ID: 1083775668

View in Genome Browser
Species Human (GRCh38)
Location 11:64893361-64893383
Sequence CCTAGGACAGGGAGGGCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083775651_1083775668 24 Left 1083775651 11:64893314-64893336 CCTCAGGATTGGCCACCCTTCAG No data
Right 1083775668 11:64893361-64893383 CCTAGGACAGGGAGGGCGGCAGG No data
1083775656_1083775668 9 Left 1083775656 11:64893329-64893351 CCCTTCAGAGAGGTGCCTGGGTT No data
Right 1083775668 11:64893361-64893383 CCTAGGACAGGGAGGGCGGCAGG No data
1083775653_1083775668 12 Left 1083775653 11:64893326-64893348 CCACCCTTCAGAGAGGTGCCTGG No data
Right 1083775668 11:64893361-64893383 CCTAGGACAGGGAGGGCGGCAGG No data
1083775659_1083775668 -6 Left 1083775659 11:64893344-64893366 CCTGGGTTCAGGAGCCTCCTAGG No data
Right 1083775668 11:64893361-64893383 CCTAGGACAGGGAGGGCGGCAGG No data
1083775657_1083775668 8 Left 1083775657 11:64893330-64893352 CCTTCAGAGAGGTGCCTGGGTTC No data
Right 1083775668 11:64893361-64893383 CCTAGGACAGGGAGGGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083775668 Original CRISPR CCTAGGACAGGGAGGGCGGC AGG Intergenic
No off target data available for this crispr