ID: 1083773089

View in Genome Browser
Species Human (GRCh38)
Location 11:64879046-64879068
Sequence TCCAGCTGGCTCGGAATCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 207}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083773080_1083773089 6 Left 1083773080 11:64879017-64879039 CCGCGCCCGCCGTTCGCCACGTG 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1083773089 11:64879046-64879068 TCCAGCTGGCTCGGAATCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 207
1083773083_1083773089 0 Left 1083773083 11:64879023-64879045 CCGCCGTTCGCCACGTGCGGTCC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1083773089 11:64879046-64879068 TCCAGCTGGCTCGGAATCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 207
1083773086_1083773089 -10 Left 1083773086 11:64879033-64879055 CCACGTGCGGTCCTCCAGCTGGC 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1083773089 11:64879046-64879068 TCCAGCTGGCTCGGAATCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 207
1083773076_1083773089 27 Left 1083773076 11:64878996-64879018 CCCTGGTTCCCTGACTACGCGCC 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1083773089 11:64879046-64879068 TCCAGCTGGCTCGGAATCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 207
1083773084_1083773089 -3 Left 1083773084 11:64879026-64879048 CCGTTCGCCACGTGCGGTCCTCC 0: 1
1: 0
2: 1
3: 1
4: 44
Right 1083773089 11:64879046-64879068 TCCAGCTGGCTCGGAATCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 207
1083773078_1083773089 19 Left 1083773078 11:64879004-64879026 CCCTGACTACGCGCCGCGCCCGC 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1083773089 11:64879046-64879068 TCCAGCTGGCTCGGAATCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 207
1083773077_1083773089 26 Left 1083773077 11:64878997-64879019 CCTGGTTCCCTGACTACGCGCCG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1083773089 11:64879046-64879068 TCCAGCTGGCTCGGAATCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 207
1083773079_1083773089 18 Left 1083773079 11:64879005-64879027 CCTGACTACGCGCCGCGCCCGCC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1083773089 11:64879046-64879068 TCCAGCTGGCTCGGAATCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 207
1083773082_1083773089 1 Left 1083773082 11:64879022-64879044 CCCGCCGTTCGCCACGTGCGGTC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1083773089 11:64879046-64879068 TCCAGCTGGCTCGGAATCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083773089 Original CRISPR TCCAGCTGGCTCGGAATCCC CGG Intronic
901053397 1:6437247-6437269 TCCGGCTGGCTGGGCACCCCTGG + Intronic
902245525 1:15118214-15118236 TCCATCTGCCTCCAAATCCCAGG + Intergenic
902711557 1:18243447-18243469 TTCAGCTGGCTTGGAGGCCCAGG - Intronic
904330580 1:29755653-29755675 TCCAACAGGCACAGAATCCCGGG - Intergenic
907154613 1:52322249-52322271 TCCAGCTGCCTCTCAATCCTGGG + Intronic
908808223 1:67952607-67952629 TCCTTTTGGCTCTGAATCCCTGG - Intergenic
