCCCCGG + Exonic
1160987457 19:1845773-1845795 GCTCCTGGGCCCTGGGTCACAGG - Intronic
1161777464 19:6271433-6271455 GCCTGCGGCCCCCTGGTGACCGG + Intronic
1162396166 19:10419142-10419164 CCCCGTGCGCCCCCTGTCACGGG - Intronic
1162778792 19:12996040-12996062 GCGCGTGCGACCCTGGCCACCGG + Intronic
1163236246 19:16032178-16032200 GTCAGTGGGCGCCTGGTCAGCGG + Intergenic
1166288850 19:41848868-41848890 GCCCTTGGGTCCCTGGACACTGG + Exonic
1166495685 19:43301560-43301582 CCCTGGGGGCCCCTGGTCACTGG - Intergenic
1168173751 19:54608152-54608174 GCCCGTGGCCCTCTGGTGTCAGG + Intronic
924979313 2:206900-206922 GGCCCTGGGTCTCTGGTCACTGG - Intergenic
925745676 2:7041711-7041733 TCCTGTGGGCCACTGGACACAGG - Exonic
926104700 2:10142800-10142822 GCCCGCGGGCACCTGGGCTCAGG - Intronic
929591861 2:43152916-43152938 GCCTGTGGCCCCCAGGTAACCGG - Intergenic
933950337 2:87323462-87323484 GCCTGTGGGTCCCTGGACACCGG - Intergenic
934636352 2:95992579-95992601 GCCTGTGGGCCCTTGGGCGCTGG - Intergenic
936125606 2:109787112-109787134 GCCCATGGCCCCCTGGCCCCAGG - Intergenic
936219087 2:110584356-110584378 GCCCATGGCCCCCTGGCCCCAGG + Intergenic
936329851 2:111538134-111538156 GCCTGTGGGTCCCTGGACACCGG + Intergenic
937837894 2:126492501-126492523 CACCTTGGGCACCTGGTCACAGG - Intergenic
938120491 2:128629524-128629546 GCCAGTGGCCCCCTGGAGACAGG - Intergenic
944671276 2:201996238-201996260 CCACCTGGGCCCTTGGTCACCGG + Intergenic
945222792 2:207501998-207502020 GCACGTGGGGCCGTGGTCACAGG - Intergenic
947459184 2:230288163-230288185 GCCCCTGGGCCCCTGGGATCTGG - Intronic
948116024 2:235494618-235494640 GCCCGCGGGCCCCGGGGCGCGGG + Exonic
948578077 2:238966736-238966758 GCCAGTGCCCACCTGGTCACCGG - Intergenic
1169849611 20:10035087-10035109 GTCCATGGGCCCCGGGTCCCCGG - Exonic
1170571038 20:17632829-17632851 GCCCGTGTCCCCCTGGGGACAGG + Intronic
1172487051 20:35304657-35304679 TCTAGTGGGCCCCTGGTCAGTGG + Intronic
1175772909 20:61635031-61635053 GCCCGTCTGCCCGTGGACACTGG + Intronic
1179108518 21:38424920-38424942 GACCGTGGGCAACAGGTCACAGG + Intronic
1179961575 21:44770064-44770086 GCATGTGGGCCCCTGGGCCCAGG - Exonic
1180592947 22:16956238-16956260 TCCTGTGGGTCCCTGGTCCCAGG - Intergenic
1181162077 22:20965218-20965240 GCCCCGGGGACCCTGGTCCCCGG + Intronic
1181267913 22:21641992-21642014 GCCGGTGAGTCCCTGGACACCGG - Intergenic
1183536122 22:38402405-38402427 GCCCCGGGGCCCCTGAACACAGG + Intergenic
1183714420 22:39525383-39525405 AGCCCCGGGCCCCTGGTCACTGG - Intergenic
1184695588 22:46137202-46137224 TCCCGTGAGCCCCAGGGCACAGG + Intergenic
1185191274 22:49438082-49438104 GCCCGCAGGCTCCTGGTCAGAGG + Intronic
1185258899 22:49850618-49850640 GCCCGGTGACCACTGGTCACTGG - Intergenic
950741206 3:15053019-15053041 GCCCTAGGGCTCCTGGTGACAGG - Intronic
953391517 3:42536400-42536422 GCCCCCGGCCCCCTGGTCTCTGG + Exonic
954119588 3:48489109-48489131 GAATGTGGGCCGCTGGTCACAGG - Intronic
954810057 3:53242066-53242088 GCCCGTGTGACCCTAGTCCCAGG + Intronic
954884329 3:53858523-53858545 GCACGTGGGTCTCGGGTCACTGG + Intronic
959677243 3:109050148-109050170 GACTGTGGGCTCCTGGCCACTGG + Intronic
961269859 3:125680565-125680587 GCCTGATGGCCCCTGGTGACAGG - Intergenic
961749493 3:129087043-129087065 GGCCCTGAGCCCCTGGACACTGG + Intergenic
965414603 3:168377120-168377142 GCCTGTGGTCACCTGGACACAGG - Intergenic
966599138 3:181757859-181757881 GCCCTTGCTCCTCTGGTCACTGG - Intergenic
966886609 3:184380606-184380628 GCCCGCGGGTCCCGGGTCCCAGG - Intronic