911101071 1:94096228-94096250 GCCAGCTGACTCAGAATCTCTGG + Intronic
911665536 1:100547180-100547202 TCCAGCTGACTCAAAAGCCCAGG + Intergenic
912570430 1:110617311-110617333 TCCATCTGGCGCAGAGTCCCTGG - Intronic
916209724 1:162350445-162350467 TCCACCTGGCTTGGAGTCCCAGG - Intronic
917427877 1:174934328-174934350 TCCACCTGCCTCGGCCTCCCAGG + Intronic
918302717 1:183218768-183218790 ACCAGCTGGCTCCAAATCCCAGG + Intronic
921715128 1:218409973-218409995 TCCACCAGGTTTGGAATCCCTGG + Intronic
923126586 1:231039647-231039669 CCCCGCTGGCTCGGAAACCTGGG - Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924798176 1:247308128-247308150 TCCAGCTCACTCCCAATCCCAGG - Intronic
1062826845 10:576209-576231 TGCAGCTGCCTGGGAGTCCCAGG - Intronic
1063034218 10:2269280-2269302 TTCAGCTGCCTCAGCATCCCTGG - Intergenic
1063457152 10:6191898-6191920 TCCAGGTGGCTCGGACACCCTGG + Intronic
1065833963 10:29640425-29640447 ACCAGCAGGCTCGGAGTCCTGGG - Intronic
1066049396 10:31620304-31620326 CCCAGCTGGCTCTCAACCCCTGG + Intergenic
1066182939 10:32981095-32981117 GCCAGCTGTATCGGATTCCCAGG - Intronic
1067322706 10:45237128-45237150 TCCAGCTGCCTTGGCCTCCCAGG + Intergenic
1069476989 10:68743404-68743426 TCCACCTGCCTCGGCCTCCCAGG + Intronic
1072793316 10:98335323-98335345 GCCAACTGGCTCTGAGTCCCTGG + Intergenic
1072891375 10:99328358-99328380 TCCATCTGCCTCGGCCTCCCAGG - Intergenic
1074235272 10:111578447-111578469 TCCAGCTGGGTGGGACACCCAGG + Intergenic
1074998565 10:118778612-118778634 TGCAACTGGGTCAGAATCCCAGG + Intergenic
1076023677 10:127094542-127094564 TCCAGCTGCCTCGCTGTCCCAGG - Intronic
1077250735 11:1559546-1559568 TCCAGCTGGCTGGGAGCCCCAGG + Intronic
1081530007 11:43951756-43951778 TCCACCTGACTCGGCCTCCCAGG - Intergenic
1083773089 11:64879046-64879068 TCCAGCTGGCTCGGAATCCCCGG + Intronic
1084428335 11:69097664-69097686 TCCAGCTGAATCGGGCTCCCTGG + Intergenic
1084434642 11:69131777-69131799 GCCTGCTGGCTGGGAATTCCTGG + Intergenic
1089324648 11:117648775-117648797 TCCAGGTGGCCCAGAATCCAAGG + Intronic
1089372811 11:117973224-117973246 TACAGCTGGCTTGTAAGCCCAGG - Intergenic
1089715236 11:120353024-120353046 TCCAGCAAGCTCAGAATCTCAGG + Intronic
1090658029 11:128860751-128860773 GCCAGGTGGCTCTGAAACCCAGG + Intronic
1091564906 12:1641035-1641057 GCCAGCTGGCTCTGGTTCCCAGG + Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1096051728 12:48615500-48615522 TCCACCTGCCTCGGCCTCCCAGG - Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1098985446 12:77007096-77007118 TCAATCTGGCTCTGAATGCCAGG + Intergenic
1100384361 12:94091804-94091826 TGGAGCTGGCTTGGAAGCCCTGG + Intergenic
1101592013 12:106133166-106133188 TCCAGGTGGCTTGGAATGCAGGG - Intronic
1102305869 12:111804098-111804120 TCCAGCAGGCCCTGAGTCCCCGG - Intronic
1103990897 12:124798598-124798620 TCCACCCGCCTCGGACTCCCAGG - Intronic
1104537308 12:129630124-129630146 CCCAGCTGGCCTGGAACCCCTGG + Intronic
1112990894 13:105512831-105512853 TCCACCTGCCTCGGCCTCCCAGG + Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116802041 14:49453436-49453458 TCAAGCTGGCTCCACATCCCAGG - Intergenic
1117640987 14:57799422-57799444 GCCACCTCGCTGGGAATCCCGGG - Intronic
1118690751 14:68337644-68337666 ACCAGCTGAATCAGAATCCCTGG + Intronic
1119130525 14:72168372-72168394 TCCTGATGGCGGGGAATCCCAGG + Intronic
1119395978 14:74326707-74326729 TCCAGCTGTCTAGCACTCCCTGG - Intronic
1122702355 14:103598445-103598467 TCCAGTTGGCTCTGAGTCCTGGG + Intronic
1122940304 14:104978188-104978210 CCCACCTGGCCCGGAACCCCCGG - Exonic
1124568070 15:30834380-30834402 TCCAGCTAGCTACGTATCCCGGG + Intergenic
1128494965 15:68192451-68192473 ACCATCTGGCTGGGAAGCCCAGG - Exonic
1129122388 15:73408471-73408493 TCCTGCTGAGTCAGAATCCCTGG + Intergenic
1130297820 15:82659644-82659666 TCCAGCTGGCCGGGCATCCAGGG + Exonic
1134138196 16:11694380-11694402 TCCACCTGCCTCGGCCTCCCAGG + Intronic
1134820653 16:17244236-17244258 TCGACCTGGGTCAGAATCCCTGG + Intronic
1135740086 16:24967678-24967700 TCCTTCTGCCTCGGCATCCCAGG - Intronic
1136228020 16:28872045-28872067 GCCAGCTCCCTCGGGATCCCAGG - Intronic
1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG + Intergenic
1139201336 16:64980577-64980599 TCCTGCTGTCTCCTAATCCCTGG - Intronic
1140299065 16:73738812-73738834 TCCAGCTGACATGGAAGCCCGGG - Intergenic
1142036060 16:87862709-87862731 GCCAGGTGTCTGGGAATCCCAGG - Intronic
1142064076 16:88050396-88050418 TCCACCTGCCTCGGCCTCCCAGG + Intronic
1142266675 16:89067102-89067124 TCCAGCTGACGGGGAAGCCCCGG - Intergenic
1143754044 17:9053566-9053588 TCCAGCAGATTCGGATTCCCTGG + Intronic
1145193340 17:20866921-20866943 TCCAGCTGGCCAGGAATTGCTGG + Intronic
1145298680 17:21614160-21614182 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1145351599 17:22089130-22089152 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1145403758 17:22568935-22568957 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1145723168 17:27090896-27090918 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1147292010 17:39451130-39451152 ACAAGTTGGCTCGGGATCCCGGG + Exonic
1147617296 17:41836964-41836986 TCCAGCGGGCTGGGAGACCCGGG + Intronic
1148593223 17:48831919-48831941 TCCAGATGGCTCAGTTTCCCAGG + Intronic
1150604873 17:66682133-66682155 TGCAGGTGGCTCGGGAACCCAGG - Intronic
1151736794 17:75947487-75947509 TCCACCTGCCTCGGCCTCCCAGG + Intronic
1151988283 17:77557885-77557907 GCCAGCTGGCGGGGAATCACGGG + Intergenic
1152408203 17:80109211-80109233 TCTGGCCGGCTCTGAATCCCTGG + Intergenic
1152873951 17:82775102-82775124 GCGCGCTGGCTCGGGATCCCGGG + Intronic
1152880286 17:82810722-82810744 TCCAGCTTGCTCAGGACCCCGGG + Intronic
1153444485 18:5156038-5156060 TCCAGCTGCTTCGGAACTCCTGG - Intronic
1154302506 18:13206836-13206858 TCCAGCTGCCCAGGAATTCCAGG - Intergenic
1155611743 18:27674192-27674214 TCCAGCTGGCTGGCAAGCGCCGG + Intergenic
1156609186 18:38706574-38706596 TCCAGCTGCCTCTGAAGCCTTGG - Intergenic
1157223599 18:45843634-45843656 TCCACCTGCCTCGGCCTCCCAGG - Intronic