966914008 3:184575119-184575141 ACCCTTGGGCCCCTGGACACAGG - Intronic
968279654 3:197466751-197466773 GCACGTGGGCAGCTGGTCATGGG + Intergenic
968952510 4:3702294-3702316 TCCCGTGGCCCCCAGGTCTCAGG + Intergenic
985619933 5:948897-948919 CCCCGTGGGCCCCTCCTCACTGG + Intergenic
992493262 5:77266644-77266666 TCCTGTGAGCCTCTGGTCACAGG - Intronic
999230993 5:150061639-150061661 GCCCATGGGCCCTTGGACAGAGG - Intronic
999303931 5:150507905-150507927 GCCAGTGGTTCCCTGGGCACGGG + Intronic
999328204 5:150656492-150656514 GCCCGTGGGAGCCAGGTCGCGGG + Intronic
1001438240 5:171717924-171717946 GACTGTGGGACCCTGGTCACTGG - Intergenic
1002461017 5:179373893-179373915 GCCTGTGGGGCCCTGCTCTCAGG - Intergenic
1002593273 5:180305611-180305633 GCCCATGGTCCTCTGGTCACTGG - Intronic
1002633733 5:180596912-180596934 CCCCGTGGGCCCTCGGGCACTGG + Intergenic
1003365637 6:5472199-5472221 GCCTGTGGGCCGCATGTCACTGG + Intronic
1006943693 6:37769976-37769998 ACCAAAGGGCCCCTGGTCACAGG + Intergenic
1016050193 6:139522519-139522541 ACCCCTGGTCCCCTGGCCACCGG + Intergenic
1017879152 6:158547760-158547782 GCCCCCGGGCCACTGGTCCCTGG + Intronic
1018545867 6:164934660-164934682 GTCCGTGAGCCCCTGGACATGGG + Intergenic
1018901252 6:168052815-168052837 GCCCCCGGGCCACTGGGCACAGG - Intergenic
1019153632 6:170024509-170024531 GCCCGGGTGCCCCTGATCCCAGG + Intergenic
1019658243 7:2209433-2209455 GCCTGAGGGCCCCAGGACACTGG + Intronic
1020818799 7:12939866-12939888 GCCCATGGAGCCTTGGTCACTGG - Intergenic
1024623457 7:51183845-51183867 GCCTGTGGGCTCCTGATGACCGG - Intronic
1026360400 7:69597935-69597957 GCGTGTGGGCCCCTGCTCCCAGG - Intergenic
1029653929 7:101912059-101912081 ACCTGCGGGCCCCTGGTCCCAGG - Intronic
1032316379 7:130842340-130842362 CCCCTTGGGCCCGTGCTCACGGG - Intergenic
1033227478 7:139573069-139573091 ACCCGGGGGCCCATGCTCACGGG + Exonic
1035153297 7:156892845-156892867 GCCCCCGGGCCCCCGGTCCCCGG - Intronic
1035261858 7:157667036-157667058 GCCCGTGGGACACTGATCTCAGG + Intronic
1035261888 7:157667276-157667298 GCCCGTGGGACACTGATCTCAGG + Intronic
1035261898 7:157667336-157667358 GCCCGTGGGACACTGATCTCAGG + Intronic
1035351208 7:158247495-158247517 GCTCGTGGGCAGCTGGGCACTGG + Intronic
1035459319 7:159029581-159029603 GCCTGCGGGCCCCTGGTGATGGG - Exonic
1037796408 8:21998983-21999005 TCCAGTAGGCCCCTGGTGACAGG - Intronic
1039603052 8:38857946-38857968 GTCCCAGGGCCCCAGGTCACAGG - Intergenic
1049710193 8:144059942-144059964 GCACGTGCCCCCCTGGGCACTGG + Exonic
1056710845 9:88991198-88991220 GCCCTTCGGCCCCTGTTCCCAGG - Exonic
1058885694 9:109320241-109320263 GGCGGCGGGCCCCTGCTCACCGG - Exonic
1061199842 9:129131451-129131473 GCCCCTGGGCACCTGCCCACTGG + Intronic
1061250821 9:129425366-129425388 GCCCCTGGGCCTTTGCTCACAGG + Intergenic
1061744645 9:132730638-132730660 CCCAGTGTGGCCCTGGTCACTGG + Intronic
1062114882 9:134802949-134802971 GCCCGGAAGCCCCTGTTCACCGG - Exonic
1062533138 9:137010457-137010479 GCACGTGGCCCCCTGGGCTCTGG - Intronic
1186452873 X:9687880-9687902 CCCCGTGGCCCCCTGGTTGCTGG + Intronic
1188040913 X:25369266-25369288 GTCCTTAGGCCCCTGGTCAGTGG + Intergenic
1192498087 X:71629607-71629629 GCCTGAGGGCCCCAGGTGACAGG + Intergenic
1196782981 X:119399555-119399577 GACCGTGGGCCACAGGGCACCGG + Exonic
1198266539 X:135014355-135014377 GCCTGTAGGCCCCTGGTGAAGGG + Intergenic
1199602270 X:149548683-149548705 GCCACTGGGCCCCTGAACACTGG + Intronic
1199648117 X:149930792-149930814 GCCACTGGGCCCCTGAACACTGG - Intronic