1157657801 18:49409040-49409062 TCCACCTGCCTCGGCCTCCCAGG - Intronic
1160712166 19:557198-557220 TCCAGCTGCCTGAGAATCCTGGG - Intergenic
1160901178 19:1429470-1429492 TCCAGCAGCCACGGAACCCCTGG + Intronic
1160983359 19:1826773-1826795 TCCAGTTGGCTCGGAGGCACGGG - Intronic
1162584781 19:11552087-11552109 TTGAGCTGGCCCGGAAGCCCTGG - Intronic
1162943836 19:14030832-14030854 CCCAGCTGGCAAGGAACCCCTGG + Exonic
1163180953 19:15601376-15601398 TCCACCTGCCTCGGCCTCCCAGG + Intergenic
1166370324 19:42296689-42296711 TCCACCTGCCTCGGCCTCCCAGG - Intergenic
1167557447 19:50205215-50205237 TCCAGCGGGGTTTGAATCCCGGG + Intronic
1167745013 19:51345556-51345578 TCCTGCTGGCTAGGAGGCCCTGG + Intronic
1202714916 1_KI270714v1_random:36821-36843 TCCGGCTGGCTGGGCACCCCTGG - Intergenic
925288578 2:2731357-2731379 TCCAGCTGGCTCCCAAGGCCTGG - Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
936239418 2:110773973-110773995 TCCAGCTGCACTGGAATCCCAGG - Intronic
938179309 2:129165266-129165288 TCCAGCTGTCTTGGTCTCCCTGG - Intergenic
938385747 2:130865796-130865818 TCCAGCTGGCTCTTGATCTCAGG + Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
945290528 2:208122618-208122640 TCCACCTGCCTCGGCTTCCCAGG - Intronic
946433034 2:219635615-219635637 TCCCTCTGGCTCGGAGGCCCCGG - Intronic
947051476 2:226048714-226048736 TCCAGCAGGGTCAGAATCCCTGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947444573 2:230154357-230154379 TGCAGATGGCACGGAACCCCTGG + Intergenic
947884673 2:233557903-233557925 TCCTGCTGCCTCGGCCTCCCAGG - Intronic
948621789 2:239239949-239239971 TCCAGCTGGCTGGGGCTCACGGG - Intronic
1169049582 20:2564634-2564656 TCCAGCTGGCTGGAAGTCTCAGG + Intronic
1169204754 20:3733264-3733286 TCAAGCTGGCCCGGAAGACCAGG - Intronic
1170938103 20:20827114-20827136 TGCAGCTGGCTGGGAGTTCCAGG - Intergenic
1171390028 20:24795333-24795355 TCCAGCAGTCTGGGAACCCCAGG - Intergenic
1172963295 20:38814037-38814059 TCCACCCGGCTCGGCCTCCCAGG + Intronic
1174400652 20:50274066-50274088 CCCAGCTGGCTGGGAGTCTCAGG - Intergenic
1179369595 21:40792380-40792402 TCCACCTGCCTCGGAATTACAGG + Intronic
1179435894 21:41361840-41361862 TCCAGCTGCATCCGAATCCTGGG - Intergenic
1184210583 22:43033117-43033139 TCCACCTGCCTCGGCCTCCCAGG - Intergenic
1184910679 22:47531914-47531936 TCAAGCTGGGTCTGAGTCCCAGG - Intergenic
1185071962 22:48661541-48661563 TCCAGCAGGCTCTGAACCCAGGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950140022 3:10609006-10609028 TCAAGGTGGCCCGGAATTCCGGG - Intronic
952301779 3:32109759-32109781 TCCAGCTGTGTCTGCATCCCTGG - Intronic
952519813 3:34145419-34145441 ACCTGCTGGCTTGGATTCCCAGG + Intergenic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
954725221 3:52602501-52602523 TCCAGCTGGCTGGGAATGTGTGG + Intronic
956182311 3:66528878-66528900 CCAAGCTGGCTCGGACTCCGGGG - Intergenic
956247204 3:67197255-67197277 TCCACCTGCCTCGGCCTCCCAGG + Intergenic
956462753 3:69487724-69487746 TCCAACTGCCTCAGCATCCCTGG - Intronic
956684856 3:71816543-71816565 TCCTGCTGGCTCCAATTCCCTGG - Intergenic
957074055 3:75587830-75587852 TCCAGCTGGCAGGGAAGCGCCGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960705283 3:120475429-120475451 TTCTGCTGGCTCCAAATCCCGGG + Intergenic
960722988 3:120642842-120642864 ACCAGCTGGCTAGGGAGCCCGGG + Intronic
961748638 3:129082189-129082211 TCCAGATGGCACCGAGTCCCTGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
962984454 3:140521936-140521958 TCCACCTCGCTGGGAATCCCAGG + Intronic
963054891 3:141178104-141178126 ACCAGCTGGCCCTGAATGCCTGG - Intergenic
967519198 3:190408424-190408446 TCCTGTTGGCTCGGAATGGCTGG + Exonic
967875625 3:194266627-194266649 TCCAGCTGTCTCTGATTCCATGG + Intergenic
969491957 4:7504581-7504603 TCCATCTGGCTCTGGACCCCAGG + Intronic
974492493 4:62585210-62585232 TCCAGCTGGTTTGGAACTCCTGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
981713679 4:147732587-147732609 CCCAGCTCTCTCGGAACCCCGGG + Intronic
982628781 4:157804512-157804534 TAAAGCTGGCTCAGAATCCCTGG - Intergenic
982738359 4:159030737-159030759 TCCACCTGCCTCGGCCTCCCAGG + Intronic
983093603 4:163536742-163536764 TCCCCCTGGCTCAGATTCCCAGG - Intronic
983665664 4:170179618-170179640 TCCAACTGACTCAGAATCTCTGG - Intergenic
983995309 4:174175189-174175211 TCCACCTGCCTCGGCCTCCCAGG - Intergenic
985759476 5:1737720-1737742 TGCAGCTGGCTCGGGGTCTCTGG - Intergenic
985795695 5:1960323-1960345 TCCCGCTGGCTCTGAGGCCCTGG - Intergenic
985938561 5:3115384-3115406 TCCACCCGTCTCGGACTCCCAGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
988357390 5:30196615-30196637 TCCAGCTTGCTATGAAACCCTGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
998095827 5:139395029-139395051 GGCAGCTGCCTCGGGATCCCAGG + Exonic
998530259 5:142877759-142877781 TCCAACTAACTCAGAATCCCTGG - Intronic
1000171050 5:158703659-158703681 TCCAGCTGGCTTTGTCTCCCAGG - Intronic
1001403489 5:171460320-171460342 TCCAGCTGGGTAGGAACCCCAGG + Intergenic
1001539782 5:172529743-172529765 TGTAGCTGGGTAGGAATCCCAGG + Intergenic
1002073459 5:176694457-176694479 ACCAGCTGGCTCGTGCTCCCAGG + Intergenic
1003030263 6:2595344-2595366 TCCAGCAGTCTGGGAATGCCAGG + Intergenic
1003105557 6:3212374-3212396 CCCCGCTGGCTTGGAACCCCTGG + Intergenic
1004393461 6:15228271-15228293 TCCACCTGCCTCGGCCTCCCAGG - Intergenic
1004633724 6:17446884-17446906 CCCAGCTGCCTGGGAATCCACGG + Intronic
1006519596 6:34563577-34563599 TCCAGCTTGCTCAGAAACTCAGG + Intergenic
1006861084 6:37171656-37171678 TTCAGCTGGCTGAAAATCCCCGG - Intronic
1008483645 6:52012088-52012110 ATCAGCTGGATCTGAATCCCGGG + Intronic
1012446790 6:99314989-99315011 TCCACCTGCCTCGGCTTCCCAGG - Intronic
1013282596 6:108652843-108652865 TTCAGTTGGCTCAGAGTCCCAGG - Intronic
1013951124 6:115782977-115782999 AGCTGCTGGCTCAGAATCCCAGG + Intergenic
1014211895 6:118716903-118716925 TCCACCCGCCTCGGACTCCCAGG - Intergenic
1015665725 6:135626357-135626379 TCCAGCTGACCCAGAAGCCCAGG + Intergenic
1017028456 6:150200877-150200899 TCCAGCTGGCTGTGGATACCAGG + Intronic
1017082326 6:150681741-150681763 TCAAGTTGGCTCCGAATCGCTGG - Intronic
1019514753 7:1434784-1434806 TCCTGCAGGCTCGGAGGCCCAGG - Intronic
1019517168 7:1445161-1445183 TGCAGCTGGAACGGAAGCCCTGG + Exonic
1022904041 7:34838529-34838551 TCCAGCTGGGTCCGCATGCCAGG + Intronic
1023960131 7:44919594-44919616 TACAGCTGGCTGGAAATCGCAGG + Intergenic
1024694990 7:51846791-51846813 TCCAGCTTGCAGGGATTCCCAGG + Intergenic
1025275970 7:57581278-57581300 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1026013151 7:66652700-66652722 TCCACCTGTCTCAGCATCCCAGG - Intronic
1027218121 7:76197191-76197213 TCTACCAGTCTCGGAATCCCAGG - Intergenic
1028668647 7:93375606-93375628 TCCAGCTGGCAAGGAAACCTAGG - Intergenic
1033619920 7:143052759-143052781 TCCAGCTGGCTGGGGCTGCCTGG + Exonic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035662020 8:1355603-1355625 TCCACCTGTCTCGGCCTCCCAGG + Intergenic
1036228872 8:6982861-6982883 TCCAGCTGGCTCAGAGTCACTGG + Intergenic
1036231325 8:7001966-7001988 TCCAGCTGGCTCAGAGTCACTGG + Intronic
1036233778 8:7021062-7021084 TCCAGCTGGCTCAGAGTCACGGG + Intergenic
1036427344 8:8657010-8657032 TCCAGCTGCCTTGCTATCCCTGG - Intergenic
1038781717 8:30573874-30573896 TCCAGCTGAGTCTGAAGCCCAGG - Intergenic
1040840638 8:51780900-51780922 TCCACCTGCCTCGGCCTCCCAGG + Intronic
1045095142 8:98789782-98789804 TCCACCTGCCTCGGCCTCCCAGG - Intronic
1045736398 8:105300859-105300881 TCCACCTGCCTCGGCCTCCCAGG - Intronic
1048547322 8:135399215-135399237 CCCAGCTGGCATGGAATGCCAGG + Intergenic
1049074188 8:140380960-140380982 TCCACCTGCCTCGGCCTCCCAGG - Intronic
1049998408 9:1051827-1051849 TCCGGCTGGCCGGGCATCCCGGG - Exonic
1050589957 9:7150484-7150506 CCCAGCTGGATCTGAATCCTTGG + Intergenic
1053361269 9:37488321-37488343 CACAGCTGGATGGGAATCCCAGG - Intronic
1055876748 9:80952698-80952720 CCCAGCCTGCTCTGAATCCCAGG + Intergenic
1057379155 9:94553550-94553572 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1059282534 9:113147376-113147398 TCCAGCTGCCCGGGACTCCCAGG - Intergenic
1059376152 9:113883210-113883232 TACAGCTGGCTCTGAAGCCATGG + Intronic
1060498144 9:124132927-124132949 TCAGGAAGGCTCGGAATCCCGGG + Intergenic
1060779480 9:126400927-126400949 TCCAGCTGGCTAGGATTTTCGGG + Intronic
1061178706 9:129011897-129011919 TCCTGCTGTCTCTGAATGCCAGG - Intronic
1062080278 9:134620073-134620095 GCCAGCTGGCCGGGAAACCCTGG - Intergenic
1188881779 X:35499307-35499329 TCCCGCTGGCTCGCAAGCGCCGG - Intergenic
1190232404 X:48592454-48592476 TTCCGCTGGCTCTGAATCCGTGG + Intronic
1193292590 X:79793133-79793155 TCCAGCTGCCTTGGAGTCTCTGG + Intergenic
1195212389 X:102661890-102661912 TCTAGCTGGCTGGGAATCCAAGG + Intergenic
1195328904 X:103780601-103780623 TCCAGCAGGCTTGGATTCCCAGG + Intronic
1196753785 X:119140284-119140306 TCCACCTGCCTCGGCCTCCCAGG - Intronic
1199380311 X:147164953-147164975 GCCAGTTGGCTTAGAATCCCTGG - Intergenic
1200215982 X:154368502-154368524 TCCAGCTGGCCCAGAATCCAGGG + Intronic